Literature DB >> 34350830

Met and Cxcr4 cooperate to protect skeletal muscle stem cells against inflammation-induced damage during regeneration.

Ines Lahmann1,2, Joscha Griger2, Jie-Shin Chen2, Yao Zhang2, Markus Schuelke3, Carmen Birchmeier1,2.   

Abstract

Acute skeletal muscle injury is followed by an inflammatory response, removal of damaged tissue, and the generation of new muscle fibers by resident muscle stem cells, a process well characterized in murine injury models. Inflammatory cells are needed to remove the debris at the site of injury and provide signals that are beneficial for repair. However, they also release chemokines, reactive oxygen species, as well as enzymes for clearance of damaged cells and fibers, which muscle stem cells have to withstand in order to regenerate the muscle. We show here that MET and CXCR4 cooperate to protect muscle stem cells against the adverse environment encountered during muscle repair. This powerful cyto-protective role was revealed by the genetic ablation of Met and Cxcr4 in muscle stem cells of mice, which resulted in severe apoptosis during early stages of regeneration. TNFα neutralizing antibodies rescued the apoptosis, indicating that TNFα provides crucial cell-death signals during muscle repair that are counteracted by MET and CXCR4. We conclude that muscle stem cells require MET and CXCR4 to protect them against the harsh inflammatory environment encountered in an acute muscle injury.
© 2021, Lahmann et al.

Entities:  

Keywords:  cxcl12/cxcr4; developmental biology; hgf/met; inflammation; mouse; muscle stem cell; satellite cell; skeletal muscle regeneration

Mesh:

Substances:

Year:  2021        PMID: 34350830      PMCID: PMC8370772          DOI: 10.7554/eLife.57356

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.140


Introduction

Muscle injury through trauma is common and can be repaired by muscle regeneration (Järvinen et al., 2005; Tidball, 2005; Tidball, 2017). Stem cells reside in the muscle tissue and provide the cellular source for the regeneration process (Chargé and Rudnicki, 2004; Relaix and Zammit, 2012). Muscle stem cells are characterized by the expression of PAX7 and their location in the stem cell niche between the basal lamina and plasma membrane of the muscle fiber (Mauro, 1961; Seale et al., 2000). Muscle stem cells are quiescent in the adult, but can be re-activated upon injury. On one hand, activated muscle stem cells proliferate and generate differentiating cells to repair the muscle, and on the other they can self-renew to repopulate the stem cell niche (Chargé and Rudnicki, 2004; Relaix and Zammit, 2012). A complex interplay between muscle stem cells and their environment occurs during muscle repair. Inflammatory cells and the cytokines they produce provide important cues for muscle stem cells and regulate their activation, proliferation, and differentiation. Therefore, communication between muscle stem cells and the immune system needs to be tightly regulated. Failure of adequate communication results in incomplete regeneration as well as sustained or chronic inflammation that ultimately damages the muscle (Chazaud et al., 2009; Saclier et al., 2013b; Londhe and Guttridge, 2015; Tidball, 2017). Shortly after an acute muscle injury, resident macrophages are activated and large numbers of macrophages and neutrophils are recruited to the injured tissue. This accumulation of immune cells is a prerequisite for the removal of damaged fibers (Tidball, 2005). The immune cells amplify the inflammatory response and create a milieu that is rich in inflammatory cytokines, reactive oxygen species, proteases, and membrane-damaging agents (Butterfield et al., 2006; Mann et al., 2011; Le Moal et al., 2017). This produces a noxious environment that muscle stem cells and regenerating fibers must withstand in order to properly rebuild functional muscle tissue. How muscle stem cells are protected from these noxious cues has not yet been elucidated. We reasoned that investigating the direct role of cytokines on muscle stem cells and during muscle repair after acute injury will help to define factors that could be beneficial in a therapeutic setting. We used cardiotoxin injection as our muscle injury model that resulted in widespread necrosis of muscle fibers, massive infiltration by neutrophils and macrophages followed by myogenic regeneration. In such a setting, extensive proliferation of muscle stem cells occurs, amplifying their numbers and providing the cellular material for new myofibers (Hardy et al., 2016). Nevertheless, a substantial number of stem cells are lost during the acute inflammatory response (Hardy et al., 2016). We show here that endogenous cytokines enable muscle stem cells to survive in the noxious environment encountered after injury. We used mouse genetics to demonstrate that MET/HGF and CXCR4/CXCL12 signals cooperate to protect muscle stem cells during early stages of regeneration. We identify TNFα as a factor that damages the stem cells in this setting. Together, our study shows that inflammatory factors have dual effects, damaging (TNFα) and protecting (HGF and CXCL12) muscle stem cells during acute injury and regeneration.

Results

Met is required for normal muscle regeneration

To identify factors that directly regulate muscle stem cell behavior in vivo, we systematically assessed chemokine transcripts in regenerating muscle using published data sources (Hirata et al., 2003; Xiao et al., 2011; Bobadilla et al., 2014) and verified their expression using qPCR. A multitude of chemokines are rapidly and strongly induced after injury. In murine tibialis anterior muscle tissue, Tnf and Hgf transcripts were induced 10–500-fold with a time course that peaked 2–3 days after injury (Figure 1A and B, Figure 1—figure supplement 1, and Supplementary file 1). TNFα is known to orchestrate the inflammatory response and to participate in the communication between immune cells (Saclier et al., 2013a; Turner et al., 2014), and HGF is a proliferation and motility factor that can act as protective factor in tissue injury (Birchmeier et al., 2003; Nakamura and Mizuno, 2010). Hgf transcripts were produced at low levels by quiescent and activated muscle stem cells, demonstrating that other cell types but muscle stem cells produce Hgf in the regenerating muscle (Figure 1C and Supplementary file 1). This is in accord with previous data on Hgf expression obtained by microarray analysis (Liu et al., 2013; Latroche et al., 2017; see also Figure 1—figure supplement 1). The HGF receptor MET is expressed in adult muscle stem cells (Cornelison and Wold, 1997), and, in contrast to quiescent muscle stem cells, Met transcripts were upregulated when the cells were activated (Figure 1D).
Figure 1.

Expression of Tnf, Hgf, and Met during muscle regeneration.

(A, B) Expression dynamics of Tnf (A) and Hgf (B) in uninjured and regenerating muscle tissue determined by qPCR. (C) Expression dynamics of Hgf in quiescent and activated muscle stem cells and in muscle tissue during muscle regeneration determined by qPCR. (D) Expression levels of Met in quiescent and activated muscle stem cells determined by qPCR. Boxplots represent interquartile range, and whiskers show min-to-max range. β-Actin expression was used for normalization in (A–D).

The microarray data sets were obtained from the GEO Database under the accession numbers GSE103684 and GSE47177. Symbols represent the mean of three independent biological replicates, error bars represent the standard deviation.

Figure 1—figure supplement 1.

Expression levels of Hgf in quiescent (freshly isolated) and proliferating muscle stem cells at various time points defined by microarray analysis (Liu et al., 2013; Latroche et al., 2017).

The microarray data sets were obtained from the GEO Database under the accession numbers GSE103684 and GSE47177. Symbols represent the mean of three independent biological replicates, error bars represent the standard deviation.

Expression of Tnf, Hgf, and Met during muscle regeneration.

(A, B) Expression dynamics of Tnf (A) and Hgf (B) in uninjured and regenerating muscle tissue determined by qPCR. (C) Expression dynamics of Hgf in quiescent and activated muscle stem cells and in muscle tissue during muscle regeneration determined by qPCR. (D) Expression levels of Met in quiescent and activated muscle stem cells determined by qPCR. Boxplots represent interquartile range, and whiskers show min-to-max range. β-Actin expression was used for normalization in (A–D).

Expression levels of Hgf in quiescent (freshly isolated) and proliferating muscle stem cells at various time points defined by microarray analysis (Liu et al., 2013; Latroche et al., 2017).

The microarray data sets were obtained from the GEO Database under the accession numbers GSE103684 and GSE47177. Symbols represent the mean of three independent biological replicates, error bars represent the standard deviation. To identify the role of HGF/MET during muscle repair, we introduced a loss-of-function mutation in Met in muscle stem cells using a constitutive Pax7 allele (Pax7 mice, named hereafter coMet; the genotype of the corresponding control mice used was Pax7). Met is known to control migration of myogenic progenitors during development (Bladt et al., 1995). The conditional mutation did not affect muscle progenitor migration because Pax7 (and hence Pax7) starts only to be expressed in progenitors that have already reached their targets (Relaix et al., 2004). Therefore, the Met mutation in myogenic progenitors is introduced after migration is completed, from there on persisting throughout fetal and postnatal development. In the undamaged muscle, neither fiber diameter nor muscle stem cell numbers were changed in coMet mutant compared to control mice (Figures 2 and 3).
Figure 2.

Mutation of Met impairs muscle regeneration.

(A–D) Immunohistological analysis of regenerating (7 days post injury [dpi] and 20 dpi) muscle of control and coMet mutants using antibodies against laminin (red) and sarcomeric myosin (green). DAPI was used as a counterstain. (E) Distribution of Feret fiber diameters in uninjured and regenerating muscle (7 dpi and 20 dpi) of control mice and coMet mutants. (F–I) Immunohistological analysis of regenerating muscle of control and TxGakaMet mice using antibodies against laminin (red) and sarcomeric myosin (green). DAPI was used as a counterstain. (J) Distribution of Feret fiber diameters in uninjured and regenerating muscle (7 dpi and 20 dpi) of control and TxGakaMet mice. (K–N) Immunohistological analysis of regenerating (7 dpi and 20 dpi) muscle of control and TxFanMet mice using antibodies against laminin (red) and sarcomeric myosin (green). DAPI was used as a counterstain. (O) Distribution of Feret fiber diameters in uninjured and regenerating (7 dpi and 20 dpi) muscle of control and TxFanMet mice. Scale bars, 100 µm. In (A–E) control: Pax7; coMet: Pax7. In (F–J) control: Pax7; TxGakaMet: Pax7; In (K–O) control: Pax7; TxFanMet: Pax7. Animals in (F–O) were treated with tamoxifen.

Figure 3.

Mutation of Met reduces the muscle stem cell pool during regeneration.

(A–D) Immunohistological analysis of uninjured and regenerating (7 days post injury [dpi]) muscle of control and coMet mice using antibodies against laminin (red) and PAX7 (green). DAPI was used as a counterstain. (E, F) Quantification of PAX7+ cells in uninjured and regenerating muscle from control and coMet mice. (G–J) Immunohistological analysis of uninjured and regenerating (7 dpi) muscle from control and TxGakaMet mice using antibodies against laminin (red) and Pax7 (green). DAPI was used as a counterstain. (K, L) Quantification of PAX7+ cells in uninjured and regenerating muscle of control and TxGakaMet mice. (M–P) Immunohistological analysis of uninjured and regenerating (7 dpi) muscle from control and TxFanMet mice using antibodies against laminin (red) and Pax7 (green). DAPI was used as a counterstain. (Q, R) Quantification of PAX7+ cells in uninjured and regenerating (7 dpi) muscle from control and TxFanMet mice. Arrowheads point to PAX7+ cells. Scale bars 100 µm. In (A–F) control: Pax7; coMet: Pax7. In (G–L) control: Pax7; TxGakaMet: Pax7. In (M–R) control: Pax7; TxFanMet: Pax7. Animals in (G–R) were treated with tamoxifen.

Quantification of recombination efficiency of the Metflox allele represented in the diagrams shown in B, C and D (Figure 3—figure supplement 1).

(A) Cartoon showing the unspliced transcripts from the Met allele before and after Cre-dependent excision of exon 17. Arrows mark position of qPCR primers used to determine the recombination efficiency. (B–D) Transcript levels generated from the Met allele before and after recombination using Pax7 (B), Pax7 (C), and Pax7 (D) in isolated muscle stem cells quantified by qPCR. β-Actin expression was used for normalization. (E) Cartoon showing the Cre alleles used to recombine muscle stem cells in this work. Genotypes of controls are in (B) Met, in (C), Met treated with tamoxifen, and in (D) Met treated with tamoxifen.

Mutation of Met impairs muscle regeneration.

(A–D) Immunohistological analysis of regenerating (7 days post injury [dpi] and 20 dpi) muscle of control and coMet mutants using antibodies against laminin (red) and sarcomeric myosin (green). DAPI was used as a counterstain. (E) Distribution of Feret fiber diameters in uninjured and regenerating muscle (7 dpi and 20 dpi) of control mice and coMet mutants. (F–I) Immunohistological analysis of regenerating muscle of control and TxGakaMet mice using antibodies against laminin (red) and sarcomeric myosin (green). DAPI was used as a counterstain. (J) Distribution of Feret fiber diameters in uninjured and regenerating muscle (7 dpi and 20 dpi) of control and TxGakaMet mice. (K–N) Immunohistological analysis of regenerating (7 dpi and 20 dpi) muscle of control and TxFanMet mice using antibodies against laminin (red) and sarcomeric myosin (green). DAPI was used as a counterstain. (O) Distribution of Feret fiber diameters in uninjured and regenerating (7 dpi and 20 dpi) muscle of control and TxFanMet mice. Scale bars, 100 µm. In (A–E) control: Pax7; coMet: Pax7. In (F–J) control: Pax7; TxGakaMet: Pax7; In (K–O) control: Pax7; TxFanMet: Pax7. Animals in (F–O) were treated with tamoxifen.

Mutation of Met reduces the muscle stem cell pool during regeneration.

(A–D) Immunohistological analysis of uninjured and regenerating (7 days post injury [dpi]) muscle of control and coMet mice using antibodies against laminin (red) and PAX7 (green). DAPI was used as a counterstain. (E, F) Quantification of PAX7+ cells in uninjured and regenerating muscle from control and coMet mice. (G–J) Immunohistological analysis of uninjured and regenerating (7 dpi) muscle from control and TxGakaMet mice using antibodies against laminin (red) and Pax7 (green). DAPI was used as a counterstain. (K, L) Quantification of PAX7+ cells in uninjured and regenerating muscle of control and TxGakaMet mice. (M–P) Immunohistological analysis of uninjured and regenerating (7 dpi) muscle from control and TxFanMet mice using antibodies against laminin (red) and Pax7 (green). DAPI was used as a counterstain. (Q, R) Quantification of PAX7+ cells in uninjured and regenerating (7 dpi) muscle from control and TxFanMet mice. Arrowheads point to PAX7+ cells. Scale bars 100 µm. In (A–F) control: Pax7; coMet: Pax7. In (G–L) control: Pax7; TxGakaMet: Pax7. In (M–R) control: Pax7; TxFanMet: Pax7. Animals in (G–R) were treated with tamoxifen.

Quantification of PAX7+ cells represented in the diagrams shown in E, F, K, L, Q and R (Figure 3).

Quantification of recombination efficiency of the Metflox allele represented in the diagrams shown in B, C and D (Figure 3—figure supplement 1).
Figure 3—figure supplement 1.

Recombination efficiency and schematic drawing of the different Pax7Cre alleles.

(A) Cartoon showing the unspliced transcripts from the Met allele before and after Cre-dependent excision of exon 17. Arrows mark position of qPCR primers used to determine the recombination efficiency. (B–D) Transcript levels generated from the Met allele before and after recombination using Pax7 (B), Pax7 (C), and Pax7 (D) in isolated muscle stem cells quantified by qPCR. β-Actin expression was used for normalization. (E) Cartoon showing the Cre alleles used to recombine muscle stem cells in this work. Genotypes of controls are in (B) Met, in (C), Met treated with tamoxifen, and in (D) Met treated with tamoxifen.

Recombination efficiency and schematic drawing of the different Pax7Cre alleles.

(A) Cartoon showing the unspliced transcripts from the Met allele before and after Cre-dependent excision of exon 17. Arrows mark position of qPCR primers used to determine the recombination efficiency. (B–D) Transcript levels generated from the Met allele before and after recombination using Pax7 (B), Pax7 (C), and Pax7 (D) in isolated muscle stem cells quantified by qPCR. β-Actin expression was used for normalization. (E) Cartoon showing the Cre alleles used to recombine muscle stem cells in this work. Genotypes of controls are in (B) Met, in (C), Met treated with tamoxifen, and in (D) Met treated with tamoxifen. Upon injury of the tibialis anterior muscle using cardiotoxin, coMet mutant muscle stem cells were able to regenerate muscle fibers. However, at 7 days post injury (dpi) the diameter of the newly regenerated fibers was smaller in coMet mutants than in control animals, but diameters largely equalized between control and coMet mutants and were no longer significantly different at 20 dpi (Figure 2A–D, quantified in E). Moreover, the number of PAX7+ stem cells in the regenerated muscle of coMet mice was reduced by 68% at 7 dpi compared to control mice, and also this difference became less pronounced at 20 dpi (47% reduction in coMet mice; Figure 3A–F). Similar deficits were observed when Met was mutated in adult muscle stem cells using the tamoxifen-inducible Pax7 allele (Pax7 mice treated with tamoxifen, named hereafter TxGakaMet as controls, Pax7 mice treated with tamoxifen were used). Thus, the diameter of new fibers was smaller at 7 dpi in TxGakaMet compared to control animals at 7 dpi, but at 20 dpi the difference in fiber diameters was no longer significant (Figure 2F-J). Moreover, the number of PAX7+ stem cells in the regenerated muscle of TxGakaMet mice was reduced by 73% at 7 dpi compared to control, and also this difference was less pronounced at 20 dpi (44% reduction in TxGakaMet mice) (Figure 3G–L). In summary, our data indicate that loss of Met in muscle stem cells results in a mild regeneration deficit. This is accompanied by a reduction of muscle stem cell numbers during early stages of regeneration, which is partly compensated for during late stages. Increased proliferation of the remaining stem cell pool might account for this (see below for a more detailed description of the mechanisms). A previous report had indicated that ablation of Met using a distinct tamoxifen-inducible Pax7 allele (Pax7) resulted in a much more severe muscle regeneration deficit (Webster and Fan, 2013). We used this Cre allele to mutate Met (Pax7 mice treated with tamoxifen, named hereafter TxFanMet animals; as controls, Pax7 mice treated with tamoxifen were used), and also detected a very severe muscle regeneration deficit at 7 dpi and 20 dpi compared to control animals at these stages of regeneration (Figure 2K–O). In particular, extracellular matrix remnants from injured skeletal muscle fibers (i.e., ghost fibers) were abundant at 7 dpi and 20 dpi. Notably, even in the uninjured muscle a 50% reduction in the number of PAX7+ cells was observed in the TxFanMet animals compared to controls. This became more pronounced after injury when a 94 and 65% reduction in stem cell numbers was present at 7 dpi and 20 dpi, respectively, compared to the control animals at these stages of regeneration (Figure 3M–R). Different recombination efficacies did not account for these differences in phenotypes observed in coMet and TxGakaMet animals on one side, and TxFanMet animals on the other side (Figure 3—figure supplement 1A-D). We conclude that the muscle stem cell and regeneration deficits present in TxFanMet mutants are apparently not only due to the Met ablation. It should be noted that in the Pax7 allele, the Pax7 coding sequence is disrupted by Cre, whereas the Pax7 and Pax7 alleles do not interfere with the Pax7 coding sequence (Keller et al., 2004; Lepper et al., 2009; Murphy et al., 2011; see also Figure 3—figure supplement 1E for a cartoon of the different Cre alleles used). PAX7 levels are known to affect muscle stem cell behavior and their ability to regenerate the muscle (von Maltzahn et al., 2013; Mademtzoglou et al., 2018). Thus, the absence of one functional Pax7 allele might contribute to the exacerbated muscle stem cell and regeneration phenotypes observed in TxFanMet animals.

MET and CXCR4 signaling cooperates during muscle regeneration

The CXCR4 receptor is expressed in developing and adult muscle stem cells and mediates CXCL12 signals that stimulate their proliferation and migration (Vasyutina et al., 2005; Odemis et al., 2007; Griffin et al., 2010). Cxcl12 is expressed by various cell types of the immune system. qPCR demonstrated that muscle tissue and PAX7+ cells expressed Cxcl12 transcripts in both uninjured and regenerating muscle, and confirmed that Cxcr4 transcripts were present in PAX7+ cells (Figure 4A–C, Figure 4—figure supplement 1, and Supplementary file 1). Cxcr4 and Met are known to cooperate during muscle development (Vasyutina et al., 2005). We therefore tested whether this cooperativity was also observed in adult muscle stem cells and whether it would have an impact on muscle repair using Cxcr4 and Met double mutant mice (Pax7 mice treated with tamoxifen, hereafter called TxGakaCxcr4;Met animals; Pax7 treated with tamoxifen served as controls). Mutations of Cxcr4 and Met in muscle stem cells did not obviously affect muscle formation or muscle stem cell numbers (Figure 5, Figure 5—figure supplement 1). However, TxGakaCxcr4;Met double mutant mice at 7 dpi displayed a very severe regeneration deficit compared to control mice at 7 dpi. In particular, formation of myofibers was strongly impaired (Figure 5A–E). Further, the number of muscle stem cells detected at 7 dpi was decreased by 93% as compared to control mice at 7 dpi (Figure 5F–J). The severe regeneration deficit was accompanied by widespread fibrosis, persisting macrophages, and prolonged inflammation (Figure 5—figure supplement 2). In contrast, the single Cxcr4 mutation in muscle stem cells (Pax7 treated with tamoxifen, hereafter named TxGakaCxcr4; Pax7 mice treated with tamoxifen served as controls) did neither affect the number of muscle stem cells in regeneration, the diameter of newly formed fibers, nor did it cause prolonged inflammation or fibrosis (Figure 5, Figure 5—figure supplement 1, and Figure 5—figure supplement 2). We conclude that loss of muscle stem cells and deficits in muscle repair are augmented if both Cxcr4 and Met are lacking.
Figure 4.

Expression of Cxcl12 and Cxcr4 during regeneration.

(A) Expression dynamics of Cxcl12 in uninjured and regenerating muscle tissue determined by qPCR. (B) Expression levels of Cxcl12 in quiescent and activated muscle stem cells and in muscle tissue during muscle regeneration determined by qPCR. (C) Expression levels of Cxcr4 in quiescent and activated muscle stem cells determined by qPCR. Boxplots represent interquartile range, whiskers show min-to-max range. β-Actin expression was used for normalization in (A–C).

The microarray data sets were obtained from the GEO Database under the accession numbers GSE103684 and GSE47177. Symbols represent the mean of three independent biological replicates, error bars represent the standard deviation.

Figure 4—figure supplement 1.

Expression levels of Cxcl12 in quiescent (freshly isolated) and proliferating muscle stem cells at various time points defined by microarray analysis (Liu et al., 2013; Latroche et al., 2017).

The microarray data sets were obtained from the GEO Database under the accession numbers GSE103684 and GSE47177. Symbols represent the mean of three independent biological replicates, error bars represent the standard deviation.

Figure 5.

Cxcr4 and Met cooperate during muscle regeneration.

(A–D) Immunohistological analysis of regenerating (7 days post injury [dpi]) muscle of control, TxGakaCxcr4, TxGakaMet, and TxGakaCxcr4;Met mice using antibodies against laminin (red) and sarcomeric myosin (green). DAPI was used as a counterstain. Control and mutant animals had been treated with tamoxifen. (E) Distribution of Ferret fiber diameters in uninjured and regenerating (7 dpi) muscle of control, TxGakaCxcr4, TxGakaMet, and TxGakaCxcr4;Met mice. (F–I) Immunohistological analysis of regenerating (7 dpi) muscle of control animals, TxGakaCxcr4, TxGakaMet, and TxGakaCxcr4;Met mutants using antibodies against laminin (green) and Pax7 (red). DAPI was used as a counterstain. Arrowheads in (H, I) point to PAX7+ cells. (J) Quantification of PAX7+ cells in regenerating muscle of control, TxGakaCxcr4 and TxGakaMet mice, and TxGakaCxcr4;Met double mutants. Scale bars, 50 µm (A–D), 30 µm (F–I). Control: Pax7; TxGakaCxcr4: Pax7; TxGakaMet: Pax7 TxGakaCxcr4;Met: Pax7. All animals were treated with tamoxifen.

(A–D) Immunohistological analysis of uninjured muscle of control, TxGakaCxcr4, TxGakaMet, andTxGakaCxcr4;Met mice using antibodies against laminin (red) and PAX7 (green). DAPI was used as a counterstain. (E) Quantification of PAX7+ cells in uninjured muscle. Scale bars: 30 µm. Genotype of control is Pax7, treated with tamoxifen.

(A–D, A′–D′) Immunohistological analysis of regenerating muscle at 7 days post injury (dpi) of control, TxGakaCxcr4, TxGakaMet, and TxGakaCxcr4;Met mutants using antibodies against F4/80 (red in A–D, white in A′–D′) and CollagenIV (green). DAPI was used as a counterstain. (E) Quantifications of F4/80+ stained area and (F) fibronectin-positive area in the regenerating muscle. Scale bars, 100 µm. Genotype of control is Pax7, treated with tamoxifen.

Figure 5—figure supplement 1.

Mutations of Cxcr4 and Met in muscle stem cells did not affect muscle stem cell numbers.

(A–D) Immunohistological analysis of uninjured muscle of control, TxGakaCxcr4, TxGakaMet, andTxGakaCxcr4;Met mice using antibodies against laminin (red) and PAX7 (green). DAPI was used as a counterstain. (E) Quantification of PAX7+ cells in uninjured muscle. Scale bars: 30 µm. Genotype of control is Pax7, treated with tamoxifen.

Figure 5—figure supplement 2.

Increased fibrosis in the regenerating muscle of Met and Cxcr4;Met mutants.

(A–D, A′–D′) Immunohistological analysis of regenerating muscle at 7 days post injury (dpi) of control, TxGakaCxcr4, TxGakaMet, and TxGakaCxcr4;Met mutants using antibodies against F4/80 (red in A–D, white in A′–D′) and CollagenIV (green). DAPI was used as a counterstain. (E) Quantifications of F4/80+ stained area and (F) fibronectin-positive area in the regenerating muscle. Scale bars, 100 µm. Genotype of control is Pax7, treated with tamoxifen.

Expression of Cxcl12 and Cxcr4 during regeneration.

(A) Expression dynamics of Cxcl12 in uninjured and regenerating muscle tissue determined by qPCR. (B) Expression levels of Cxcl12 in quiescent and activated muscle stem cells and in muscle tissue during muscle regeneration determined by qPCR. (C) Expression levels of Cxcr4 in quiescent and activated muscle stem cells determined by qPCR. Boxplots represent interquartile range, whiskers show min-to-max range. β-Actin expression was used for normalization in (A–C).

Expression levels of Cxcl12 in quiescent (freshly isolated) and proliferating muscle stem cells at various time points defined by microarray analysis (Liu et al., 2013; Latroche et al., 2017).

The microarray data sets were obtained from the GEO Database under the accession numbers GSE103684 and GSE47177. Symbols represent the mean of three independent biological replicates, error bars represent the standard deviation.

Cxcr4 and Met cooperate during muscle regeneration.

(A–D) Immunohistological analysis of regenerating (7 days post injury [dpi]) muscle of control, TxGakaCxcr4, TxGakaMet, and TxGakaCxcr4;Met mice using antibodies against laminin (red) and sarcomeric myosin (green). DAPI was used as a counterstain. Control and mutant animals had been treated with tamoxifen. (E) Distribution of Ferret fiber diameters in uninjured and regenerating (7 dpi) muscle of control, TxGakaCxcr4, TxGakaMet, and TxGakaCxcr4;Met mice. (F–I) Immunohistological analysis of regenerating (7 dpi) muscle of control animals, TxGakaCxcr4, TxGakaMet, and TxGakaCxcr4;Met mutants using antibodies against laminin (green) and Pax7 (red). DAPI was used as a counterstain. Arrowheads in (H, I) point to PAX7+ cells. (J) Quantification of PAX7+ cells in regenerating muscle of control, TxGakaCxcr4 and TxGakaMet mice, and TxGakaCxcr4;Met double mutants. Scale bars, 50 µm (A–D), 30 µm (F–I). Control: Pax7; TxGakaCxcr4: Pax7; TxGakaMet: Pax7 TxGakaCxcr4;Met: Pax7. All animals were treated with tamoxifen.

Mutations of Cxcr4 and Met in muscle stem cells did not affect muscle stem cell numbers.

(A–D) Immunohistological analysis of uninjured muscle of control, TxGakaCxcr4, TxGakaMet, andTxGakaCxcr4;Met mice using antibodies against laminin (red) and PAX7 (green). DAPI was used as a counterstain. (E) Quantification of PAX7+ cells in uninjured muscle. Scale bars: 30 µm. Genotype of control is Pax7, treated with tamoxifen.

Increased fibrosis in the regenerating muscle of Met and Cxcr4;Met mutants.

(A–D, A′–D′) Immunohistological analysis of regenerating muscle at 7 days post injury (dpi) of control, TxGakaCxcr4, TxGakaMet, and TxGakaCxcr4;Met mutants using antibodies against F4/80 (red in A–D, white in A′–D′) and CollagenIV (green). DAPI was used as a counterstain. (E) Quantifications of F4/80+ stained area and (F) fibronectin-positive area in the regenerating muscle. Scale bars, 100 µm. Genotype of control is Pax7, treated with tamoxifen.

Muscle stem cells deficient for Met and Cxcr4 are susceptible to apoptosis

We next assessed the mechanisms by which the Cxcr4 and Met mutations affect muscle stem cell maintenance in the injured muscle. We observed a pronounced increase in apoptosis of PAX7+ cells at 4 dpi in the double mutants and a severe decrease in the number of PAX7+ muscle stem cells (Figure 6). A less pronounced enhancement of apoptosis of muscle stem cells was observed in TxGakaMet single mutants, whereas the TxGakaCxcr4 single mutation did not significantly impair survival as compared to control animals (Figure 6). Thus, the signals provided by CXCR4 and MET protect muscle stem cells from apoptosis in the acutely injured muscle.
Figure 6.

Cxcr4;Met mutant muscle stem cells undergo apoptosis after acute injury.

(A–D, A′–D′) Immunohistological analysis of apoptotic cells. PAX7 antibody staining (red) was combined with TUNEL assay (green) to identify apoptotic muscle stem cells in injured muscle of control, TxGakaCxcr4, TxGakaMet, and TxGakaCxcr4;Met mice at 4 days post injury (dpi). DAPI was used as a counterstain in (A–D). Arrowheads point to TUNEL+ PAX7+ cells. (E) Quantification of PAX7+ TUNEL+ cells in regenerating muscle of control, TxGakaCxcr4, TxGakaMet, and TxGakaCxcr4;Met mutants. (F) Quantification of PAX7+ cells in regenerating muscle of control, TxGakaCxcr4, TxGakaMet, and TxGakaCxcr4;Met mice. Scale bars, 20 µm. Control: Pax7; TxGakaCxcr4: Pax7; TxGakaMet: Pax7 TxGakaCxcr4;Met: Pax7. All animals were treated with tamoxifen.

Quantification of EdU+PAX7+ cells represented in the diagram shown in E (Figure 6—figure supplement 1). Quantification of MYOG+ and PAX7+ cells represented in the diagrams shown in E and F (Figure 6—figure supplement 2).

(A–D) Identification of proliferating muscle stem cells by EdU incorporation in regenerating muscle of (A) control, (B) Tx, (C) TxGakaMet, and (D) TxGakaCxcr4;Met mice at 4 days post injury (dpi) using antibodies against EdU (green) and PAX7 (red). DAPI was used as a counterstain. Arrowheads point to EdU+ PAX7+ muscle stem cells in regenerating muscle. (A′–D′) show the Pax7 channel, (A′′–D′′) show the EdU channel of images in (A–D). (E) Quantification of the proliferating EdU+ PAX7+ cells. Scale bars, 20 µm. Genotype of control is Pax7, treated with tamoxifen.

(A–D) Identification of differentiating myogenic cells in regenerating muscle of (A) control, (B) TxGakaCxcr4, (C) TxGakaMet, and (D) TxGakaCxcr4;Met mice at 4 days post injury (dpi) using antibodies against Myogenin (green) and PAX7 (red). DAPI was used as a counterstain. (E) Number of Myogenin+ cells/mm2 and (F) quantification of the proportion of cells that express PAX7 and/or Myogenin. Scale bars, 20 µm. Genotype of control is Pax7, treated with tamoxifen.

Cxcr4;Met mutant muscle stem cells undergo apoptosis after acute injury.

(A–D, A′–D′) Immunohistological analysis of apoptotic cells. PAX7 antibody staining (red) was combined with TUNEL assay (green) to identify apoptotic muscle stem cells in injured muscle of control, TxGakaCxcr4, TxGakaMet, and TxGakaCxcr4;Met mice at 4 days post injury (dpi). DAPI was used as a counterstain in (A–D). Arrowheads point to TUNEL+ PAX7+ cells. (E) Quantification of PAX7+ TUNEL+ cells in regenerating muscle of control, TxGakaCxcr4, TxGakaMet, and TxGakaCxcr4;Met mutants. (F) Quantification of PAX7+ cells in regenerating muscle of control, TxGakaCxcr4, TxGakaMet, and TxGakaCxcr4;Met mice. Scale bars, 20 µm. Control: Pax7; TxGakaCxcr4: Pax7; TxGakaMet: Pax7 TxGakaCxcr4;Met: Pax7. All animals were treated with tamoxifen.

Quantification of PAX7+TUNEL+ and PAX7+ cells represented in the diagrams shown in E and F (Figure 6).

Quantification of EdU+PAX7+ cells represented in the diagram shown in E (Figure 6—figure supplement 1). Quantification of MYOG+ and PAX7+ cells represented in the diagrams shown in E and F (Figure 6—figure supplement 2).
Figure 6—figure supplement 1.

Enhanced proliferation of PAX7+ cells in Cxcr4;Met mutants during regeneration.

(A–D) Identification of proliferating muscle stem cells by EdU incorporation in regenerating muscle of (A) control, (B) Tx, (C) TxGakaMet, and (D) TxGakaCxcr4;Met mice at 4 days post injury (dpi) using antibodies against EdU (green) and PAX7 (red). DAPI was used as a counterstain. Arrowheads point to EdU+ PAX7+ muscle stem cells in regenerating muscle. (A′–D′) show the Pax7 channel, (A′′–D′′) show the EdU channel of images in (A–D). (E) Quantification of the proliferating EdU+ PAX7+ cells. Scale bars, 20 µm. Genotype of control is Pax7, treated with tamoxifen.

Figure 6—figure supplement 2.

Differentiation is mildly enhanced in Met and Cxcr4;Met mutants during regeneration.

(A–D) Identification of differentiating myogenic cells in regenerating muscle of (A) control, (B) TxGakaCxcr4, (C) TxGakaMet, and (D) TxGakaCxcr4;Met mice at 4 days post injury (dpi) using antibodies against Myogenin (green) and PAX7 (red). DAPI was used as a counterstain. (E) Number of Myogenin+ cells/mm2 and (F) quantification of the proportion of cells that express PAX7 and/or Myogenin. Scale bars, 20 µm. Genotype of control is Pax7, treated with tamoxifen.

Enhanced proliferation of PAX7+ cells in Cxcr4;Met mutants during regeneration.

(A–D) Identification of proliferating muscle stem cells by EdU incorporation in regenerating muscle of (A) control, (B) Tx, (C) TxGakaMet, and (D) TxGakaCxcr4;Met mice at 4 days post injury (dpi) using antibodies against EdU (green) and PAX7 (red). DAPI was used as a counterstain. Arrowheads point to EdU+ PAX7+ muscle stem cells in regenerating muscle. (A′–D′) show the Pax7 channel, (A′′–D′′) show the EdU channel of images in (A–D). (E) Quantification of the proliferating EdU+ PAX7+ cells. Scale bars, 20 µm. Genotype of control is Pax7, treated with tamoxifen.

Differentiation is mildly enhanced in Met and Cxcr4;Met mutants during regeneration.

(A–D) Identification of differentiating myogenic cells in regenerating muscle of (A) control, (B) TxGakaCxcr4, (C) TxGakaMet, and (D) TxGakaCxcr4;Met mice at 4 days post injury (dpi) using antibodies against Myogenin (green) and PAX7 (red). DAPI was used as a counterstain. (E) Number of Myogenin+ cells/mm2 and (F) quantification of the proportion of cells that express PAX7 and/or Myogenin. Scale bars, 20 µm. Genotype of control is Pax7, treated with tamoxifen. CXCR4 and MET signals stimulate muscle stem cell proliferation in vitro (Allen et al., 1995; Cornelison, 2008). However, in the regenerating muscle in vivo, ablation of Cxcr4 and Met in muscle stem cells did not impair their proliferation. On the contrary, EdU incorporation showed that proliferation of muscle stem cells increased in the TxGakaCxcr4;Met double and TxGakaMet single mutants (Figure 6—figure supplement 1), possibly due to compensatory mechanisms. Moreover, in TxGakaCxcr4;Met double and TxGakaMet single mutants, the ratio of MyoG+/Pax7+ cells was slightly increased, indicating that differentiation was mildly enhanced (Figure 6—figure supplement 2). We conclude that CXCR4 and MET signals cooperate to convey powerful cyto-protective functions.

MET and CXCR4 signaling protects muscle cells from TNFα-induced apoptosis

We next aimed to identify the factor that induces apoptosis of Met;Cxcr4 mutant muscle stem cells in the injured muscle. The pro-inflammatory cytokine TNFα is induced at the early stages of muscle regeneration and has pro- as well as anti-apoptotic effects on many cell types (Darnay and Aggarwal, 1999; Malka et al., 2000; Collins and Grounds, 2001; Zador et al., 2001; Warren et al., 2002; Aggarwal, 2003). We thus asked whether TNFα production might be responsible for the observed cell death. If freshly isolated muscle stem cells were cultured in media containing 2% horse serum, TNFα induced apoptosis (Figure 7A and B). This TNFα-induced cell death of cultured cells was rescued by the addition of HGF and CXCL12, or by the addition of 10% fetal calf serum. No cooperative effect of HGF and CXCL12 was observed in this cell culture setting (Figure 7C and D).
Figure 7.

CXCL12 and HGF protect muscle cells from TNFα-induced cell death.

(A–C) Primary muscle stem cells were isolated and cultured for 3 hr in the presence of TNFα plus/minus HGF and Cxcl12. Apoptotic cells were identified by TUNEL staining. (D) Quantification of TUNEL+ cells present in such cultures. (E, F) Immunohistological analysis of muscle stem cells (PAX7+, red) and apoptotic cells (TUNEL staining, green) in injured muscle (4 days post injury [dpi]) of control mice treated with TNFα neutralizing antibodies or control IgG 2 hr before acute injury. DAPI was used as a counterstain. (G) Quantification of PAX7+ cells in regenerating muscle (4 dpi) of control mice treated with TNFα neutralizing antibodies or control IgG. (H) Quantification of PAX7+ TUNEL+ cells in regenerating muscle (4 dpi) of control mice treated with TNFα neutralizing antibodies or control IgG. (I, J) Immunohistological analysis of muscle stem cells (PAX7+, red) and apoptotic cells (TUNEL staining, green) in injured muscle (4 dpi) of TxGakaMet mutants treated with TNFα neutralizing antibodies or control IgG 2 hr before acute injury. DAPI was used as a counterstain. (K) Quantification of PAX7+ cells in regenerating (4 dpi) muscle of TxGakaMet mice treated with TNFα neutralizing antibodies or control IgG. (L) Quantification of PAX7+ TUNEL+ cells in regenerating muscle from TxGakaMet mice treated with TNFα neutralizing antibodies or control IgG. (M, N) Immunohistological analysis of muscle stem cells (PAX7+, red) and apoptotic cells (TUNEL staining, green) in injured muscle (4 dpi) of TxGakaCxcr4;Met mutants treated with TNFα neutralizing antibodies or control IgG 2 hr before acute injury. DAPI was used as a counterstain. (O) Quantification of PAX7+ cells in regenerating muscle (4 dpi) of TxGakaCxcr4;Met mice treated with TNFα neutralizing antibodies or control IgG. (P) Quantification of PAX7+ TUNEL+ cells in regenerating muscle (4 dpi) of TxGakaCxcr4;Met mice treated with TNFα neutralizing antibodies or control IgG. Scale bars, 20 µm. Control: Pax7; TxGakaMet: Pax7 TxGakaCxcr4;Met: Pax7. All animals were treated with tamoxifen.

Quantification of TUNEL+ cells represented in the diagram shown in Figure 7—figure supplement 1.

C2C12 cells were cultured for 24 hr in the presence of TNFα plus/minus different concentration of neutralizing TNFα antibody. Apoptotic cells were identified by TUNEL staining and quantified.

CXCL12 and HGF protect muscle cells from TNFα-induced cell death.

(A–C) Primary muscle stem cells were isolated and cultured for 3 hr in the presence of TNFα plus/minus HGF and Cxcl12. Apoptotic cells were identified by TUNEL staining. (D) Quantification of TUNEL+ cells present in such cultures. (E, F) Immunohistological analysis of muscle stem cells (PAX7+, red) and apoptotic cells (TUNEL staining, green) in injured muscle (4 days post injury [dpi]) of control mice treated with TNFα neutralizing antibodies or control IgG 2 hr before acute injury. DAPI was used as a counterstain. (G) Quantification of PAX7+ cells in regenerating muscle (4 dpi) of control mice treated with TNFα neutralizing antibodies or control IgG. (H) Quantification of PAX7+ TUNEL+ cells in regenerating muscle (4 dpi) of control mice treated with TNFα neutralizing antibodies or control IgG. (I, J) Immunohistological analysis of muscle stem cells (PAX7+, red) and apoptotic cells (TUNEL staining, green) in injured muscle (4 dpi) of TxGakaMet mutants treated with TNFα neutralizing antibodies or control IgG 2 hr before acute injury. DAPI was used as a counterstain. (K) Quantification of PAX7+ cells in regenerating (4 dpi) muscle of TxGakaMet mice treated with TNFα neutralizing antibodies or control IgG. (L) Quantification of PAX7+ TUNEL+ cells in regenerating muscle from TxGakaMet mice treated with TNFα neutralizing antibodies or control IgG. (M, N) Immunohistological analysis of muscle stem cells (PAX7+, red) and apoptotic cells (TUNEL staining, green) in injured muscle (4 dpi) of TxGakaCxcr4;Met mutants treated with TNFα neutralizing antibodies or control IgG 2 hr before acute injury. DAPI was used as a counterstain. (O) Quantification of PAX7+ cells in regenerating muscle (4 dpi) of TxGakaCxcr4;Met mice treated with TNFα neutralizing antibodies or control IgG. (P) Quantification of PAX7+ TUNEL+ cells in regenerating muscle (4 dpi) of TxGakaCxcr4;Met mice treated with TNFα neutralizing antibodies or control IgG. Scale bars, 20 µm. Control: Pax7; TxGakaMet: Pax7 TxGakaCxcr4;Met: Pax7. All animals were treated with tamoxifen.

Quantification of TUNEL+, PAX7+ and PAX7+TUNEL+ cells represented in the diagrams shown in D, G, H, K, L, O and P (Figure 7).

Quantification of TUNEL+ cells represented in the diagram shown in Figure 7—figure supplement 1.
Figure 7—figure supplement 1.

Neutralizing capacity of TNFα antibody used in Figure 7.

C2C12 cells were cultured for 24 hr in the presence of TNFα plus/minus different concentration of neutralizing TNFα antibody. Apoptotic cells were identified by TUNEL staining and quantified.

Neutralizing capacity of TNFα antibody used in Figure 7.

C2C12 cells were cultured for 24 hr in the presence of TNFα plus/minus different concentration of neutralizing TNFα antibody. Apoptotic cells were identified by TUNEL staining and quantified. Finally, using neutralizing antibodies against TNFα,we tested whether the loss of muscle stem cells in the absence of MET and CXCL12 signaling during regeneration in vivo was caused by TNFα. The efficacy TNFα antibodies was verified in a cell culture experiment (Figure 7—figure supplement 1). We observed a pronounced rescue of PAX7+ cells in the regenerating muscle of TxGakaMet and TxGakaCxcr4;Met mutant mice after injection of TNFα neutralizing antibodies (Figure 7E–P). Taken together, these data demonstrate that MET and CXCR4 signaling cooperate in vivo to protect muscle stem cells from TNFα-induced apoptosis in the inflammatory environment encountered after injury.

Discussion

Muscle injury results in an acute inflammatory response causing the recruitment of macrophages and neutrophils. These cells remove cellular debris at the site of injury and provide signals that are beneficial for muscle repair. In addition, they release a multitude of chemokines, as well as reactive oxygen species and enzymes needed to degrade the debris, thereby creating a hostile environment that muscle stems cells have to withstand in order to regenerate the muscle and self-renew (Tidball, 2005; Chazaud et al., 2009; Saclier et al., 2013b; Londhe and Guttridge, 2015; Tidball, 2017). Our analysis of the in vivo function of MET and CXCR4 demonstrates an important cooperative role in muscle repair that protects stem cells against the adverse environment created by the acute inflammatory response. Previous studies had shown that HGF can elicit muscle stem cell proliferation in culture and that CXCL12 has mitogenic activity on myogenic C2C12 cells (Allen et al., 1995; Gal-Levi et al., 1998; Odemis et al., 2007). Further, injection of HGF into the intact muscle activates muscle stem cells (Tatsumi et al., 1998), and ablation of Met in muscle stem cells interferes with entry into Galert, a ‘alerted’ state of quiescence observed in muscle stem cells after injury of the contralateral muscle or of other unrelated organs (Rodgers et al., 2014). HGF/MET signaling also affects additional aspects of muscle stem cell biology. In particular, HGF suppresses differentiation of cultured myogenic cell lines and of primary muscle stem cells (Gal-Levi et al., 1998; Siegel et al., 2009). Thus, HGF had been implicated in multiple aspects of muscle stem cell behaviors, but its role as cyto-protective factor had not been addressed. Interestingly, cyto-protective functions of HGF/MET were reported in several cell types and injury models, indicating that HGF might be part of a general defensive mechanism in response to tissue damage. In particular, ectopic application of HGF prior to or shortly after an insult protects cells in the liver, kidney, and heart from damage (Ueda et al., 1999; Zhou et al., 2013; Matsumoto et al., 2014; Pang et al., 2018). Moreover, after injury to the liver, kidney, heart, or skeletal muscle, increased HGF expression can be observed in the damaged organs, and plasma levels of HGF rise quickly after injury (Michalopoulos and DeFrances, 1997; Nakamura et al., 2000; Matsumoto and Nakamura, 2001). It was proposed that release from extracellular matrix might account for the fast rise in HGF plasma levels (Shimomura et al., 1995; Tatsumi et al., 1998). In addition, various cytokines, among them interleukin-1 and interleukin-6, activate HGF transcription, which might account for the increased HGF transcripts observed after tissue damage (Birchmeier et al., 2003). We demonstrate here that loss of Met impairs the resistance of muscle stem cells against acute inflammation. Moreover, in vivo the additional loss of Cxcr4 exacerbated the deficits observed after loss of Met. The cooperative effect that we detected here in vivo is reflected by the fact that both receptors, Met and Cxcr4, use in part overlapping downstream signaling cascades but also activate distinct signaling molecules. Tyrosine phosphorylation of MET results in the activation of various signaling events that regulate cell motility, proliferation, and survival; among them RAS/MAPK, PI3-kinase/AKT, PLCγ/PKC, RAC/CDC42, and CRK (Birchmeier et al., 2003; Gentile et al., 2008). CXCR4 uses G-proteins to transmit signals into the cytoplasm, which involves activation of second messenger-regulated serine/threonine kinases or ion channels. However, CXCR4 also activates RAS/MAPK, PI3-kinase/AKT, and CRK signaling, which is particularly well documented in cancer cells (Teicher and Fricker, 2010). Among these cascades, PI3-kinase/AKT is well known to act anti-apoptotically, and MAPK/ERK signals can counteract the apoptotic activity of TNFα (Tran et al., 2001; Franke et al., 2003). TNFα is one of many pro-inflammatory cytokines that are rapidly induced upon acute muscle injury, and TNFα is highly expressed by pro-inflammatory macrophages. The primary role of TNFα is to regulate immune cells, but it also affects the proliferation and differentiation of cultured muscle cells (Wallach et al., 1999; Li, 2003; Luo et al., 2005; Palacios et al., 2010). Mice lacking TNFα receptors p55 and p75 show that TNFα does not play an essential role in muscle regeneration, indicating that this cytokine seems to act redundantly with other factors (Collins and Grounds, 2001). However, systemic injection of TNFα neutralizing antibodies protected dystrophic skeletal muscle of mdx mice from necrosis and increased the number of PAX7+ cells (Palacios et al., 2010). This indicates that TNFα exacerbates muscle fiber damage and, in addition, impairs muscle stem cell maintenance in dystrophic muscle. Our analysis indicates that TNFα signals are also damaging for muscle stem cells during acute inflammation after injury, but that endogenous HGF and CXCL12 may counteract this. Effects of TNFα are modulated by other signals, and particularly MAPK/ERK activity can override the apoptotic TNFα signal (Tran et al., 2001; Aggarwal, 2003; Wada and Penninger, 2004; Lu and Xu, 2006; Lau et al., 2011). Acute skeletal muscle injury resulting in inflammation is a common clinical condition caused by trauma, severe contraction, chemicals, myotoxins, and ischemia. Similarly, acute inflammation is observed in muscle diseases like dystrophy (Kharraz et al., 2014; Tidball et al., 2018). Our genetic experiments indicate that HGF/MET and CXCL12/CXCR4 signaling protects muscle stem cells against the noxious environment generated by the inflammatory response. Exogenous HGF was previously tested in muscle injury and increased the numbers of activated muscle stem cells, but did not enhance fiber growth (Miller et al., 2000). Thus, in healthy muscle, endogenous factors, among them HGF, suffice to ensure appropriate regeneration. Nevertheless, in muscle disease where repair mechanisms fail, enhanced cyto-protection of muscle stem cells appears to be beneficial (Palacios et al., 2010). Whether HGF/MET and CXCL12/CXCR4 signaling protects against TNFα-induced damage in such disease settings will need further investigation.

Materials and methods

RNA isolation and qPCR

RNA from the entire muscle and from FACS-isolated muscle stem cells was extracted using TRIzol reagent (15596026, Thermo Fisher Scientific) following the manufacturer’s instructions. qPCR was performed using SYBR green master mix (4309155, Thermo Fisher Scientific) as described previously (Bröhl et al., 2012). PCR primers are listed in Key resources table. β-Actin was used for normalization.

Immunohistochemistry

Immunohistochemistry was performed on 12 μm cryo-sections of muscle biopsy samples fixed in Zamboni’s fixative for 20 min as described previously (Bröhl et al., 2012). For staining of Pax7, sections were incubated in Antigen Unmasking Solution buffer (H-3300, Vector Laboratories) for 20 min at 80°C. Primary and secondary antibodies used are listed in Key resources table. Primary antibodies were incubated overnight, and secondary antibodies for 1 hr at 4°C in blocking solution. DAPI (D9542, Sigma-Aldrich) was used as a counterstain to label nuclei. To detect apoptotic cells, Pax7 immunohistochemistry was combined with TUNEL TMR Red detection kit according to the manufacturer’s instruction (12156792910, Roche). To monitor proliferating cells, EdU (50 µg/g body weight) was given i.p. 2 hr before the isolation of the muscle. EdU was detected using Click chemistry (EdU-Click 647, BCK-EdU647, baseclick GmbH) and Biotin picolyl azide (900912, Sigma-Aldrich) as substrate. Detection was performed with fluorophore-coupled streptavidin. Images were acquired using a LSM700 confocal microscope and processed using Adobe Photoshop (Adobe Systems).

Isolation of muscle stem cells and muscle injury

Muscle stem cells were isolated from skeletal muscle using fluorescent-activated cell sorting (FACS) as described (Bröhl et al., 2012). Shortly, muscle tissue was minced, enzymatically digested with 1.5 U/ml NB4G Collagenase (S1745401, Serva), and 2.4 U/ml Dispase (04942078001, Sigma-Aldrich). Mono-nucleated cells were isolated and labeled with antibodies against VCAM, Sca1, CD45, CD31 (AF643, rndsystems; BD Bioscience). VCAM+ Sca1 CD31-CD45-cells were isolated using a BD Aria III sorter (BD Bioscience) and dead cells were excluded by propidium iodide staining (P4864, Sigma-Aldrich). Muscle stem cells from regenerating muscles were isolated from animals carrying Pax7nGFP allele using the digestion procedure described above. Mono-nucleated cells GFP+ cells were isolated by FACS. Cells were collected in TRIzol RNA extraction reagent (15596026, Thermo Fisher Scientific) for RNA isolation or in DMEM/10% FCS for cultivation. Muscle injury was induced by injecting 30 µl of cardiotoxin (10 µM; C9759, Sigma-Aldrich) into the tibialis anterior muscle of 8- to 12-week-old mice. Muscle injected with phosphate buffered saline (10010056, Thermo Fisher Scientific) was used as a control. Recombination using CreERT2 alleles was induced as described (Murphy et al., 2011), and the injury was induced 10 days after the last tamoxifen administration. Antigen affinity-purified polyclonal goat human/mouse TNFα antibody (AF-410-NA, rndsystems, LOT NQ2519111, NQ2520111, NQ2418041) was dissolved in PBS and 100 µg were injected in a single injection i.p. 2 hr before the cardiotoxin injection. Mice injected with 100 µg goat IgG (AB-108-C, rndsystems) served as control. The animals were analyzed 4 days after injury.

Mouse strains

The Cxcr4flox, Metflox, Pax7nGFP, Pax7iresCre, Pax7CreERT2Fan , and Pax7iresCreERT2Gaka mouse strains have been described previously (Borowiak et al., 2004; Keller et al., 2004; Nie et al., 2004; Lepper et al., 2009; Sambasivan et al., 2009; Murphy et al., 2011). Heterozygous animals carrying the Pax7iresCre allele served as controls for Pax7iresCre/+;Metflox/flox (coMet) mutants. Heterozygous animals carrying the Pax7iresCreERT2Gaka or Pax7CreERT2Fan treated with tamoxifen served as controls for Pax7iresCreERT2Gaka/+;Metflox/flox (TxGakaMet) and Pax7CreERT2Fan/-;Metflox/flox (TxFanMet) mutants, respectively, in all experiments but those shown in Figure 3—figure supplement 1A–D, where Cre-negative littermates served as controls. Mice were maintained on a mixed 129/Sv and C57BL/6 genetic background. All experiments were conducted according to regulations established by the Max-Delbrück-Center for Molecular Medicine (MDC) and the Landesamt für Gesundheit und Soziales, Berlin (0320/10; 0130/13).

Cultivation, induction of apoptosis, and rescue of muscle stem cells in culture

Neutralization capacity of the TNFα antibody (AF-410-NA, rndsystems) was tested in vitro. C2C12 cells (ATCC, CRL-1772; not listed by ICLAC) in DMEM (1196508, Thermo Fisher Scientific) containing 2% horse serum (16050122, Thermo Fisher Scientific), 1% Penicillin/Streptomycin (15140122, Thermo Fisher Scientific), and 1% GlutaMax (35050061, Thermo Fisher Scientific) were exposed to 60 ng/ml recombinant TNFα (210-TA, rndsystems) and different concentrations of TNFα neutralizing antibody (60 ng/ml, 180 ng/ml, 600 ng/ml, and 1800 ng/ml) overnight, fixed in 4% paraformaldehyde (PFA), and apoptotic cells were detected using TUNEL TMR Red detection kit according to the manufacturer’s instruction (12156792910, Roche). The ratio of TUNEL+ DAPI+/DAPI+ cells was quantified in randomly chosen areas of triplicate experiments using a LSM700 Zeiss confocal microscope and ImageJ ‘cell counter’ plug-in for quantification. The cell identity of the C2C12 cell line used in this study was tested by in vitro differentiation into multinuclear myotubes. Differentiation was achieved by replacing growth media (GM) ( 10% fetal calf serum (FCS) F7524, Sigma-Aldrich, DMEM 1196508, Thermo Fisher Scientific, 1% Penicillin/Streptomycin 15140122, Thermo Fisher Scientific, 1% GlutaMax 35050061, Thermo Fisher Scientific) to differentiation media (DM) (2% horse serum 16050122, Thermo Fisher Scientific, DMEM 1196508, Thermo Fisher Scientific, 1% Penicillin/Streptomycin 15140122, Thermo Fisher Scientific, 1% GlutaMax 35050061, Thermo Fisher Scientific). Formation of myotubes was observed 4 days after replacing the GM to DM. Differentiation was confirmed by immunohistochemistry using an antibody against Myogenin. The C2C12 cell line was tested negative for mycoplasma contamination. FACS-isolated muscle stem cells were cultivated on 10% Matrigel (354230, Corning Life Sciences) in DMEM/F-12 (11320074, Thermo Fisher Scientific) containing 10% fetal calf serum (F7524, Sigma-Aldrich), 5% horse serum (16050122, Thermo Fisher Scientific), 0.1% bovine FGF (F5329, Sigma-Aldrich), 1% Penicillin/Streptomycin (15140122, Thermo Fisher Scientific), and 1% GlutaMax (35050061, Thermo Fisher Scientific) for 24 hr, and subsequently incubated in DMEM/F-12 containing 2% horse serum. Recombinant human TNFα (210-TA, rndsystems) was added to a final concentration of 120 ng/ml, and cell survival was assayed 3 hr later. Recombinant Cxcl12 (250-20A, Peprotech) and HGF protein (kindly provided by W. Birchmeier) were used at final concentrations of 20 ng/ml and 25 ng/ml, respectively. After 3 hr incubation, cells were fixed in 4% PFA and washed twice with phosphate-buffered saline (PBS) (10010056, Thermo Fisher Scientific). To detect apoptotic cells, Pax7 immunohistochemistry was combined with TUNEL TMR Red detection according to the manufacturer’s instruction (12156792910, Roche); DAPI (D9542, Sigma-Aldrich) was used as a counterstain. The ratio of TUNEL+ DAPI+/DAPI+ cells was quantified in randomly chosen areas of three different experiments using a LSM700 Zeiss confocal microscope and ImageJ ‘cell counter’ plug-in.

Computational analysis and statistics

Gene expression levels of freshly isolated and cultured muscle stem cells were previously determined using gene expression microarrays (Liu et al., 2013; Latroche et al., 2017). The *.CEL files of scanned Affymetrix mRNA expression microarrays were downloaded from the GEO repository (accession codes GSE47177 and GSE103684, n = 3 replicates/condition). Normalization and background corrections were performed using the AffySTExpressionCreator v0.14 on the GenePattern Server (Reich et al., 2006) running the Robust Multi-array Average (RMA) algorithm (Irizarry et al., 2003). The relative signal intensities of gene expression of muscle stem cell activation were plotted against the time axis. Three or more animals were used per genotype and experiment. Microsoft Excel and GraphPad Prism 9 were used for statistical analysis. Data were analyzed using an unpaired, two-tailed t-test. p-values < 0.05 were considered significant. Results are shown as arithmetical mean ± standard error of the mean (SEM) and the dots represent the mean of individual animals. ns: not significant, p>0.05, *p<0.05, **p<0.01, ***p<0.001. In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses. Acceptance summary: MET/HGF and CXCR4/CXCL12 signals have long been known to play roles in muscle stem cells, but in this manuscript the authors demonstrate a new role for MET and CXCR4. Using conditional mutagenesis and rescue experiments, they show that MET and CXCR4 act cooperatively during regeneration to protect stem cells from apoptosis, via inhibition of the pro-inflammatory cytokine TNFα. Decision letter after peer review: Thank you for submitting your article "Met and Cxcr4 signals cooperate to protect muscle stem cells against inflammation-induced damage during regeneration" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, including Gabrielle Kardon as the Reviewing Editor and Reviewer #1, and the evaluation has been overseen by Didier Stainier as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: So-ichiro Fukada (Reviewer #2). The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission. Summary: Lahmann and colleagues examine in "Met and Cxcr4 signals cooperate to protect muscle stem cells against inflammation-induced damage during regeneration" the cell-autonomous role of Met and Cxcr4 signaling in satellite cells during regeneration. The role of Met signaling, in particular, in muscle regeneration has been examined by multiple papers over many years, and roles in activation, proliferation, migration, fusion, and quiescence have all been implicated. The novel finding of this paper is that the authors find that Met and Cxcr4 in satellite cells protects these cells from apoptosis early in regeneration (3 days post injury) in response to TNFα expression. They also suggest that Met and Cxcr4 act cooperatively and HGF/Met and CXCL12/Cxc4 signaling act in an autocrine manner to protect satellite cells. The reviewers were generally enthusiastic about the proposed new role of Met and Cxcr4 in protecting satellite cells from apoptosis during regeneration. The reviewers found that manuscript is well written and the experimental approach is overall of high-standards, involving a large number of genetic models. However, there were several deficiencies noted (particularly with respect to controls) that need to be addressed. The data supporting that HGF/Met and CXCL12/Cxcr4 functions in an autocrine manner was found to be less well supported and in need of more experimental data to be included in the manuscript. Essential revisions: 1. A major concern is the issue of the experimental mice used in these experiments. For most experiments Pax7iresCre mice were used to delete Met and/or Cxcr4. As Pax7iresCre deletes in muscle progenitors during development, both the satellite cells and myofibers have Met and Cxcr4 deleted at the start of the regeneration experiments and thus the experiments are not strictly testing the role of Met and/or Cxcr4 only during muscle regeneration. The authors have addressed this in a small number of experiments in Figure 1 and Figure S1. They show that the cross-sectional area of myofibers and the number of satellite cells does not differ between control and Pax7iresCre uninjured muscle, suggesting that loss of Met in Pax7+ cells does not have a major developmental defect. In addition they show (Figure 1K and S1B-E) that in response to injury the number of Pax7+ cells is reduced 7dpi with deletion in Pax7iresCre as well as Pax7iresCreERT2GAKA and Pax7CreERT2FAN mice. Thus they argue that the results with the Pax7iresCre are similar to the results with the tamoxifen-inducible Pax7CreERT2 mice and reflect the role of Met during regeneration and not during development. However, the results in Figure 1K and Figure S1E are not able to be compared because they use different metrics (Pax7+ cells/100 myofibers vs Pax7+ cells/area) and the identity of controls are unclear. Thus whether the results with the Pax7iresCre really reflect the requirement of Met and/or Cxcr4 strictly during regeneration is uncertain. The authors need to repeat key experiments using the Pax7CreERT2FAN or Pax7CreERT2GAKA mice. 2. There is concern about whether the appropriate control mice have been used in the genetic experiments. Throughout all figure panels, the full genotype of all control and experimental mice should be displayed. Particularly in experiments using Pax7CreERT2FAN, the control mice should be Pax7CreERT2Fan/+; Met+/+ and with tamoxifen. The issue of the control mice used was particularly of concern in Figure S1E. 3. The authors conclude that HGF/Met and CXCL12/Cxcr4 signaling is autocrine in satellite cells. However, they do not provide enough data to support such a conclusion. They show in Figures 1D and 2A by smFISH that HGF and CXCl12 is co-expressed with Pax7 in satellite cells, although there was some concern about the quality of this data. The expression of HGF and CXCL12 in satellite cells could be strengthen by examining their expression via qPCR in isolated satellite cells rather than in whole muscle homogenates. Even with such data, the authors can only suggest, but not conclude, that HGF and CXCL12 function in an autocrine manner. HGF and CXCL12 from other cell types may be critical. A definitive test would require that HGF or CXCL12 are conditionally deleted in satellite cells via Pax7CreERT2. 4. The authors propose that Met and Cxcr4 act cooperatively to prevent TNFa-mediated apoptosis. While the authors show the number of apoptotic Pax7+ cells is increased in Pax7iresCre/+; Metfl/fl; Cxcr4fl/fl (Figure 3C), they do not quantify the number of apoptotic Pax7+ cells in Pax7iresCre/+; Metfl/fl or Pax7iresCre/+; Cxcr4fl/fl. Also the control genotype for these experiments is not detailed. The data for all four genotypes needs to be included in order for a role of Met and Cxcr4 cooperativity to be assessed. 5. Figure 4A-C shows an increase in propidium iodide+ satellite cells cultured in the presence of TNFa, which is rescued when either HGF, CXCL12, or HGF and CXCL12 are added. Propidium iodide is an assay for nonviable cells. The authors should conduct this experiment with TUNEL assay (as in Figure 3A-C). In addition, these data suggest that either HGF or CXCL12 are sufficient to rescue cell death and there is no additive benefit to using both HGF and CXCL12. This does not support the contention that HGF and CXCL12 are both required to protect satellite cells from TNFα -induced apoptosis. 6. The in vivo role of Met and Cxcr4 in protection against TNFa -induced apoptosis needs to be strengthened. The authors need to show in vivo whether loss of Met alone leads to an increase in satellite cell apoptosis at 3 dpi. Also, the rescue experiments using neutralizing TNFa antibody (Figure 4D-F) only assay the number of Pax7+ cells/area and not changes in numbers of apoptotic Pax7+ cells; this should be included.Reviewer #1: Lahmann and colleagues examine in "Met and Cxcr4 signals cooperate to protect muscle stem cells against inflammation-induced damage during regeneration" the cell-autonomous role of Met and Cxcr4 signaling in satellite cells during regeneration. The role of Met signaling, in particular, in muscle regeneration has been examined by multiple papers over many years, and roles in activation, proliferation, migration, fusion, and quiescence have all been implicated. The novel finding of this paper is the implication that Met and Cxcr4 protects satellite cells from apoptosis early in the regenerative response (3 days post injury) due to TNFa expression. They also suggest that Met and Cxcr4 act cooperatively and in an autocrine manner to protect satellite cells. The finding of a role for Met and Cxcr4 for cooperatively blocking apoptosis during regeneration is interesting, but in need of further data to support. There is little data in this to support that HGF/Met and CXCL12/Cxc4 functions in an autocrine manner. See specific comments. 1. The authors show by qPCR that satellite cells express Met and by smFish that some satellite cells express HGF and conclude "HGF I (probably a typo – "is") produced by muscle stem cells and functions in an autocrine manner during repair" p.5. Based on their expression data and conditional deletion in satellite cells, they can not conclude this. They show that Met is required in satellite cells, but the source of HGF may be from satellite cells or many other cell types present in regenerating muscle that they have not tested. 2. Figure 1E-L: In these experiments they have deleted Met using the Pax7iresCre, and so Met has been deleted in muscle progenitors throughout development. They need to explicitly state this in the last paragraph of p. 5. I find it surprising that there is no developmental phenotype (neither number of Pax7+ muscle progenitors or myofiber cross-sectional area is affected). Please make sure to highlight this in text. Also, please put the actual genotype of control and experimental mice on the Figure panels – do not use the abbreviation "control" and "coMet"; we need to see the actual genotypes of these mice. The authors state that "similar deficits were observed when Met was mutated in adult muscle stem cells using the tamoxifen-inducible Pax7iresCreERT2GAKA allele". Only the reduction in Pax7+ satellite cells at 7 dpi is shown and not the changes in myofiber cross-sectional area; this should be shown. 3. The authors write on p. 6 that "loss of Met in muscle stem cells results in a mild regeneration deficit that is accompanied by a reduction in the number of muscle stem cells". However, the authors never analyze any muscle regeneration phenotypes after 7 dpi. Certainly the work of Webster and Fan 2013 shows a severe regeneration phenotype in the myofibers at later time points (20 dpi). The authors need to look at later time points post injury or explicitly acknowledge the work of Webster and Fan, which clearly shows a regeneration defect. 4. Figure 2: The case of cooperativity between Met and Cxcr4 would be made easier to see if they included the data on Pax7iresCre;Cxcr4fl/fl mice in the main figure and not in Figure S2. It is unclear if there is increased fibrosis if both Met and Cxcr4 are deleted, versus individual loss of Met and Cxcr4. If they want to make this point they need to include all 4 genotypes (Control that is specified; Pax7iCre; Cxcr4fl/fl; Pax7iCre;Metfl/fl; and Pax7iCre;Cxcr4fl/fl;Metfl/fl) and quantify the degree of fibrosis. 5. Figure 3: Panels A-C. The authors show an increase in the number of Tunel+Pax7+ cells at 3dpi in Pax7iCre; Cxcr4fl/fl;Metfl/fl mice. The authors need to show the quantification of Tunel+Pax7+ cells at 3 dpi for Pax7iCre; Cxcr4fl/fl and Pax7iCre;Metfl/fl mice. Also please write the genotype of the "control" mice. Panels D-H. The authors need to show the number of Pax7+ and BrdU+Pax7+ cells for all four genotypes: 1. control, which needs to be specified; 2. Pax7iCre; Cxcr4fl/fl; 3. Pax7iCre;Metfl/fl; and 4. Pax7iCre;Cxcr4fl/fl;Metfl/fl. Without all four genotypes, it is not possible to infer whether the effects of Met and Cxcr4 really are cooperative. 6. Figure 4: 1. The authors show in Panel C that either Cxcl12 or HGF alone is sufficient to rescue TNFa induced satellite cell death in culture and the effects of Cxcl12 and HGF do not lead to a further rescue. Thus it is most parsimonious to argue that Cxcl12 and HGF do not have a synergistic (cooperative) or additive effect on rescue of cell death – either factor will work. 2. Panel D. The authors show that blocking TNFa partially rescues the number of Pax7+ cells when Cxcr4 and Met are deleted in Pax7+ cells. It is important for the authors to show the effects of TNFa blockade on Pax7iCre; Cxcr4fl/fl and Pax7iCre;Metfl/fl, if there is increased apoptosis in these genotypes (see comments above). 7. The authors claim that the "major role" of Met and Cxcr4 is to "work together in order to protect stem cells against the adverse environment created by the acute inflammatory response." This is clearly not the only role Met. There are many papers showing multiple other roles for Met in regeneration (e.g. Webster and Fan 2013 amongst many others). They need to modify this statement and acknowledge the vast literature on this subject. 8. The authors claim that HGF/Met and Cxcl12/Cxcr4 signaling is autocrine (p. 11). However, they have not explicitly tested this by deleting HGF or Cxcl12 in satellite cells. They need to remove this claim in the Discussion and Abstract. Reviewer #2: Lahmann et al., focused on cytokines which is dramatically increased in early phase of muscle regeneration. Among them, they investigated the roles of HGF and Cxcl12 using conditional KO mice. Intriguingly, the loss of them did not affect the proliferation ability of satellite cells, but functioned to protect satellite cells from cell death induced by TNF-a. in vivo assay system, authors showed the data indicating the influence of loss of HGF and Cxcl12 were rescued by TNF-a neutralizing antibodies. Most of conclusion is supported by the present data. Please respond the following comments. 1. Gene expression pattern of Cxcl12 is similar with that of TNF-a. While, the peak of HGF expression is at 3 dpi, meaning that the peak of HGF/c-Met signaling is not matched with that of TNF-a. Pro-HGF, biologically inactive HGF form, binds to the ECM. The following paper shows that HGF is stored in normal adult skeletal muscle. Is there a possibility that the stored HGF function to suppress the cell death in the early phase of regeneration? While considering this result, please discuss the different expression pattern of HGF and TNF-a. HGF/SF is present in normal adult skeletal muscle and is capable of activating satellite cells. Tatsumi R, Anderson JE, Nevoret CJ, Halevy O, Allen RE. Dev Biol. 1998 Feb 1;194(1):114-28. 2. In this study, the impact of Met-null on cell death of satellite cells is critical. Authors showed the remarkable increased number of TUNEL+ cells in coCxcr4/Met satellite cell. While, there is no data showing the relevance between Met-null adn apoptosis in vivo. In order to conclude the protective function of Met, reviewer would like to ask authors to present the data. 3. In Figure 4, necrotic cells were also positive for Propidium Iodide. Reviewer recommends to detect apoptotic cells using TUNEL assay.Reviewer #3: The study presented by Lahmann et al., proposes a specific role of Met and Cxcr4 during muscle regeneration that is distinct from the already reported involvement during muscle cells migration. Instead, the authors use genetic mouse models to show that Met and Cxcr4 cooperate in a cell-autonomous manner to protect muscle stem cells against TNFα-induced damage during repair. The manuscript is well written and the experimental approach is overall of high-standards, involving a large number of genetic models. However, a series of control experiments are needed to solidify the results. Concerns: I raise two main concerns: 1. For the majority of the experiments, a constitutive Pax7-Cre line is used. In the case of Met flox, tamoxifen-inducible Pax7-CreERT2 line is used but the appropriate controls are missing. 2. The RNA ISH shown in Figure 1D and 2A need more scrutiny. The overlapping pattern between the different probes is alarming and further controls are needed. Specifically: – Figure 1 – Figure 1A, B, C The transcript levels of several cytokines are measured in resting and regenerating muscle. It seems that for Figure 1A and B whole muscle extracts were used whereas 1C results (Met expression) are based on isolated muscle stem cells. It would be informative to look at the expression of the other transcripts in isolated MuSCs, and especially Hgf, as it is later suggested to be acting in an MuSC-autocrine fashion (see Figure 1D). – Figure 1D The authors conclude that "HGF is produced [exclusively] by muscle stem cells and functions in an autocrine manner during repair".This is based on the RNA ISH that shows Hgf expression exclusively and in all Pax7 cells. Some additional experiments are needed to support unequivocally this conclusion. Hybridization protocols can produce artefacts if there are aggregates or other impurities. The similarity between the Pax7 and the HGF pattern is somewhat worrisome. The authors could combine PAX7 IF with Hgf ISH to confirm their observations. In addition, the double ISH could be performed in resting muscle, where Hgf is supposed to be absent or lower. In any case, quantification of the Pax7+/Hgf+ cells is needed. – Figure 1 E-L The loss of Pax7, specifically during regeneration, is a very interesting phenotype. Some additional information on the proliferation, differentiation and apoptosis kinetics and status of the mutant cells would give important insights into the role of Met in this context. One general concern is that the analysis of mice with constitutive Cre (Pax7-Cre here) is always risky. It is true that the authors argue that this is not an issue as "Pax7 is first expressed in progenitors that have already reached their targets" and also show that the number of Pax7 cells and the fiber diameter are the same in the resting muscle between control and coMet (Figure 1E-L). This shows, indeed, that in the Pax7-Cre; Met flox/flox mice there is no major MuSC phenotype, yet it does not exclude that the mutant MuSCs, fibres and all other cell types, for all we know, are identical at the molecular level. In fact, as shown in Figure S1J, K the satellite cells in the resting muscle of Pax7-Cre; Met flox/flox mice have half Pax7 transcript and protein. The authors are well aware of this problem and used two different mouse lines with tamoxifen-inducible Pax7-CreERT2, that nicely recapitulated the loss of MuSCs phenotype (Figure S1B-E). From this figure (Figure S1B-E), however, it becomes evident that all the compound mice were compared to the same control. Instead, each mutant mouse should be compared to its corresponding control, and even more so for the Pax7-CT2-FAN knock-in/knock-out allele that is notoriously impacting muscle regeneration (here, the control should be tamoxifen-treated Pax7-CT2-FAN/+; Met +/+ mice). In summary, I propose that the authors provide the appropriate comparison using the corresponding controls, and if the results hold true, transfer the conditional Pax7-CreERT2 in the main figure and the constitutive in the supplemental. – Figure 2 Figure 2A: same comments as for Figure 1D. The overlap in the ISH is worrisome. Nevertheless, a very interesting Cxcr4/Met synergistic muscle regeneration phenotype is described. It is unfortunate that all this series of experiments is performed with a constitutive Pax7-Cre line. [Editors' note: further revisions were suggested prior to acceptance, as described below.] Thank you for resubmitting your article “Met and Cxcr4 signals cooperate to protect muscle stem cells against inflammation-induced damage during regeneration" for consideration by eLife. Your revised article has been reviewed by 2 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Didier Stainier as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: So-ichiro Fukada (Reviewer #2). The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission. Overall, we found that this is an extremely responsive revision to the critiques of the previous submission, the manuscript is substantially improved, and the manuscript is an important and original contribution to our understanding of the role of Met and Cxc4 signaling in muscle stem cells during regeneration. Only two small revisions to the manuscript are requested. Essential Revisions: 1) Figure 7D and S7A: Please, avoid bar plots showing only the average, instead include the individual countings (as you have done for all the other plots). 2) The Abstract needs some changes as some sentences are vague or poorly written. Abstract Acute muscle injury is followed by an inflammatory response, tissue repair, and the generation of new muscle fibers by resident muscle stem cells. During regeneration, cytokines and growth factors are produced by the various cell types in the muscle that regulate inflammatory cell behavior as well as muscle stem cell activity, a process well characterized in murine injury models. A better understanding of the function of cytokines and growth factors might be useful to stimulate muscle repair, but needs to distinguish the factor's effects on the different cell types that participate in the repair process [unclear, please re-write]. We show here that MET and CXCR4 cooperate to protect muscle stem cells against TNFα-induced damage during repair. This powerful cyto-protective role was revealed by the genetic ablation of Met and Cxcr4 in muscle stem cells of mice, which resulted in severe apoptosis during the early stages of regeneration. This effect was be [typo] rescued by tnfa neutralizing antibodies. we conclude that muscle stem cells require factors that protect them in the harsh inflammatory environment encountered in acute injury. [too vague for an abstract]. Reviewer #2: In this revised version, one conclusion (autocrine role of Met and Cxcr4 signaling) and the results from gp130-mutatnt mice have been excluded. However, the main conclusion, the protective role of Met/Cxcr4 signaling against TNF-α, has been strengthened. This is an important work in this research field. Reviewer #3: This is an exemplary revision of a manuscript, where the authors have addressed in depth all the points raised by the 3 reviewers. The revised manuscript includes careful characterization of all possible combinations of genotypes and treatments that serve as robust controls. Also, it is appreciated that the authors have removed the Hgf, following a careful examination of its expression (as suggested by the reviewers). In view of this, the autocrine Met/HGF model is no longer suggested. Despite this modification, the study provides very interesting and original data on a novel, protective role of old players in the muscle field -Met and Cxcr4- that would be of great interest for a broad readership. Figure 7D and S7A: Please, avoid bar plots showing only the average, instead include the individual countings (as you have done for all the other plots). Summary: Lahmann and colleagues examine in "Met and Cxcr4 signals cooperate to protect muscle stem cells against inflammation-induced damage during regeneration" the cell-autonomous role of Met and Cxcr4 signaling in satellite cells during regeneration. The role of Met signaling, in particular, in muscle regeneration has been examined by multiple papers over many years, and roles in activation, proliferation, migration, fusion, and quiescence have all been implicated. The novel finding of this paper is that the authors find that Met and Cxcr4 in satellite cells protects these cells from apoptosis early in regeneration (3 days post injury) in response to TNFα expression. They also suggest that Met and Cxcr4 act cooperatively and HGF/Met and CXCL12/Cxc4 signaling act in an autocrine manner to protect satellite cells. The reviewers were generally enthusiastic about the proposed new role of Met and Cxcr4 in protecting satellite cells from apoptosis during regeneration. The reviewers found that manuscript is well written and the experimental approach is overall of high-standards, involving a large number of genetic models. However, there were several deficiencies noted (particularly with respect to controls) that need to be addressed. We appreciate the comments about the clarity of the manuscript and about their overall favorable assessment. We have now included a comparison of the phenotypes of the Met mutation (Figures 2 and 3), using as controls the different Pax7Cre lines as requested which is indicated in detail in the point by point response. Moreover, we now used the Pax7iresCreERT2Gaka for all subsequent experiments (Figures 5-7), and the results obtained with this line substantiate and extend our previous findings. The data supporting that HGF/Met and CXCL12/Cxcr4 functions in an autocrine manner was found to be less well supported and in need of more experimental data to be included in the manuscript. We were unable to verify the RNAscope data that indicated that Hgf is expressed by activated muscle stem cells using qPCR, and we thank the reviewers for pointing out that these data might be problematic. Neither our qPCR data nor published microarray datasets support the notion that Hgf is expressed at appreciable amounts in activated MuSC. We therefore removed our RNAscope data, and deleted the suggestion that Hgf and Cxcl12 signal in an autocrine manner. The new qPCR data are inserted in Figures 1 and 4 of the revised manuscript. Essential Revisions: 1. A major concern is the issue of the experimental mice used in these experiments. For most experiments Pax7iresCre mice were used to delete Met and/or Cxcr4. As Pax7iresCre deletes in muscle progenitors during development, both the satellite cells and myofibers have Met and Cxcr4 deleted at the start of the regeneration experiments and thus the experiments are not strictly testing the role of Met and/or Cxcr4 only during muscle regeneration. The authors have addressed this in a small number of experiments in Figure 1 and Figure S1. They show that the cross-sectional area of myofibers and the number of satellite cells does not differ between control and Pax7iresCre uninjured muscle, suggesting that loss of Met in Pax7+ cells does not have a major developmental defect. In addition they show (Figure 1K and S1B-E) that in response to injury the number of Pax7+ cells is reduced 7dpi with deletion in Pax7iresCre as well as Pax7iresCreERT2GAKA and Pax7CreERT2FAN mice. Thus they argue that the results with the Pax7iresCre are similar to the results with the tamoxifen-inducible Pax7CreERT2 mice and reflect the role of Met during regeneration and not during development. However, the results in Figure 1K and Figure S1E are not able to be compared because they use different metrics (Pax7+ cells/100 myofibers vs Pax7+ cells/area) We have now used everywhere in the manuscript the identical metrics (Pax7+ cells/mm2) and the identity of controls are unclear. Thus whether the results with the Pax7iresCre really reflect the requirement of Met and/or Cxcr4 strictly during regeneration is uncertain. The authors need to repeat key experiments using the Pax7CreERT2FAN or Pax7CreERT2GAKA mice. As requested by the reviewers, we now included consistently a Cre control in the Figures comparing Met phenotypes observed with different Cre lines (Figures 2, 3). Moreover, we repeated all experiments of the paper using an inducible CreERT2 allele, i.e. Pax7iresCreERT2GAKA. Except in Figures 2 and 3 were we compare phenotypes observed with the three Cre alleles, we now entirely rely on Pax7iresCreERT2GAKA for our analysis (Figures 5-7). To make the manuscript more accessible to readers, we continue to abbreviate the genotypes in Results and Figures. The abbreviations are introduced in Results and Methods, and the exact genotypes are also described in the legend to each Figure. In particular, the following abbreviations are used: TxGakaMet mutant: Pax7iresCreERT2Gaka/+;Metflox/flox treated with tamoxifen TxFanMet mutant: Pax7CreERT2Fan/+;Metflox/flox treated with tamoxifen coMet mutant: Pax7iresCre/+;Metflox/flox Controls for TxGakaMet: Pax7iresCreERT2Gaka/+;Met+/+ treated with tamoxifen Controls for TxFanMet: Pax7CreERT2Fan/+;Met+/+ treated with tamoxifen Controls for coMet: Pax7iresCre/+;Met+/+ Importantly, in our hands Met phenotypes obtained by the use of Pax7iresCreERT2GAKA and the constitutive Pax7iresCre alleles consistently show identical phenotypes. This contrasts the results obtained with Pax7CreERT2Fan. The fact that phenotypes observed with Pax7iresCreERT2Gaka and Pax7iresCre are identical indicate to us that these data are reliable. In Pax7CreERT2Fan allele, the Pax7 coding sequence is disrupted, resulting in lowered Pax7 levels. In contrast, in the Pax7iresCreERT2Gaka and Pax7iresCre alleles, Pax7 remains intact and the CreERT2/Cre sequences, respectively, are fused via an ires sequence which does not affect Pax7 expression. We are not the first to observe that the Pax7CreERT2FAN allele is problematic (reviewer # 3 writes …..”that is notoriously impacting muscle regeneration”; see also von Maltzahn et al., 2013; Mademtzoglou et al. 2018; Noguchi et al., 2019). Although we do not consider this to be a major finding of our work, we wanted to document the impact of the Pax7CreERT2Fan allele on the Met phenotype because we believe that our observations might be of useful for others. 2. There is concern about whether the appropriate control mice have been used in the genetic experiments. Throughout all figure panels, the full genotype of all control and experimental mice should be displayed. Particularly in experiments using Pax7CreERT2FAN, the control mice should be Pax7CreERT2Fan/+; Met+/+ and with tamoxifen. The issue of the control mice used was particularly of concern in Figure S1E. As the reviewer requested, we include now for all data additional genotypes as controls. Controls for TxGakaMet: Pax7iresCreERT2Gaka/+;Met+/+ treated with tamoxifen Controls for TxFanMet: Pax7CreERT2Fan/+;Met+/+ treated with tamoxifen Controls for coMet: Pax7iresCre/+;Met+/+ Importantly, we realized during the revision that many fibers in tamoxifen treated TxFanMet mice observed after regeneration are ‘ghost fibers’, i.e. represent remnants of laminin matrices devoid of a myosin-positive cell. We therefore use consistently in the revised manuscript pan-myosin and laminin antibodies to quantify fiber diameters, counting only those laminin circles that contain a myosin-positive cell. In the original submission, we had used only laminin antibodies, and thus had not eliminated ghost fibers. The new approach used for quantifications further augmented differences in fiber diameters between TxGakaMet and coMet mutations on one side, and the TxFanMet mutation on the other side. 3. The authors conclude that HGF/Met and CXCL12/Cxcr4 signaling is autocrine in satellite cells. However, they do not provide enough data to support such a conclusion. They show in Figures 1D and 2A by smFISH that HGF and CXCl12 is co-expressed with Pax7 in satellite cells, although there was some concern about the quality of this data. The expression of HGF and CXCL12 in satellite cells could be strengthen by examining their expression via qPCR in isolated satellite cells rather than in whole muscle homogenates. Indeed, we were unable to verify the RNAscope data that indicated that Hgf is expressed by activated muscle stem cells using qPCR, and we thank the reviewers for pointing out that these data might be problematic. Neither our qPCR data nor published microarray datasets support the notion that Hgf is expressed at appreciable amounts in activated MuSC. However, our qPCR data and published microarray datasets support the notion that Cxcl12 is expressed by activated muscle stem cells. The qPCR data are now inserted in Figures 1 and 4 of the revised manuscript, and the RNAscope data were deleted. Even with such data, the authors can only suggest, but not conclude, that HGF and CXCL12 function in an autocrine manner. HGF and CXCL12 from other cell types may be critical. A definitive test would require that HGF or CXCL12 are conditionally deleted in satellite cells via Pax7CreERT2. We agree with the reviewer. This was changed in the abstract and other parts of the revised manuscript. 4. The authors propose that Met and Cxcr4 act cooperatively to prevent TNFa-mediated apoptosis. While the authors show the number of apoptotic Pax7+ cells is increased in Pax7iresCre/+; Metfl/fl; Cxcr4fl/fl (Figure 3C), they do not quantify the number of apoptotic Pax7+ cells in Pax7iresCre/+; Metfl/fl or Pax7iresCre/+; Cxcr4fl/fl. Also the control genotype for these experiments is not detailed. The data for all four genotypes needs to be included in order for a role of Met and Cxcr4 cooperativity to be assessed. We now quantified the number of apoptotic Pax7+ cells in mice of the following genotypes (Figure 6 of the revised manuscript): Control: Pax7iresCreERT2Gaka TxGakaCxcr4: Pax7iresCreERT2Gaka/+;Cxcr4flox/flox TxGakaMet: Pax7iresCreERT2Gaka/+;Metflox/flox TxGakaCxcr4;Met: Pax7iresCreERT2Gaka/+;Cxcr4flox/flox;Metflox/flox (all tamoxifen treated). The data show that the TxGakaMet mutation impairs survival of stem cells mice, whereas the TxGakaCxcr4 mutation does not. Moreover, the double mutation TxGakaCxcr4;Met further augments the apoptosis phenotype observed in TxGakaMet. Thus, the new data provided in the revised manuscript (Figure 6) support and extend the previous data. 5. Figure 4A-C shows an increase in propidium iodide+ satellite cells cultured in the presence of TNFa, which is rescued when either HGF, CXCL12, or HGF and CXCL12 are added. Propidium iodide is an assay for nonviable cells. The authors should conduct this experiment with TUNEL assay (as in Figure 3A-C). As requested, we replaced the propidium iodide straining and use TUNEL assays in the revised manuscript (Figure 7 A-D); please note that the proportion of dead/apoptotic cells are similar, regardless whether we use propidium iodide or TUNEL. In addition, these data suggest that either HGF or CXCL12 are sufficient to rescue cell death and there is no additive benefit to using both HGF and CXCL12. This does not support the contention that HGF and CXCL12 are both required to protect satellite cells from TNFα -induced apoptosis. We show in Figure 7 A-D a rescue of TNF-α-induced apoptosis in a cell culture setting using freshly isolated muscle stem cells kept in low serum on Matrigel; Matrigel is known to contain many growth factors. Thus, the cells are kept under conditions where they are exposed to undefined signals which might not be identical to those present in vivo. Under such conditions, both HGF and Cxcl12 rescue from apoptosis, but there is no additive effect. In contrast to this cell culture experiment, we observe in the in vivo setting a clear additive effect- i.e. stronger apoptosis phenotypes in the conditional TxGakaCxcr4;Met double mutant animals than in single TxGakaMet and TxGakaCxcr4 mutants. Moreover, we show that TNFalpha neutralizing antibodies rescue apoptosis in TxGakaMet and TxGakaCxc4;Met animals. We therefore conclude that in vivo, Met/Cxcr4 act cooperatively. We point out explicitly in the revised manuscript that cooperativity is observed in vivo but not in vitro (page 9, end of 1st and 2nd paragraphs). 6. The in vivo role of Met and Cxcr4 in protection against TNFa -induced apoptosis needs to be strengthened. The authors need to show in vivo whether loss of Met alone leads to an increase in satellite cell apoptosis at 3 dpi. Also, the rescue experiments using neutralizing TNFa antibody (Figure 4D-F) only assay the number of Pax7+ cells/area and not changes in numbers of apoptotic Pax7+ cells; this should be included. In the revised manuscript, we now provide data using neutralizing antibodies for TxGAKAMet, TxGakaCxcr4;Met and control (Pax7iresCreERT2Gaka treated with tamoxifen) animals. This demonstrates that the neutralizing antibodies rescue apoptosis in both, TxGakaMet and TxGakaCxcr4;Met animals. Moreover, we show that the rescue is accompanied by a reduction in the number of apoptotic cells in the muscle of such animals. The new data are shown in Figure 7 of the revised manuscript and extend and support our previous findings. Reviewer #1: Lahmann and colleagues examine in "Met and Cxcr4 signals cooperate to protect muscle stem cells against inflammation-induced damage during regeneration" the cell-autonomous role of Met and Cxcr4 signaling in satellite cells during regeneration. The role of Met signaling, in particular, in muscle regeneration has been examined by multiple papers over many years, and roles in activation, proliferation, migration, fusion, and quiescence have all been implicated. The novel finding of this paper is the implication that Met and Cxcr4 protects satellite cells from apoptosis early in the regenerative response (3 days post injury) due to TNFa expression. They also suggest that Met and Cxcr4 act cooperatively and in an autocrine manner to protect satellite cells. The finding of a role for Met and Cxcr4 for cooperatively blocking apoptosis during regeneration is interesting, but in need of further data to support. There is little data in this to support that HGF/Met and CXCL12/Cxc4 functions in an autocrine manner. See specific comments. We thank the reviewer for finding the new role of Met/Cxcr4 in the protection of muscle stem cells against TNF-α induced damage interesting. We included additional data and controls to support these findings. Moreover, the reviewer is right to point out that the data do not show that Met/Cxcr4 act in an autocrine manner. We had provided data that the ligands/receptors are produced by the same cells, which we were however unable to verify for Hgf by qPCR (Figure 1 of the revised manuscript). We have changed the wording in the abstract/manuscript accordingly. 1. The authors show by qPCR that satellite cells express Met and by smFish that some satellite cells express HGF and conclude "HGF I (probably a typo – "is") produced by muscle stem cells and functions in an autocrine manner during repair" p.5. Based on their expression data and conditional deletion in satellite cells, they can not conclude this. They show that Met is required in satellite cells, but the source of HGF may be from satellite cells or many other cell types present in regenerating muscle that they have not tested. Indeed, we were unable to verify the RNAscope data that indicated that Hgf is expressed by activated muscle stem cells using qPCR, and we thank the reviewers for pointing out that these data might be problematic. Neither our qPCR data nor published microarray datasets support the notion that Hgf is expressed at appreciable amounts in activated MuSC. As the reviewer requested, we show the qPCR data (Figures1 and 4 of the revised manuscript). Moreover, the RNAscope data were deleted. 2. Figure 1E-L: 1. In these experiments they have deleted Met using the Pax7iresCre, and so Met has been deleted in muscle progenitors throughout development. They need to explicitly state this in the last paragraph of p. 5. I find it surprising that there is no developmental phenotype (neither number of Pax7+ muscle progenitors or myofiber cross-sectional area is affected). Please make sure to highlight this in text. In the revised manuscript, we mention on page pg. 5 (last paragraph) that the Pax7iresCreinduced Met mutation (coMet) deletes in muscle progenitors throughout development. Met has a very important migratory function in developing myogenic progenitor cells, that we and others (including the lab of the reviewer) have observed. Pax7 is however not expressed in muscle progenitor cells before or during migration, and is only induced after the progenitors reach their targets (Relaix et al., 2004). Therefore, the Pax7iresCre-induced mutations neither affect the migratory behavior nor the muscle that derive from migrating cells. Others suggested that Met regulates in addition to migration the size of the precursor pool for secondary myogenesis in the trunk (Maina et al., 1996). For this study, a hypomorph allele that mutates the Grb2 binding site of Met was used. Several possibilities might explain that we do not observe this in our experiments: (1) Allele differences or possibly differences in the genetic background might account for this. We use an allele in which the exon that encodes the ATP-binding site of Met is deleted and that abolishes Met functions. (2) The hypomorph allele that Maina et al. used also affects placental development (page 535 of (Maina et al., 1996): ‘The corresponding placentae appeared slightly smaller compared with controls but were well vascularized (data not shown)’). A small placenta might impair the supply of nutrients/oxygen to the embryos thus indirectly the development of other tissues, including muscle. Our data presented here are in accordance with earlier findings of our lab. In chimeric mice (chimera of Met+/+ and Met-/- cells), Met-/- cells do not contribute to muscle generated by migrating progenitors (diaphragm, limb muscle) but contribute normally to other muscle groups in the trunk and head (Bladt et al., 1995). Moreover, aggregation chimera of tetraploid (wild type) and diploid (Met−/−) morulae were performed in our lab; tetraploid wildtype cells only contribute to extraembryonic structures including the placenta, whereas the embryo proper is exclusively generated by diploid Met-/- cells. Such chimera lack muscle groups that derive from migratory precursor cells, but display otherwise normal skeletal muscles in the trunk at E17.5 (Dietrich et al., 1999). Also, please put the actual genotype of control and experimental mice on the Figure panels – do not use the abbreviation "control" and "coMet"; we need to see the actual genotypes of these mice. I find the exact genotypes in the text and figures difficult. i.e. exact genotypes are long and difficult to understand for non-geneticists. After lengthy discussions, we decided to continue to use abbreviations; the abbreviations are explained in the main text, in Methods, and in the legend of every figure. Thus, the reader can verify genotypes easily, but the flow of the text is not interrupted, and we can label in figures individual panels using a font size that is not too small. In summary, the following abbreviations are used: TxGakaMet: Pax7iresCreERT2Gaka/+;Metflox/flox treated with tamoxifen TxFanMet: Pax7CreERT2Fan/+;Metflox/flox treated with tamoxifen coMet: Pax7iresCre/+;Metflox/flox Controls for TxGakaMet: Pax7iresCreERT2Gaka/+;Met+/+ treated with tamoxifen Controls for TxFanMet: Pax7CreERT2Fan/+;Met+/+ treated with tamoxifen Controls for coMet: Pax7iresCre/+;Met+/+. The authors state that "similar deficits were observed when Met was mutated in adult muscle stem cells using the tamoxifen-inducible Pax7iresCreERT2GAKA allele". Only the reduction in Pax7+ satellite cells at 7 dpi is shown and not the changes in myofiber cross-sectional area; this should be shown. In the revised manuscripts, we show number of Pax7+ cells before injury and 7 day after injury, and fiber diameters 7 and 20 dpi for Met mutations induced by the three different Cre alleles (Figures 2 and 3; supplemental data Figure 2 —figure supplement 1). Genotypes used are: TxGakaMet: Pax7iresCreERT2Gaka/+;Metflox/flox treated with tamoxifen TxFanMet: Pax7CreERT2Fan/+;Metflox/flox treated with tamoxifen coMet: Pax7iresCre/+; Metflox/flox Controls for TxGakaMet: Pax7iresCreERT2Gaka/+;Met+/+ treated with tamoxifen Controls for TxFanMet: Pax7CreERT2Fan/+;Met+/+ treated with tamoxifen Controls for coMet: Pax7iresCre/+; Met+/+. Importantly, in our hands the data obtained using Pax7iresCreERT2Gaka and Pax7iresCre are always very similar; in Figure 2 and 3 we directly compare the mutations using the three Cre alleles, but otherwise we show in the revised manuscript only data using Pax7iresCreERT2Gaka. The constitutive Pax7iresCre-induced mutations were shown in the original manuscript, but are no longer included in Figures5-8 of the revised manuscript to avoid redundancies. The fact that phenotypes observed with Pax7iresCreERT2Gaka and Pax7iresCre are consistently similar indicate to us that these data are reliable. 3. The authors write on p. 6 that "loss of Met in muscle stem cells results in a mild regeneration deficit that is accompanied by a reduction in the number of muscle stem cells". However, the authors never analyze any muscle regeneration phenotypes after 7 dpi. Certainly the work of Webster and Fan 2013 shows a severe regeneration phenotype in the myofibers at later time points (20 dpi). The authors need to look at later time points post injury or explicitly acknowledge the work of Webster and Fan, which clearly shows a regeneration defect. Webster and Fan show very severe regeneration phenotype at 10 and 20 days after injury in Figure 1 or their paper. As the reviewer requested, we include in the revised manuscript one further time point, 20 dpi, at which we compare the different alleles, in addition to 7dpi time point. At both time points, we observe very severe phenotypes using the Pax7CreERT2Fan allele, and milder phenotypes when the mutation was introduced by Pax7iresCreERT2Gaka or the constitutive Pax7iresCre alleles (Figures 2, 3 and Figure 3 —figure supplement 1, revised manuscript). These data show that we reproduce the results of Webster and Fan when we use the Pax7CreERT2Fan allele to mutate Met, but not when we use Pax7iresCreERT2Gaka or the constitutive Pax7Cre alleles. Together, our experiments show that the severe phenotype of the Pax7CreERT2Fan; Metflox/flox mice is not only due to the loss of Met in muscle stem cells, but arises also because of the use of the Pax7CreERT2Fan allele. As the reviewer requested, we acknowledge the work by Webster and Fan on page 6 of the revised manuscript and cite their paper, but also point out that with other Cre lines we cannot detect such a severe phenotype. 4. Figure 2: 1. The case of cooperativity between Met and Cxcr4 would be made easier to see if they included the data on Pax7iresCre;Cxcr4fl/fl mice in the main figure and not in Figure S2. 2. It is unclear if there is increased fibrosis if both Met and Cxcr4 are deleted, versus individual loss of Met and Cxcr4. If they want to make this point they need to include all 4 genotypes (Control that is specified; Pax7iCre; Cxcr4fl/fl; Pax7iCre;Metfl/fl; and Pax7iCre;Cxcr4fl/fl;Metfl/fl) and quantify the degree of fibrosis. As the reviewer requested, we now show data on the cooperativity in one figure of the revised manuscript to ease comparison of the genotypes (Figure 5-7 and the corresponding figure supplements). Genotypes displayed are: Control: Pax7iresCreERT2Gaka TxGakaCxcr4: Pax7iresCreERT2Gaka/+;Cxcr4flox/flox TxGakaMet: Pax7iresCreERT2Gaka/+;Metflox/flox TxGakaCxcr4;Met: Pax7iresCreERT2Gaka/+;Cxcr4flox/flox;Metflox/flox All genotypes were tamoxifen treated. Shown are the effects of the mutation on Pax7+ cell numbers, fiber diameter, fibrosis. The new data extend and support our previous conclusion. 5. Figure 3: Panels A-C. The authors show an increase in the number of Tunel+Pax7+ cells at 3dpi in Pax7iCre; Cxcr4fl/fl;Metfl/fl mice. The authors need to show the quantification of Tunel+Pax7+ cells at 3 dpi for Pax7iCre; Cxcr4fl/fl and Pax7iCre;Metfl/fl mice. Also please write the genotype of the "control" mice. As requested by the reviewer, we now quantified the number of apoptotic Pax7+ cells inmice with the following genotypes: Control: Pax7iresCreERT2Gaka/+ TxGakaCxcr4: Pax7iresCreERT2Gaka/+;Cxcr4flox/flox TxGakaMet: Pax7iresCreERT2Gaka/+;Metflox/flox TxGakaCxcr4;Met: Pax7iresCreERT2Gaka/+;Cxcr4flox/flox;Metflox/flox All Genotypes were tamoxifen treated. The new data extend and support our previous conclusion and are shown in Figure 6 of the revised manuscript. Panels D-H. The authors need to show the number of Pax7+ and BrdU+Pax7+ cells for all four genotypes: 1. control, which needs to be specified; 2. Pax7iCre; Cxcr4fl/fl; 3. Pax7iCre;Metfl/fl; and 4. Pax7iCre;Cxcr4fl/fl;Metfl/fl. Without all four genotypes, it is not possible to infer whether the effects of Met and Cxcr4 really are cooperative. As requested by the reviewer, we now quantified the number of Pax7+ and EdU+Pax7+ cells in mice with different genotypes: Control: Pax7iresCreERT2Gaka/+ TxGakaCxcr4: Pax7iresCreERT2Gaka/+Cxcr4flox/flox TxGakaMet: Pax7iresCreERT2Gaka/+;Metflox/flox TxGakaACxcr4;Met: Pax7iresCreERT2Gaka/+;Cxcr4flox/flox;Metflox/flox All genotypes were tamoxifen treated. The new data extend and support our previous conclusion and are displayed in Figure 6 – figure supplement 1. 6. Figure 4: The authors show in Panel C that either Cxcl12 or HGF alone is sufficient to rescue TNFa induced satellite cell death in culture and the effects of Cxcl12 and HGF do not lead to a further rescue. Thus it is most parsimonious to argue that Cxcl12 and HGF do not have a synergistic (cooperative) or additive effect on rescue of cell death – either factor will work. We show in Figure 7 A-D a rescue of TNF-α-induced apoptosis in a cell culture settingusing freshly isolated muscle stem cells kept in low serum on Matrigel; Matrigel is known to contain many growth factors. Thus, the cells are kept under conditions where they are exposed to undefined signals which might not be identical to those present in vivo. Under such conditions, both HGF and Cxcl12 rescue from apoptosis, but there is no additive effect. In contrast to this cell culture experiment, we observe in the in vivo setting a clear additive effect- i.e. stronger apoptosis phenotypes in the conditional TxGakaCxcr4;Met double mutant animals than in single TxGakaMet and TxGakaCxcr4 mutants. Moreover, we show that TNFalpha neutralizing antibodies rescue apoptosis in TxGakaMet and TxGakaCxc4;Met animals. We therefore conclude that in vivo, Met/Cxcr4 act cooperatively. We point out explicitly in the revised manuscript that cooperativity is observed in vivo but not in vitro (page 9, end of 1st and 2nd paragraphs). Panel D. The authors show that blocking TNFa partially rescues the number of Pax7+ cells when Cxcr4 and Met are deleted in Pax7+ cells. It is important for the authors to show the effects of TNFa blockade on Pax7iCre; Cxcr4fl/fl and Pax7iCre;Metfl/fl, if there is increased apoptosis in these genotypes (see comments above). As the reviewer requested, we show data on the effects of the TNF-α blocking antibodies on mice of the following genotypes: Pax7iresCreERT2Gaka/+ Pax7iresERT2CreGaka/+;Metflox/flox and Pax7iresERT2CreGaka/+;Cxcr4flox/flox;Metflox/flox (all tamoxifen treated) (Figure 7). We have not used it on the Pax7iresCreERT2Gaka/+;Cxcr4flox/flox genotypes, because we did not observe increased apoptosis in this genotype. The new data extend and support our previous conclusion. 7. The authors claim that the "major role" of Met and Cxcr4 is to "work together in order to protect stem cells against the adverse environment created by the acute inflammatory response." This is clearly not the only role Met. There are many papers showing multiple other roles for Met in regeneration (e.g. Webster and Fan 2013 amongst many others). They need to modify this statement and acknowledge the vast literature on this subject. Indeed, there are many papers on the role of Met and Hgf in muscle regeneration- InPubMed I find 2,051 on skeletal muscle AND Met, 264 skeletal muscle AND Hgf, 101 papers on Met AND skeletal muscle AND regeneration, and 102 papers on Hgf AND skeletal muscle AND regeneration (the search was done on May 16th, 2021). We had a short look at all of the ones that deal with regeneration during the revision. A multitude of these reports describe effects of HGF on cultured myogenic cells from various species (primary muscle cells, myoblasts, myoblast cell lines): Exogenous HGF elicits responses that extend from increased migration, changes in cell morphology, proliferation, cell survival, suppression of differentiation – typical responses to growth factors. It is often difficult to extrapolate from such in vitro work to the roles of a growth factor in vivo. We have cited some of the earliest papers of this literature that describes in vitro effects of HGF on myogenic cells, but I feel strongly that we cannot cite all of the published papers. Very few of these papers use genetic models to assess muscle regeneration after mutation of Met in muscle stem cells: (1) the Webster/Fan paper (Webster and Fan 2013) on a regenerative phenotype of Met; we cite this paper but provide data that the phenotype of Webster/Fan is not only caused by the Met mutation but also by the use of the Pax7CreERT2Fan allele, and that the severe phenotype cannot be observed when Met is mutated using other Cre alleles. (2) Two papers by the Rando lab on the entry of muscle stem cells into Galert and a role of Met in this process. These papers do not investigate to what extend the Met mutation in stem cells affects regeneration of the muscle. We now cite one of these papers (Rodgers et al., 2014). To further discuss the Met literature on muscle, an extra paragraph was inserted into the revised manuscript (page 10, 2nd paragraph of the discussion). From our analysis we can conclude that a major function of Met in muscle regeneration is to keep the muscle stem cell numbers ‘normal’ by protecting them from apoptosis, which is extensively documented in our paper. The reduction of the stem cell numbers in the Met mutant (using Pax7iresCreERT2Gaka or the Pax7iresCre) is not caused by an inability to enter the proliferative phase or by a proliferate deficit. We performed an analysis of the proliferation rate (EdU incorporation) of TxGakaCxcr4, TxGakaMet, TxGakaACxcr4;Met animals, including the appropriate control. Proliferation rates are slightly increased in TxGakaMet and TxGakaACxcr4;Met mice, possibly due to compensatory proliferation (Figure 6 – figure supplement 1 of the revised manuscript). We have therefore rephrased the sentence and say more specifically: Unexpectedly, our analysis of the in vivo function of Met and Cxcr4 demonstrates an important cooperative role in muscle repair that protects stem cells against the adverse environment created by the acute inflammatory response (pg. 9 of the revised manuscript). I hope that this satisfies the reviewer. In regards to additional literature on Met in muscle regeneration we want to point out the following: Many papers describe sources of HGF during muscle regeneration as well as effects on cell types other than muscle stem cells. As possible sources of circulating factor, different cell types are discussed, as well a release from extracellular matrix. Extracellular matrix as a source of HGF in tissue injury was to my knowledge first proposed in liver regeneration experiments where a very fast increase of HGF is observed that too fast to be due to the synthesis of new transcripts/protein and secretion from cells. This was subsequently again discussed in for many other organs. We cited the first liver papers that introduced the concept in our original manuscript and an early work on HGF in the matrix of the muscle that was pointed out to use by one of the reviewers (Shimomura et al., 1995; Tatsumi et al., 1998, Page 10 of the revised manuscript). In addition, there are many papers describing (mostly beneficial) roles of exogenous HGF during muscle regeneration in animal models. In these studies, HGF is providedexogenously, either alone or in combinations with other factors (e.g. as serum from patients with liver injuries). Apparently, when purified HGF is used, effects differ depending on the time the factor is given: muscle stem cell numbers were increased, but fiber growth was not enhanced (Miller et al., 2000). We cite this study in the revised version of the manuscript (discussion, page 12). Further studies have investigated HGF in non-myogenic cell types during muscle regeneration, for instance immune cells, endothelia, neurons, mesenchymal stem cells, bone marrow stem cells. We do not cite these reports because we did not investigate roles of HGF/Met in such cell types. 8. The authors claim that HGF/Met and Cxcl12/Cxcr4 signaling is autocrine (p. 11). However, they have not explicitly tested this by deleting HGF or Cxcl12 in satellite cells. They need to remove this claim in the Discussion and Abstract. Indeed, we were unable to verify the RNAscope data that indicated that Hgf is expressed by activated muscle stem cells using qPCR, and we thank the reviewers for pointing out that these data might be problematic. Neither our qPCR data nor published microarray datasets support the notion that Hgf is expressed at appreciable amounts in activated MuSC. However, our qPCR data and published microarray datasets indicate that Cxcl12 is expressed in muscle stem cells. The qPCR data are now inserted in Figures1 and 4 of the revised manuscript, and the RNAscope data were deleted (Figures 1 and 4 of the revised manuscript). Reviewer #2: Lahmann et al., focused on cytokines which is dramatically increased in early pahse of muscle regeneration. Among them, they investigated the roles of HGF and Cxcl12 using conditional KO mice. Intriguingly, the loss of them did not affect the proliferation ability of satellite cells, but functioned to protect satellite cells from cell death induced by TNF-a. in vivo assay system, authors showed the data indicating the influence of loss of HGF and Cxcl12 were rescued by TNF-a neutralizing antibodies. Most of conclusion is supported by the present data. Please respond the following comments. 1. Gene expression pattern of Cxcl12 is similar with that of TNF-a. While, the peak of HGF expression is at 3 dpi, meaning that the peak of HGF/c-Met signaling is not matched with that of TNF-a. Pro-HGF, biologically inactive HGF form, binds to the ECM. The following paper shows that HGF is stored in normal adult skeletal muscle. Is there a possibility that the stored HGF function to suppress the cell death in the early phase of regeneration? While considering this result, please discuss the different expression pattern of HGF and TNF-a. HGF/SF is present in normal adult skeletal muscle and is capable of activating satellite cells. Tatsumi R, Anderson JE, Nevoret CJ, Halevy O, Allen RE. Dev Biol. 1998 Feb 1;194(1):114-28. We thank the reviewer for pointing out this study which we cite in the revised paper. We discuss that matrix-bound factor released by proteases might be active during regeneration. 2. In this study, the impact of Met-null on cell death of satellite cells is critical. Authors showed the remarkable increased number of TUNEL+ cells in coCxcr4/Met satellite cell. While, there is no data showing the relevance between Met-null adn apoptosis in vivo. In order to conclude the protective function of Met, reviewer would like to ask authors to present the data. As the reviewer suggested, we included data on apoptosis in the single mutants, TxGakaMet and TxGakaCXCR4, the double mutant TxGakaMet;CXCR4 and as controls the Pax7CreERT2Gaka in Figure 6 of the revised manuscript. The additional data confirm and extend our previous conclusion. 3. In Figure 4, necrotic cells were also positive for Propidium Iodide. Reviewer recommends to detect apoptotic cells using TUNEL assay. As suggested by the reviewer, we use TUNEL staining to detect apoptotic cells in vitro in the revised manuscript (Figure 7). Please note that the two assay methods give identical relative values. Reviewer #3: The study presented by Lahmann et al., proposes a specific role of Met and Cxcr4 during muscle regeneration that is distinct from the already reported involvement during muscle cells migration. Instead, the authors use genetic mouse models to show that Met and Cxcr4 cooperate in a cell-autonomous manner to protect muscle stem cells against TNFα-induced damage during repair. The manuscript is well written and the experimental approach is overall of high-standards, involving a large number of genetic models. However, a series of control experiments are needed to solidify the results. We thank the reviewer for the overall positive assessment of our paper, and for the praise on the clarity of the manuscript and the quality of the experimental approach. Concerns: I raise two main concerns: 1. For the majority of the experiments, a constitutive Pax7-Cre line is used. In the case of Met flox, tamoxifen-inducible Pax7-CreERT2 line is used but the appropriate controls are missing. We acknowledge that the controls used were not described in detail in the original manuscript. In part this was done to keep the manuscript clear- it would be very tedious to mention all controls that were done. In the revised manuscript, we use the following specific genotypes: For comparison of different cre alleles: TxGakaMet: Pax7iresCreERT2Gaka/+;Metflox/flox treated with tamoxifen TxFanMet: Pax7CreERT2Fan/+;Metflox/flox treated with tamoxifen coMet: Pax7iresCre/+;Metflox/flox Controls for TxGakaMet: Pax7CreERT2Gaka/+;Met+/+ treated with tamoxifen Controls for TxFanMet: Pax7CreERT2Fan/+;Met+/+ treated with tamoxifen Controls for coMet: Pax7iresCre/+; Met+/+. For the comparison of the effects of met, Cxcr4 and Cxcr4/Met double mutants: Control: Pax7iresCreERT2Gaka/+; TxGakaCxcr4: Pax7iresCreERT2Gaka/+;Cxcr4flox/flox TxGakaMet: Pax7iresCreERT2Gaka/+;Metflox/flox TxGakaCxcr4;Met: Pax7iresCreERT2Gaka/+;Cxcr4flox/flox;Metflox/flox Abbreviations used for genotypes are introduced in Results and Methods, and the exact information is also provided in the legend of the figures of the revised manuscript. 2. The RNA ISH shown in Figure 1D and 2A need more scrutiny. The overlapping pattern between the different probes is alarming and further controls are needed. We were unable to verify the RNAscope data that indicated that Hgf is expressed by activated muscle stem cells using qPCR, and we thank the reviewers for pointing out that these data might be problematic. As requested, we preformed qPCR, and in addition reanalyzed previously published microarray data generated others. Neither our qPCR data nor published microarray datasets support the notion that Hgf is expressed at appreciable amounts in activated MuSC. We therefore removed our RNAscope data, and deleted the suggestion that Hgf and Cxcl12 signal in an autocrine manner. The qPCR data are now inserted in Figures1 and 4, and the ISH data were removed. Specifically: – Figure 1 – Figure 1A, B, C The transcript levels of several cytokines are measured in resting and regenerating muscle. It seems that for Figure 1A and B whole muscle extracts were used whereas 1C results (Met expression) are based on isolated muscle stem cells. It would be informative to look at the expression of the other transcripts in isolated MuSCs, and especially Hgf, as it is later suggested to be acting in an MuSC-autocrine fashion (see Figure 1D). As suggested by the reviewer, we performed a qPCR experiments (see answer to the previous point of the reviewer). -Figure 1D The authors conclude that "HGF is produced [exclusively] by muscle stem cells and functions in an autocrine manner during repair".This is based on the RNA ISH that shows Hgf expression exclusively and in all Pax7 cells. Some additional experiments are needed to support unequivocally this conclusion. Hybridization protocols can produce artefacts if there are aggregates or other impurities. The similarity between the Pax7 and the HGF pattern is somewhat worrisome. The authors could combine PAX7 IF with Hgf ISH to confirm their observations. In addition, the double ISH could be performed in resting muscle, where Hgf is supposed to be absent or lower. In any case, quantification of the Pax7+/Hgf+ cells is needed. See previous comment. – Figure 1 E-L The loss of Pax7, specifically during regeneration, is a very interesting phenotype. Some additional information on the proliferation, differentiation and apoptosis kinetics and status of the mutant cells would give important insights into the role of Met in this context. We have included in the revised manuscript data on proliferation, differentiation and apoptosis of TxGakaMet, TxGakaCxcr4 and TxGakaCxcr4;Met double mutant at 4 dpi; as a control for this, Pax7iresCreERT2Gaka/+; Cxcr4+/+;Met+/+ mice treated with tamoxifen were used. We agree with the reviewer that apoptosis kinetics would be interesting to analyze. However, in early stages of muscle regeneration, antibody stainings do not work well due to high background, presumably due to the fact that immune cells and antibodies are present at high concentrations in the tissue. Thus, a time course of surviving cells cannot be reliably done by combining Pax7 antibodies and TUNEL staining. A time course of the disappearance of PAX7+ cells could be reliably done only by FACS using a fluorescent marker in muscle stem cells (e.g. Tg:Pax7nGFP, RosafloxstopfloxdtTomato), which would require to cross in an additional allele into all of the strains used (TxGakaMet, TxGakaCxcr4 and TxGakaCxcr4;Met), a very time consumable breeding. We have therefore refrained from doing this. One general concern is that the analysis of mice with constitutive Cre (Pax7-Cre here) is always risky. It is true that the authors argue that this is not an issue as "Pax7 is first expressed in progenitors that have already reached their targets" and also show that the number of Pax7 cells and the fiber diameter are the same in the resting muscle between control and coMet (Figure 1E-L). This shows, indeed, that in the Pax7-Cre; Met flox/flox mice there is no major MuSC phenotype, yet it does not exclude that the mutant MuSCs, fibres and all other cell types, for all we know, are identical at the molecular level. In fact, as shown in Figure S1J, K the satellite cells in the resting muscle of Pax7-Cre; Met flox/flox mice have half Pax7 transcript and protein. The authors are well aware of this problem and used two different mouse lines with tamoxifen-inducible Pax7-CreERT2, that nicely recapitulated the loss of MuSCs phenotype (Figure S1B-E). From this figure (Figure S1B-E), however, it becomes evident that all the compound mice were compared to the same control. Instead, each mutant mouse should be compared to its corresponding control, and even more so for the Pax7-CT2-FAN knock-in/knock-out allele that is notoriously impacting muscle regeneration (here, the control should be tamoxifen-treated Pax7-CT2-FAN/+; Met +/+ mice). In summary, I propose that the authors provide the appropriate comparison using the corresponding controls, and if the results hold true, transfer the conditional Pax7-CreERT2 in the main figure and the constitutive in the supplemental. In order to address concerns with controls, and to overcome the concerns that arose due to the use of a constitutive Cre line, we have redone many of the experiments, and use now exclusively the following genotypes in the revised manuscript: For comparison of different cre alleles: TxGakaMet: Pax7iresCreERT2Gaka/+;Metflox/flox treated with tamoxifen TxFanMet: Pax7CreERT2Fan/+;Metflox/flox treated with tamoxifen coMet: Pax7iresCre/+; Metflox/flox Controls for TxGakaMet: Pax7CreERT2Gaka/+;Met+/+ treated with tamoxifen Controls for TxFanMet: Pax7CreERT2Fan/+;Met+/+ treated with tamoxifen Controls for coMet: Pax7iresCre/+; Met+/+. For the comparison of the effects of Met, Cxcr4 and Cxcr4/Met double mutants: Control: Pax7iresCreERT2Gaka/+ TxGakaMet: Pax7iresCreERT2Gaka/+;Metflox/flox TxGakaCxcr4: Pax7iresCreERT2Gaka/+;Cxcr4flox/flox TxGakaCxcr4;Met: Pax7iresCreERT2Gaka/+;Cxcr4flox/flox;Metflox/flox I hope this addresses the concerns of the reviewer. – Figure 2 Figure 2A: same comments as for Figure 1D. The overlap in the ISH is worrisome. We were unable to verify the RNAscope data that indicated that Hgf is expressed by activated muscle stem cells using qPCR, and we thank the reviewers for pointing out that these data might be problematic. Our qPCR data indicate however that Cxcl12 is expressed by muscle stem cells, which is in accordance to previously published microarray data. The qPCR data are now inserted in Figures1 and 4 of the revised manuscript, and the RNAscope data were deleted. Nevertheless, a very interesting Cxcr4/Met synergistic muscle regeneration phenotype is described. It is unfortunate that all this series of experiments is performed with a constitutive Pax7-Cre line. As pointed out above, we have reinvestigated the Met, Cxcr4 and Cxcr4/Met double mutants using the Pax7iresCreERT2Gaka allele (Figures2-7). I hope this addresses the concerns of the reviewer. References Bladt F, Riethmacher D, Isenmann S, Aguzzi A, Birchmeier C. 1995. Essential role for the cmet receptor in the migration of myogenic precursor cells into the limb bud. Nature 376: 768-771. Dietrich S, Abou-Rebyeh F, Brohmann H, Bladt F, Sonnenberg-Riethmacher E, Yamaai T, Lumsden A, Brand-Saberi B, Birchmeier C. 1999. The role of SF/HGF and c-Met in the development of skeletal muscle. Development 126: 1621-1629. Heinrich PC, Behrmann I, Muller-Newen G, Schaper F, Graeve L. 1998. Interleukin-6-type cytokine signalling through the gp130/Jak/STAT pathway. Biochem J 334 ( Pt 2):297-314. Mademtzoglou D, Asakura Y, Borok MJ, Alonso-Martin S, Mourikis P, Kodaka Y, Mohan A, Asakura A, Relaix F. 2018. Cellular localization of the cell cycle inhibitor Cdkn1c controls growth arrest of adult skeletal muscle stem cells. eLife 7. Maina F, Casagranda F, Audero E, Simeone A, Comoglio PM, Klein R, Ponzetto C. 1996. Uncoupling of Grb2 from the Met receptor in vivo reveals complex roles in muscledevelopment. Cell 87: 531-542. Noguchi YT, Nakamura M, Hino N, Nogami J, Tsuji S, Sato T, Zhang L, Tsujikawa K, Tanaka T, Izawa K et al. 2019. Cell-autonomous and redundant roles of Hey1 and HeyL in muscle stem cells: HeyL requires Hes1 to bind diverse DNA sites.Development 146. O'Shea JJ, Plenge R. 2012. JAK and STAT signaling molecules in immunoregulation and immune-mediated disease. Immunity 36: 542-550. Relaix F, Rocancourt D, Mansouri A, Buckingham M. 2004. Divergent functions of murine Pax3 and Pax7 in limb muscle development. Genes Dev 18: 1088-1105. Rodgers JT, King KY, Brett JO, Cromie MJ, Charville GW, Maguire KK, Brunson C, Mastey N, Liu L, Tsai CR et al. 2014. mTORC1 controls the adaptive transition of quiescent stem cells from G0 to G(Alert). Nature 510: 393-396. von Maltzahn J, Jones AE, Parks RJ, Rudnicki MA. 2013. Pax7 is critical for the normal function of satellite cells in adult skeletal muscle. Proc Natl Acad Sci U S A 110:16474-16479. Webster MT, Fan CM. 2013. c-MET regulates myoblast motility and myocyte fusion during adult skeletal muscle regeneration. PLoS One 8: e81757. Yu H, Lee H, Herrmann A, Buettner R, Jove R. 2014. Revisiting STAT3 signalling in cancer: new and unexpected biological functions. Nat Rev Cancer 14: 736-746.
Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
AntibodyGuinea pig polyclonal anti-PAX7Our labPMID:229401131:2500
AntibodyRabbit polyclonal anti-LamininSigma-AldrichL9393RRID:AB_4771631:500
AntibodyGoat polyclonalanti-CollagenIVMilliporeAB769RRID:AB_922621:500
AntibodyMouse monoclonalanti-sarcomeric myosinDSHBMF20RRID:AB_21477811:10
AntibodyRabbit polyclonalanti-MyogeninAbcamab124800RRID:AB_109718491:1000
AntibodyMouse monoclonal anti-F4/80Abcamab6640RRID:AB_11400401:100
AntibodyRabbit polyclonal anti-fibronectinSigma-AldrichF7387RRID:AB_4769881:500
AntibodyCy2, Cy3, Cy5 conjugated antibodiesDianova1:500
Commercial assay or kitIn Situ Cell Death Detection KitRoche12156792910
Commercial assay or kitEdUbaseclick GmbHBCK-EdU647
Commercial Assay or kitqPCR SYBR Green MixThermoFisherAB1158B
Sequence-based reagent ATCCACGATGTTCATGAGAG EurofinsN/AqPCR HGF (forward primer)
Sequence-based reagent GCTGACTGCATTTCTCATTC EurofinsN/AqPCR HGF (reverse primer)
Sequence-based reagent CACAGAAAGCATGATCCGCGACGT EurofinsN/AqPCR TNF (forward primer)
Sequence-based reagent CGGCAGAGAGGAGGTTGACTTTCT EurofinsN/AqPCR TNF (reverse primer)
Sequence-based reagent CAGAGCCAACGTCAAGCA EurofinsN/AqPCR Cxcl12 (forward primer)
Sequence-based reagent AGGTACTCTTGGATCCAC EurofinsN/AqPCR Cxcl12 (reverse primer)
Sequence-based reagent CATTTTGGCTGTGTCTATCATG EurofinsN/AqPCR Met (forward primer)
Sequence-based reagent ACTCCTCAGGCAGATTCCC EurofinsN/AqPCR Met (reverse primer)
Sequence-based reagent TCAGTGGCTGACCTCCTCTT EurofinsN/AqPCR CXCR4 (forward primer)
Sequence-based reagent CTTGGCCTTTGACTGTTGGT EurofinsN/AqPCR CXCR4 (reverse primer)
Sequence-based reagent CATTTTGGCTGTGTCTATCATG EurofinsN/AqPCR Met Exon 17 (forward primer)
Sequence-based reagent ACTCCTCAGGCAGATTCCC EurofinsN/AqPCR Met Exon 18 (reverse primer)
Sequence-based reagent CTTGCCAGAGACATGTACGAT EurofinsN/AqPCR Met Exon 20 (forward primer)
Sequence-based reagent AGGAGCACACCAAAGGACCA EurofinsN/AqPCR Met Exon 21 (reverse primer)
Sequence-based reagent CCAGTTGGTAACAATGCCATGT EurofinsN/AqPCR β-actin (forward primer)
Sequence-based reagent GGCTGTATTCCCCTCCATCG EurofinsN/AqPCR β-actin (reverse primer)
Sequence-based reagent ACTAGGCTCCACTCTGTCCTTC EurofinsPMID:19554048Genotyping PCR-Primer 1 Pax7CreERT2Fan
Sequence-based reagent GCAGATGTAGGGACATTCCAGTG EurofinsPMID:19554048Genotyping PCR-Primer 2 Pax7CreERT2Fan
Sequence-based reagent GCTGCTGTTGATTACCTGGC EurofinsPMID:21828091Genotyping PCR-Primer 1 Pax7CreERT2GaKa
Sequence-based reagent CTGCACTGAGACAGGACCG EurofinsPMID:21828091Genotyping PCR-Primer 2 Pax7CreERT2GaKa
Sequence-based reagent GCTGCTGTTGATTACCTGGC EurofinsPMID:21828091Genotyping PCR-Primer 1 Pax7CreERT2GaKa
Sequence-based reagent GCTCTGGATACACCTGAGTCT EurofinsPMID:15520281Genotyping PCR-Primer 1 Pax7-IRESCre
Sequence-based reagent GGATAGTGAAACAGGGGCAA EurofinsPMID:15520281Genotyping PCR-Primer 2 Pax7-IRESCre
Sequence-based reagent TCGGCCTTCTTCTAGGTTCTGCTC EurofinsPMID:15520281Genotyping PCR-Primer 3 Pax7-IRESCre
Sequence-based reagent CCACCCAGGACAGTGTGACTCTAA EurofinsPMID:15520246Genotyping PCR-Primer 1 Cxcr4 flox
Sequence-based reagent GATGGGATTCTGTATGAGGATTAGC EurofinsPMID:15520246Genotyping PCR-Primer 2 Cxcr4 flox
Sequence-based reagent CCAAGTGTCTGACGGCTGTG EurofinsN/AGenotyping PCR-Primer 1 Met flox
Sequence-based reagent AGCCTAGTGGAATTCTCTGTAAG EurofinsN/AGenotyping PCR-Primer 2 Met flox
  75 in total

1.  Pax7 is required for the specification of myogenic satellite cells.

Authors:  P Seale; L A Sabourin; A Girgis-Gabardo; A Mansouri; P Gruss; M A Rudnicki
Journal:  Cell       Date:  2000-09-15       Impact factor: 41.582

Review 2.  Mitogen-activated protein kinases in apoptosis regulation.

Authors:  Teiji Wada; Josef M Penninger
Journal:  Oncogene       Date:  2004-04-12       Impact factor: 9.867

3.  Hepatocyte growth factor plays a dual role in regulating skeletal muscle satellite cell proliferation and differentiation.

Authors:  R Gal-Levi; Y Leshem; S Aoki; T Nakamura; O Halevy
Journal:  Biochim Biophys Acta       Date:  1998-03-12

Review 4.  Tumor necrosis factor receptor and Fas signaling mechanisms.

Authors:  D Wallach; E E Varfolomeev; N L Malinin; Y V Goltsev; A V Kovalenko; M P Boldin
Journal:  Annu Rev Immunol       Date:  1999       Impact factor: 28.527

5.  Single-cell analysis of regulatory gene expression in quiescent and activated mouse skeletal muscle satellite cells.

Authors:  D D Cornelison; B J Wold
Journal:  Dev Biol       Date:  1997-11-15       Impact factor: 3.582

6.  Hepatocyte growth factor activates quiescent skeletal muscle satellite cells in vitro.

Authors:  R E Allen; S M Sheehan; R G Taylor; T L Kendall; G M Rice
Journal:  J Cell Physiol       Date:  1995-11       Impact factor: 6.384

Review 7.  The Met tyrosine kinase receptor in development and cancer.

Authors:  Alessandra Gentile; Livio Trusolino; Paolo M Comoglio
Journal:  Cancer Metastasis Rev       Date:  2008-03       Impact factor: 9.264

8.  Activation of hepatocyte growth factor by two homologous proteases, blood-coagulation factor XIIa and hepatocyte growth factor activator.

Authors:  T Shimomura; K Miyazawa; Y Komiyama; H Hiraoka; D Naka; Y Morimoto; N Kitamura
Journal:  Eur J Biochem       Date:  1995-04-01

Review 9.  The discovery of hepatocyte growth factor (HGF) and its significance for cell biology, life sciences and clinical medicine.

Authors:  Toshikazu Nakamura; Shinya Mizuno
Journal:  Proc Jpn Acad Ser B Phys Biol Sci       Date:  2010       Impact factor: 3.493

10.  Cellular localization of the cell cycle inhibitor Cdkn1c controls growth arrest of adult skeletal muscle stem cells.

Authors:  Despoina Mademtzoglou; Yoko Asakura; Matthew J Borok; Sonia Alonso-Martin; Philippos Mourikis; Yusaku Kodaka; Amrudha Mohan; Atsushi Asakura; Frederic Relaix
Journal:  Elife       Date:  2018-10-04       Impact factor: 8.140

View more
  3 in total

1.  Uhrf1 governs the proliferation and differentiation of muscle satellite cells.

Authors:  Hiroshi Sakai; Yuichiro Sawada; Naohito Tokunaga; Kaori Tanaka; So Nakagawa; Iori Sakakibara; Yusuke Ono; So-Ichiro Fukada; Yasuyuki Ohkawa; Tadahiko Kikugawa; Takashi Saika; Yuuki Imai
Journal:  iScience       Date:  2022-02-14

2.  The chemokine receptor CXCR4 regulates satellite cell activation, early expansion, and self-renewal, in response to skeletal muscle injury.

Authors:  Ahmed S Shams; Robert W Arpke; Micah D Gearhart; Johannes Weiblen; Ben Mai; David Oyler; Darko Bosnakovski; Omayma M Mahmoud; Gamal M Hassan; Michael Kyba
Journal:  Front Cell Dev Biol       Date:  2022-09-22

3.  Proliferin-1 Ameliorates Cardiotoxin-Related Skeletal Muscle Repair in Mice.

Authors:  Hiroki Goto; Aiko Inoue; Limei Piao; Lina Hu; Zhe Huang; Xiangkun Meng; Yusuke Suzuki; Hiroyuki Umegaki; Masafumi Kuzuya; Xian Wu Cheng
Journal:  Stem Cells Int       Date:  2021-11-20       Impact factor: 5.443

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.