Literature DB >> 34354222

Vaginal microbiome Lactobacillus crispatus is heritable among European American women.

Michelle L Wright1,2, Jennifer M Fettweis3,4,5, Lindon J Eaves6, Judy L Silberg6,7, Michael C Neale6, Myrna G Serrano3,5, Nicole R Jimenez3,5, Elizabeth Prom-Wormley8, Philippe H Girerd4,5, Joseph F Borzelleca4, Kimberly K Jefferson3,5, Jerome F Strauss4,5, Timothy P York9,10, Gregory A Buck3,5,11.   

Abstract

The diversity and dominant bacterial taxa in the vagina are reported to be influenced by multiple intrinsic and extrinsic factors, including but not limited to pregnancy, contraceptive use, pathogenic states, socioeconomic status, and ancestry. However, the extent to which host genetic factors influence variation in the vaginal microbiota is unclear. We used a biometrical genetic approach to determine whether host genetic factors contribute to inter-individual differences in taxa from a sample of 332 twins who self-identified as being of African (44 pairs) or European ancestry (122 pairs). Lactobacillus crispatus, a major determinant of vaginal health, was identified as heritable among European American women (narrow-sense heritability = 34.7%, P-value = 0.018). Heritability of L. crispatus is consistent with the reduced prevalence of adverse reproductive disorders, including bacterial vaginosis and preterm birth, among women of European ancestry.
© 2021. The Author(s).

Entities:  

Mesh:

Year:  2021        PMID: 34354222      PMCID: PMC8342574          DOI: 10.1038/s42003-021-02394-6

Source DB:  PubMed          Journal:  Commun Biol        ISSN: 2399-3642


Introduction

Differences in microbial diversity and predominant bacteria of the vaginal microbiome have been reported to be related to pregnancy[1], vaginal infections[2,3], contraceptive use[4], preterm birth[5-8], menopause[9], and ethnic/racial background[10-13]. Women harboring more complex vaginal microbiomes are more likely to have bacterial vaginosis, higher susceptibility to sexually transmitted diseases, pelvic inflammatory disease, and premature birth[14]. Yet, the contribution of host genetic factors to shaping the vaginal microbiota is largely unknown. Overall, studies published to date suggest there are not broad host genetic influences, but rather genetic factors contribute to presence of specific microbes associated with clinical conditions. Twin studies of gut microbiome composition in monozygotic (MZ) and dizygotic (DZ) twin pairs show[15,16] that some bacteria appear to be heritable and associate with a clinical phenotype[15]. One study reports that the vaginal microbiomes of MZ twins (n = 26, 13 pairs) are more similar to each other than to their mothers (n = 8) or sisters (n = 8)[9]. Yet, this study does not adequately distinguish host genetic from other shared familial influences. Another study evaluating the vaginal microbiome among Korean twins and selected relatives (N = 542, 111 MZ and 28 DZ pairs), reports Prevotella as the most heritable bacterial taxon in the vaginal microbiome[17]. However, most of the taxa are reported at the genus level. Given the importance of species-level differences to women’s health outcomes, further studies with improved resolution among more diverse cohorts are warranted. The estimation of a genetic contribution to inter-individual differences in phenotypic trait measurements was proposed over a century ago[18]. The subsequent development of methods to partition a trait of interest into separate genetic and environmental contributions using genetically informative twin and family samples remains an important tool in the genomics era[19]. Heritability is a technical term that refers to the proportion of phenotypic variance of a trait measured in a population that can be accounted for by genetic sources. A meta-analysis of over 17,804 human traits from 2748 twin studies report an average heritability of 49%, and a subset of reproductive traits at an average heritability of 31%[20]. The utility of this summary ratio of genetic variance to the total phenotypic variance not only expresses the extent of genetic influence but also allows for meaningful comparisons across traits. An accurate representation of the genetic architecture of species-level vaginal microbiota requires heritability estimates across different populations. Evaluating host genetic and environmental contributions to the vaginal microbiome composition has unique challenges compared to other microbiome sites due to the sparsity of data and relatively few numbers of taxa present across all women within the vagina. Vaginal microbiomes of ~60–90% of reproductive aged women are predominantly composed of Lactobacillus species[10,11,13]. High proportions of specific species within vaginal microbial communities are associated with vaginal health (e.g., Lactobacillus crispatus) and adverse clinical conditions (e.g., Gardnerella vaginalis with bacterial vaginosis). Previous studies consistently report different proportions of predominant taxa by self-reported ancestry[10,11,13]. For example, L. crispatus is more prevalent among women of European ancestry, whereas Lactobacillus iners is the most prevalent Lactobacillus species among women of African ancestry[10,11]. The goal of this study was to estimate the contribution of host genetic factors to species-level variation in microbial taxa of the vagina using a biometrical genetic approach. Differences in these estimates by self-reported ancestry were considered due to consistently reported heterogeneity in vaginal microbiome composition between ancestry groups, including our previous studies[10,12].

Results

A total of 380 mid-vaginal wall swabs were obtained from self-identified MZ or DZ twin participants (Table 1). Thirty-four samples were collected from only one member of a twin pair and not included in these analyses. There were 332 twins of self-identified African (44 pairs) or European ancestry (122 pairs). There was a higher proportion of African American DZ than MZ twins (chi-square = 5.21, P value = 0.022). Participants ranged in age from 18 to 78 years old (median = 36). The median BMI of all participants was 27 (range = 17–50), and the mean was higher among African American participants (t-test = 4.45, P value < 0.001). In this sample African American participants were more often diagnosed with bacterial vaginosis (chi-square = 9.48, P value = 0.002), while more European American participants reported active smoking at the time of assessment (chi-square = 6.66, P value = 0.010).
Table 1

Reproductive health characteristics of twin participants by self-reported ancestry.

VariableEuropean ancestry (N = 244)African ancestry (N = 88)P value
Zygosity (%)
  MZ168 (69)48 (55)
  DZ76 (31)40 (45)0.0224
BMI
  Minimum18.0017.00
  Median (IQR)25.10 (21.00, 31.02)30.90 (25.30, 36.00)
  Mean (sd)26.84 ± 6.7430.95 ± 7.020
  Maximum50.0049.00
  Missing32/244 (13)11/88 (12)
Age
  Minimum1918
  Median (IQR)36.00 (29.00, 49.00)36.50 (29.00, 51.75)
  Mean (sd)39.58 ± 13.9038.98 ± 13.400.7199
  Maximum7865
Bacterial vaginosis (%)
  No213 (89)65 (77)
  Yes19 (8)18 (21)
  Not sure6 (3)1 (1)
  Missing6/244 (2)4/88 (5)0.0021
Pregnant status (%)
  No231 (96)85 (97)
  Yes4 (2)1 (1)
  Not sure6 (2)2 (2)
  Missiing3/244 (1)0/88 (0)1
Nulliparous (%)
  No164 (69)62 (70)
  Yes75 (31)26 (30)
  Missing5/244 (2)0/88 (0)0.8543
Hormone therapy (%)
  No64 (78)34 (92)
  Yes18 (22)3 (8)
  Missing162/244 (66)51/88 (58)0.1155
Hormonal birth control (%)
  No162 (75)61 (77)
  Yes54 (25)18 (23)
  Missing28/244 (11)9/88 (10)0.811
Sample pH (%)
  Minimum4.004.00
  Median (IQR)4.50 (4.00, 5.50)4.70 (4.40, 5.50)
  Mean (sd)5.02 ± 1.135.08 ± 1.030.6369
  Maximum7.007.00
  Missinig4/244 (2)0/88 (0)
Current smoking (%)
  No142 (67)64 (83)
  Yes71 (33)13 (17)
  Missing31/244 (13)11/88 (12)0.0099
Reproductive health characteristics of twin participants by self-reported ancestry. After initial quality control screening of samples containing at least 5000 reads, 267 bacterial taxa were identified in at least one participant. Due to the sparsity of individual taxa in the vaginal microbiome data, we limited analyses to 3 taxa, L. cripatus, L. iners, and G. vaginalis, that were present in at least 20% of participants and a within participant proportion of at least 10% (Fig. 1). Biometrical analyses identified a single taxon, L. crispatus (heritability = 34.7%, P value = 0.018), as significant among women of self-reported European ancestry and did not identify any taxa as heritable for women of self-reported African ancestry (Table 2). L. crispatus is the taxon most commonly associated with vaginal health, particularly among women of European ancestry. The genetic contribution of almost 35% of variance in L. crispatus abundance among women of European ancestry may partially explain why a higher prevalence of L. crispatus is consistently reported among this population. Heritability estimates remained constant after removing women older than the mean age of menopause onset (51 years) to assess whether the expected shift in vaginal pH influenced the genetic covariance of these taxa (Supplementary Table 1).
Fig. 1

Taxa distribution across zygosity and ancestry.

Twin pairs are represented as one horizontal line within a pane with each member separated by the vertical dashed line. Monozygotic twin pairs are presented in the left panels, with dizygotic twin pairs on the right. The upper panels are twin pairs of African ancestry, and European ancestry twin pairs are the bottom two panels. Panels summarize taxa proportions for A. Monozygotic/African ancestry; B. Dizygotic/African ancestry; C. Monozygotic/Eurpean ancestry and; D. Dizygotic/European ancestry twin pairs.

Table 2

Heritability estimates for predominant taxa by self-reported ancestry.

TaxaAncestryComponentStandardized estimateUnstandardized estimate95% LI95% UI
Lactobacillus crispatusAfricanA0.17060.0455−0.06090.1630
E0.82940.22130.13580.3735
EuropeanA0.34730.14280.05830.2415
E0.65270.26830.20220.3625
Lactobacillus inersAfricanA0.07050.0215−0.09810.1463
E0.92950.28350.17880.4669
EuropeanA0.08670.0217−0.02780.0738
E0.91330.22920.17690.3019
Gardnerella vaginalisAfricanA0.12590.0116−0.02360.0506
E0.87410.08050.05020.1331
EuropeanA−0.1654−0.0168−0.03960.0045
E1.16540.11870.09140.1563

LI lower interval, UI upper interval, A additive genetic component, E unique environmental component.

Taxa distribution across zygosity and ancestry.

Twin pairs are represented as one horizontal line within a pane with each member separated by the vertical dashed line. Monozygotic twin pairs are presented in the left panels, with dizygotic twin pairs on the right. The upper panels are twin pairs of African ancestry, and European ancestry twin pairs are the bottom two panels. Panels summarize taxa proportions for A. Monozygotic/African ancestry; B. Dizygotic/African ancestry; C. Monozygotic/Eurpean ancestry and; D. Dizygotic/European ancestry twin pairs. Heritability estimates for predominant taxa by self-reported ancestry. LI lower interval, UI upper interval, A additive genetic component, E unique environmental component.

Discussion

A landmark study from the Gordon laboratory demonstrated that gut microbiota from twin pairs discordant for obesity could be transplanted into gnotobiotic mice and differentially modulate metabolism[21], established the microbiome as an environmental factor that can have strong phenotypic effects. More recent studies of the gut microbiota have found that relatively few species exhibit strong heritability, with some heritability reported at higher taxonomic levels (e.g., Christensenellaceae family, Bifidobacterium abundance)[22,23]. Taxa found in the gut with the strongest heritability have been associated with clinically meaningful phenotypic differences, such as host metabolism[15]. Two genome-wide analyses related to microbiome composition using Human Microbiome Project data concluded that host genetic signature likely influences the overall composition of the oral and gut microbiome[22,23]. However, differences in approach and significance testing resulted in the lack of replication between studies of genetic associations related to the presence of specific taxa. One of the studies evaluated the relationship of host genetic factors and the vaginal microbiome (N = 80); but did not identify any statistically significant associations, likely due to the small sample size[23]. In the current study, we reported significant heritability estimates for L. crispatus among women of European ancestry, but not among women of African ancestry. The difference in heritability between self-identified ancestry groups in this case may be due to the increased prevalence of L. crispatus dominance among women of European ancestry[10,12]. Larger sample sizes will be needed to determine whether this taxon is also heritable among women of African ancestry given that prevalence of L. crispatus is less common[10-13,24]. Additionally, we did not identify significant heritability estimates for L. iners or G. vaginalis among women of European or African ancestry. Two previous twin studies evaluated heritability of the vaginal microbiome among Korean women[9,17]. Lee et al. reported the vaginal microbiome of twins are more alike to each other than their mothers or sisters, but noted that differing menopause status could have contributed to the observed differences[9]. Heritability estimates for individual microbial taxa were not reported. In the second larger study that included 111 MZ and 28 DZ pairs, Prevotella was identified as the most heritable taxa (48.76%) followed by L. crispatus (36.9%) and L. iners (41.2%). Thus, L. crispatus has similar heritability estimates among Korean and European American women. The study by Si and colleagues reported most heritability estimates at the genus level; other than L. crispatus and L. iners, species-level differences in the vaginal microbiome among their cohort were not reported[17]. Differences in vaginal microbiome composition by ancestry are one of the most reproducible signatures reported in microbiome literature. L. crispatus dominance is more common among women of European ancestry[10]. Women of African ancestry are less likely to have L. crispatus dominance and more likely to have L. iners or diverse microbial communities[10,14]. These differences are observed across geographic locations and populations[3,5,13], suggesting there may be a heritable component contributing to the compositional differences of the vaginal microbiome. Furthermore, the association of L. crispatus with lower risk for preterm birth is one of the most consistent, reproducible microbial signatures identified to date[5,7,25,26]. Understanding what contributes to variation in the microbiome is clinically important because L. crispatus dominance is associated with lower risk for vaginal infections and preterm birth[10-12]. Additionally, diverse vaginal microbial communities have been associated with birth complications and higher risk for sexually transmitted infections, including HIV infection and tansmission[5,14]. However, the lowered risk of preterm birth associated with L. crispatus prevalence is only consistently reported among women of European ancestry, which may be partially due to the lower prevalence of L. crispatus among women of African ancestry. This is the only study to date that has attempted to estimate the genetic contribution to vaginal microbiome profiles among African American and European American women. Our findings raise important questions regarding how host genetic factors influence the establishment of the vaginal microbiome and subsequently contribute to women’s health. Future studies should be directed to the identification of specific genetic loci that contribute to the heritability of L. crispatus. Understanding heritable differences in host susceptibility will be critical for precision-based approaches of microbiome modulation to improve health outcomes. L. crispatus is one of the most promising species being tested as a probiotic to improve and maintain vaginal health[27]. If L. crispatus is indeed heritable, but only among some ancestry groups, this may have implications for probiotic effectiveness in improving vaginal health or birth outcomes in diverse populations. Future work investigating efficacy of L. crispatus probiotics need to engage women across ancestry groups, and may need to consider alternate approaches among women without previous L. crispatus predominance (e.g., longer duration or different probiotic therapy). To date, published research on specific taxa of the vaginal microbiome has largely focused on common species, such as those classified as Lactobacillus or Gardnerella. Understanding how relatively unstudied, less prevalent, microbes contribute to vaginal health and birth outcomes may be necessary to solve persistent clinical puzzles, such as recurrence of bacterial vaginosis. We will likely need a variety of approaches for microbiome modulation if host genetic factors contribute to vaginal microbiome signatures. In summary, our study suggests L. crispatus, is a heritable taxon present in the vaginal microbiome. Therefore, heritability may explain, in part, why L. crispatus is most prevalent among women of European ancestry in previous vaginal microbiome studies.

Methods

Adult female twin pairs were recruited from the Mid-Atlantic Twin Registry under IRB protocol HM12169 at Virginia Commonwealth University. Detailed sample collection and data processing methods have been described elsewhere[10,28]. Briefly, metadata were collected from 173 (112 MZ; 61 DZ) female twin pairs over the age of 18, 166 pairs self-identified as African or European ancestry. Swabs from the mid-vaginal wall were collected by a physician during a speculum exam using CultureSwab EZ (Becton Dickenson) and DNA was extracted within 4 h of collection using the Powersoil kit (MoBio). V1-V3 regions of bacterial 16S rRNA were amplified and sequenced using the Roche 454 GS FLX Titanium platform. Amplification primers specifically designed to interrogate the vaginal microbiome using a (4:1) mixture of the forward primers Fwd-P1 (5′ - CCATCTCATCCCTGCGTGTCTCCGACTCAG BBBBBB AGAGTTYGATYMTGGCTYAG) and Fwd-P2 (5′ - CCATCTCATCCCTGCGTGTCTCCGACTCAG BBBBBB AGARTTTGATCYTGGTTCAG) and the reverse primer Rev1B (5′ – CCTATCCCCTGTGTGCCTTGGCAGTCTCAG ATTACCGCGGCTGCTGG) as previously described[10,28]. The analysis pipeline controls for detection (> 5,000 reads), quality of base reads, and assigns taxonomy with minimum bootstrap confidence of 80% using STIRRUPS (Species-level Taxon Identification of rDNA Reads using USEARCH Pipeline Strategy) using database version 09/27/11[28]. Allelic tests using the Profiler Plus and Cofiler kits were performed to determine the zygosity status for 14 pairs of twins with missing relationship information. The zygosity status of a random sample of 20 pairs of known zygosity (10 MZ and 10 DZ pairs) were evaluated to validate self-reported measures.

Data analysis

Briefly, genetic and environment contributions to variance in taxa abundance can be derived from the observation that MZ and DZ twins share differing proportions of genetic material and also share environmental exposures as a result of being raised together. Differences within MZ twins of the same pair are assumed to be due to unique environmental influences, which also contain measurement error in the modeling framework. Since members of a DZ twin pair share, on average, only one-half their genes observed differences can be attributed to their genes not shared, in addition to non-shared environmental influences. Thus, taxa showing stronger correlations within MZ pairs compared to DZ pairs can be attributed to genetic factors. The twin study provides a methodological control well-suited for vaginal microbiome studies where vertical transmission may occur since both members of MZ and DZ twin pairs could, in practice, be exposed to the same microbiota during delivery. Exposures shared by both members of a twin pair would be reflected in the estimates of the common environment (C) as opposed to additive genetic sources (A). In this study, the OpenMx R package was used to solve a system of linear equations using maximum likelihood methods to estimate the contribution of genetic (A), common environment (C) and unique environmental (E) sources[29]. The arcsine square root transformation of taxa proportions was used for all heritability analyses and was estimated for each taxa and self-identified ancestry group separately. In order to ensure sufficient covariance coverage, heritability was estimated only for taxa that were present in at least 20% of subjects and a within subject proportion of at least 10%. The contribution of individual genetic and environmental parameters to the covariance of taxa was assessed by dropping each in turn from the model and registering the decline in the fit of sub-models by the likelihood ratio chi-square test and change in the Akaike Information Criterion. In order to limit type I errors, an alpha level of 5% was used for all statistical tests. Nested model and fit statistics are provided in Supplementary Table 2a–f for each taxa by ancestry. An expanded list of 32 taxa present in at least 2.5% of subjects and a within subject proportion of at least 1% can be found in Supplementary Tables 3a–d insofar as this can be helpful for comparisons in future studies. The code used to compute heritability is available at https://github.com/tpyork/twin-microbiome.
  28 in total

Review 1.  Heritability in the genomics era--concepts and misconceptions.

Authors:  Peter M Visscher; William G Hill; Naomi R Wray
Journal:  Nat Rev Genet       Date:  2008-03-04       Impact factor: 53.242

2.  Replication and refinement of a vaginal microbial signature of preterm birth in two racially distinct cohorts of US women.

Authors:  Benjamin J Callahan; Daniel B DiGiulio; Daniela S Aliaga Goltsman; Christine L Sun; Elizabeth K Costello; Pratheepa Jeganathan; Joseph R Biggio; Ronald J Wong; Maurice L Druzin; Gary M Shaw; David K Stevenson; Susan P Holmes; David A Relman
Journal:  Proc Natl Acad Sci U S A       Date:  2017-08-28       Impact factor: 11.205

3.  The Vaginal Microbiome in U.S. Black Women: A Systematic Review.

Authors:  Jessica S Wells; Rasheeta Chandler; Alexis Dunn; Glenna Brewster
Journal:  J Womens Health (Larchmt)       Date:  2020-02-28       Impact factor: 2.681

4.  Randomized Trial of Lactin-V to Prevent Recurrence of Bacterial Vaginosis.

Authors:  Craig R Cohen; Michael R Wierzbicki; Audrey L French; Sheldon Morris; Sara Newmann; Hilary Reno; Lauri Green; Steve Miller; Jonathan Powell; Thomas Parks; Anke Hemmerling
Journal:  N Engl J Med       Date:  2020-05-14       Impact factor: 91.245

5.  Prevotella as a Hub for Vaginal Microbiota under the Influence of Host Genetics and Their Association with Obesity.

Authors:  Jiyeon Si; Hyun Ju You; Junsun Yu; Joohon Sung; GwangPyo Ko
Journal:  Cell Host Microbe       Date:  2016-12-22       Impact factor: 21.023

6.  Human genetics shape the gut microbiome.

Authors:  Julia K Goodrich; Jillian L Waters; Angela C Poole; Jessica L Sutter; Omry Koren; Ran Blekhman; Michelle Beaumont; William Van Treuren; Rob Knight; Jordana T Bell; Timothy D Spector; Andrew G Clark; Ruth E Ley
Journal:  Cell       Date:  2014-11-06       Impact factor: 41.582

7.  Gut microbiota from twins discordant for obesity modulate metabolism in mice.

Authors:  Vanessa K Ridaura; Jeremiah J Faith; Federico E Rey; Jiye Cheng; Alexis E Duncan; Andrew L Kau; Nicholas W Griffin; Vincent Lombard; Bernard Henrissat; James R Bain; Michael J Muehlbauer; Olga Ilkayeva; Clay F Semenkovich; Katsuhiko Funai; David K Hayashi; Barbara J Lyle; Margaret C Martini; Luke K Ursell; Jose C Clemente; William Van Treuren; William A Walters; Rob Knight; Christopher B Newgard; Andrew C Heath; Jeffrey I Gordon
Journal:  Science       Date:  2013-09-06       Impact factor: 47.728

8.  Vaginal dysbiosis increases risk of preterm fetal membrane rupture, neonatal sepsis and is exacerbated by erythromycin.

Authors:  Richard G Brown; Julian R Marchesi; Yun S Lee; Ann Smith; Benjamin Lehne; Lindsay M Kindinger; Vasso Terzidou; Elaine Holmes; Jeremy K Nicholson; Phillip R Bennett; David A MacIntyre
Journal:  BMC Med       Date:  2018-01-24       Impact factor: 8.775

9.  The vaginal microbiome and preterm birth.

Authors:  Jennifer M Fettweis; Myrna G Serrano; J Paul Brooks; David J Edwards; Philippe H Girerd; Hardik I Parikh; Bernice Huang; Tom J Arodz; Laahirie Edupuganti; Abigail L Glascock; Jie Xu; Nicole R Jimenez; Stephany C Vivadelli; Stephen S Fong; Nihar U Sheth; Sophonie Jean; Vladimir Lee; Yahya A Bokhari; Ana M Lara; Shreni D Mistry; Robert A Duckworth; Steven P Bradley; Vishal N Koparde; X Valentine Orenda; Sarah H Milton; Sarah K Rozycki; Andrey V Matveyev; Michelle L Wright; Snehalata V Huzurbazar; Eugenie M Jackson; Ekaterina Smirnova; Jonas Korlach; Yu-Chih Tsai; Molly R Dickinson; Jamie L Brooks; Jennifer I Drake; Donald O Chaffin; Amber L Sexton; Michael G Gravett; Craig E Rubens; N Romesh Wijesooriya; Karen D Hendricks-Muñoz; Kimberly K Jefferson; Jerome F Strauss; Gregory A Buck
Journal:  Nat Med       Date:  2019-05-29       Impact factor: 53.440

10.  Association of the vaginal microbiota with human papillomavirus infection in a Korean twin cohort.

Authors:  Jung Eun Lee; Sunghee Lee; Heetae Lee; Yun-Mi Song; Kayoung Lee; Min Ji Han; Joohon Sung; GwangPyo Ko
Journal:  PLoS One       Date:  2013-05-22       Impact factor: 3.240

View more
  1 in total

Review 1.  Novel Vaccine Strategies and Factors to Consider in Addressing Health Disparities of HPV Infection and Cervical Cancer Development among Native American Women.

Authors:  Crystal G Morales; Nicole R Jimenez; Melissa M Herbst-Kralovetz; Naomi R Lee
Journal:  Med Sci (Basel)       Date:  2022-09-13
  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.