Guangquan Hu1,2, Xiaojie Ding3, Feng Gao2, Jiehua Li1. 1. Department of Geriatric Cardiology, The First Affiliated Hospital of Anhui Medical University, No. 218, Jixi Road, Hefei 230022, P.R. China. 2. Department of Internal Medicine-Cardiovascular, The Second Hospital of Anhui Medical University, No. 678, Furong Road, Economic Development Zone, Hefei 230601, P.R. China. 3. Department of Endocrinology, Anhui No.2 Provincial People's Hospital, No. 1868, North Second Ring Dangshan Road, Yaohai District, Hefei 230041, P.R. China.
Abstract
Myocardial infarction (MI) is a severe coronary artery disease resulted from substantial and sustained ischemia. Abnormal upregulation of calcium and integrin binding protein 1 (CIB1) has been found in several cardiovascular diseases. In this study, we established a mouse model of MI by permanent ligation of the left anterior descending coronary artery. CIB1 was upregulated in the heart of MI mice. Notably, CIB1 knockdown by intramuscular injection of lentivirus-mediated short hairpin RNA (shRNA) targeting Cib1 improved cardiac function and attenuated myocardial hypertrophy and infarct area in MI mice. MI-induced upregulation of α-SMA, vimentin, Collagen I, and Collagen III, which resulted in collagen production and myocardial fibrosis, were regressed by CIB1 silencing. In vitro, cardiac fibroblasts (CFs) isolated from mice were subjected to angiotensin II (Ang II) treatment. Inhibition of CIB1 downregulated the expression of α-SMA, vimentin, Collagen I, and Collagen III in Ang II-treated CFs. Moreover, CIB1 knockdown inhibited Ang II-induced phosphorylation of PI3K-p85 and Akt in CFs. The effect of CIB1 knockdown on Ang II-induced cellular injury was comparable to that of LY294002, a specific inhibitor of the PI3K/Akt pathway. We demonstrated that MI-induced cardiac hypertrophy, myocardial fibrosis, and cardiac dysfunction might be attributed to the upregulation of CIB1 in MI mice. Downregulation of CIB1 alleviated myocardial fibrosis and cardiac dysfunction by decreasing the expression of α-SMA, vimentin, Collagen I, and Collagen III via inhibiting the PI3K/Akt pathway. Therefore, CIB1 may be a potential target for MI treatment.
Myocardial infarction (MI) is a severe coronary artery disease resulted from substantial and sustained ischemia. Abnormal upregulation of calcium and integrin binding protein 1 (CIB1) has been found in several cardiovascular diseases. In this study, we established a mouse model of MI by permanent ligation of the left anterior descending coronary artery. CIB1 was upregulated in the heart of MI mice. Notably, CIB1 knockdown by intramuscular injection of lentivirus-mediated short hairpin RNA (shRNA) targeting Cib1 improved cardiac function and attenuated myocardial hypertrophy and infarct area in MI mice. MI-induced upregulation of α-SMA, vimentin, Collagen I, and Collagen III, which resulted in collagen production and myocardial fibrosis, were regressed by CIB1 silencing. In vitro, cardiac fibroblasts (CFs) isolated from mice were subjected to angiotensin II (Ang II) treatment. Inhibition of CIB1 downregulated the expression of α-SMA, vimentin, Collagen I, and Collagen III in Ang II-treated CFs. Moreover, CIB1 knockdown inhibited Ang II-induced phosphorylation of PI3K-p85 and Akt in CFs. The effect of CIB1 knockdown on Ang II-induced cellular injury was comparable to that of LY294002, a specific inhibitor of the PI3K/Akt pathway. We demonstrated that MI-induced cardiac hypertrophy, myocardial fibrosis, and cardiac dysfunction might be attributed to the upregulation of CIB1 in MI mice. Downregulation of CIB1 alleviated myocardial fibrosis and cardiac dysfunction by decreasing the expression of α-SMA, vimentin, Collagen I, and Collagen III via inhibiting the PI3K/Akt pathway. Therefore, CIB1 may be a potential target for MI treatment.
Entities:
Keywords:
PI3K/Akt pathway; calcium and integrin binding protein 1 (CIB1); collagen production; myocardial fibrosis; myocardial infarction
Myocardial infarction (MI), a leading cause of death among all cardiovascular diseases, is characterized by cardiomyocyte death resulting from substantial and sustained ischemia due to
imbalances between myocardial oxygen supply and demand [1, 2]. Acute myocardial infarction is the most severe
manifestation of coronary artery disease with high morbidity and mortality. It can consequently result in the development of chronic heart failure and has a significant impact on global
health, affecting more than 7 million people worldwide each year [3, 4]. Although early treatment with reperfusion
and pharmacotherapy has contributed to a conspicuous decline in mortality after acute MI, current therapies for heart failure after MI is limited and non-curative, and the efforts remain to be
urgently needed to minimize the mortality and economic cost in the disease treatment [5, 6].Calcium and integrin binding protein 1 (CIB1), which was first discovered as a binding partner of the αIIb integrin cytoplasmic domain in platelets, can bind to different proteins in diverse
cells, exhibiting a broad functional versatility in multiple cellular processes, such as adhesion, migration, and Ca2+ signaling to cell survival and proliferation. Increasing
evidence also indicates a novel role of CIB1 in cancer and cardiovascular disease [7, 8]. CIB1 mediates tumor growth
and angiogenesis by repressing tumor cell apoptosis and promoting tumor cell proliferation and migration [9,10,11]. CIB1 is widely expressed in multiple tissues or organs of humans and mice, particularly highly expressed in the heart [12, 13]. The level of urine CIB1 in patients with both acute and chronic ischemic heart failure is significantly
higher than that in healthy individuals [14]. Besides, it also is upregulated both in the right atrial myocardium of patients with atrial fibrillation
and in the peripheral blood mononuclear cells of patients with the acute coronary syndrome [15, 16]. Moreover,
CIB1 expression is strongly induced in cardiomyocytes by hypertrophy. The contribution of CIB1 to transverse aortic constriction (TAC)-induced cardiac hypertrophy model has been investigated
[17]. CIB1 overexpression aggravates cardiac hypertrophy in response to pressure overload, while CIB1 deficiency inhibits pathological cardiac growth.
Besides, CIB1 deletion also reduced myocardial fibrosis and cardiac dysfunction in the mice after pressure overload [17]. However, the role of CIB1 in MI
and the underlying mechanism have not been explored yet. In our research, MI model was established by left anterior descending coronary artery (LAD) ligation [18, 19]. TAC-induced cardiac hypertrophy and LAD ligation-induced MI are both models of heart failure, but they have different pathogenesis
mechanisms. TAC triggers the exposure of the heart to high pressure and cardiac hypertrophy, while LAD induces ischemic heart failure [20, 21]. The findings above suggest a vital role of CIB1 in heart diseases.An increasing number of studies report that the phosphatidylinositol 3-kinase (PI3K)/protein kinase B (Akt) pathway is involved in cardiac fibrosis [22,
23]. PI3K is a protein consisting of a regulatory subunit p85 and a catalytic subunit p110. Activation of the p85 subunit leads to activation of p110,
inducing the phosphorylation and activation of Akt [24]. In this study, to investigate CIB1 role in MI-induced myocardial fibrosis and whether CIB1
functions in this process via regulating the PI3K/Akt pathway, we established the MI model in vivo via LAD ligation and assessed angiotensin II (Ang
II)-inducing fibrosis in vitro using cardiac fibroblasts. Cardiac fibrosis is a common feature after MI. By experiments in vivo and in vitro,
we demonstrate that CIB1 knockdown plays a protective role in MI via inhibiting myocardial fibrosis, which may provide new insight into MI progression and therapy.
Materials and Methods
Animal model
Permanent ligation of the left anterior descending coronary artery (LAD) was performed on 8-week-old C57BL/6 male mice purchased from Liaoning Changsheng Biotechnology Co., Ltd. (Benxi,
China) to induce myocardial infarction (MI), as previously described [25, 26]. Briefly, mice were anesthetized
with an intraperitoneal injection of 50 mg/kg sodium pentobarbital (Xiya reagent, Linyi, China). The trachea was exposed after a median neck incision and then split horizontally for 2–3 mm.
A plastic cannula was intubated into the trachea and connected to a rodent ventilator. Next, a left thoracotomy was carried out between the third and the fourth intercostal rib space to
expose the heart. LAD was ligated permanently using a 7–0 silk suture, and then the chest was then closed. The same operation was performed on sham-operated mice without LAD ligation. During
the whole process, the mice’s body temperature was maintained at about 37°C. The animal experiments were approved by the ethics committee of the First Affiliated Hospital of Anhui Medical
University (No.LLSC20201117).To detect CIB1 expression, the sham-operated and MI mice were anesthetized by an overdose of sodium pentobarbital (200 mg/kg) for euthanasia at 1 and 4 weeks post-MI, and the heart tissues
were separated. In addition, some heart tissues were frozen in liquid nitrogen and store at −70°C, and some were fixed with 4% paraformaldehyde (Aladdin, Shanghai, China).To investigate CIB1 function in MI, the sham-operated mice were subjected to multipoint intramyocardial injection of equivalent PBS (Wanleibio, Shenyang, China) without LAD ligation.
Multipoint intramyocardial injection (5 points, 2 µl/point) of PBS, 5 × 106 transducing units of Cib1 RNA-interfering lentivirus
(LV-shCib1), or its negative control lentiviral (LV-shNC) was performed respectively before LAD ligation during the MI surgery (Fig.
1). Six mice were used for analysis in each group. Four weeks later, the mice were euthanized, and some heart tissues were used to separate the left ventricle and calculated each ratio
of left ventricle weight to the bodyweight of the mouse. The other heart tissues were used to measure the infarct area with 2, 3, 5-triphenyltetrazoliumchloride (TTC) staining and frozen in
liquid nitrogen before stored at −70°C.
Fig. 1.
The diagram of treatments for CIB1 function analysis in the myocardial infarction (MI). MI model was established on 8-week-old male C57BL/6 mice with permanent ligation of the left
anterior descending coronary artery (LAD). Multipoint intramyocardial injection of Cib1 RNA-interfering lentivirus (LV-shCib1) was performed before
LAD ligation for CIB1 knockdown. PBS: phosphate buffer saline. LV-shNC: negative control lentivirus.
The diagram of treatments for CIB1 function analysis in the myocardial infarction (MI). MI model was established on 8-week-old male C57BL/6 mice with permanent ligation of the left
anterior descending coronary artery (LAD). Multipoint intramyocardial injection of Cib1 RNA-interfering lentivirus (LV-shCib1) was performed before
LAD ligation for CIB1 knockdown. PBS: phosphate buffer saline. LV-shNC: negative control lentivirus.
Echocardiography (Echo)
Four weeks after MI modeling, the left ventricular function of the mice, including left ventricular end-diastolic dimension (LEVDd), left ventricular end-systolic dimension (LVESd),
fractional shortening (FS,%), and ejection fraction (EF,%), was assessed with echocardiography.
Quantitative real-time PCR
The total RNA isolation reagent TRIpure (Bioteke, Beijing, China) was used to extract RNA in tissues or cells. Then RNA was reverse-transcribed by Super M-MLV reverse transcriptase
(Bioteke), and cDNA was amplificated with 2×Taq PCR MasterMix (Solarbio, Beijing, China) and detected on ExicyclerTM 96 Real-time PCR System (Bioneer Corporation, Daejeon, Korea).
The primers were synthesized by Genscript Biotechnology Co., Ltd. (Nanjing, China) and listed in Table 1.
Table 1.
The primers used for real-time PCR
Gene
Forward (5’-3’)
Reverse (5’-3’)
Cib1
GATGACGATGGAACCCTG
ATGCTGGAACTCGGAAAG
Vim
TTGAACGGAAAGTGGAATC
AGGTCAGGCTTGGAAACG
Col1a1
AAGAACCCTGCCCGCACATG
GAATCCATCGGTCATGCTCT
Col3a1
GCCCACAGCCTTCTACACCT
GATAGCCACCCATTCCTCCC
β-actin
CTGTGCCCATCTACGAGGGCTAT
TTTGATGTCACGCACGATTTCC
Western blot analysis
The proteins isolated from tissues or cells were quantified using BCA Kit (Beyotime, Shanghai, China). Equal amounts of proteins were separated via SDS-PAGE and transferred
onto polyvinylidene difluoride (PVDF; Thermo Scientific, Pittsburgh, PA, USA) membranes. The membrane was blocked with 5% bovine serum albumin (BSA; Biosharp, Hefei, China) and incubated
with the anti-CIB1antibody (Cat.No.A4430; dilution, 1:1,000; Abclonal, Wuhan, China), anti-PI3K-p85 antibody (Cat.No. AF6241; dilution, 1:1,000; Affinity, Cincinnati, OH, USA),
anti-p-PI3K-p85 antibody (Cat.No. AF3242; dilution, 1:1,000; Affinity), anti-Akt antibody (Cat.No. AF6261; dilution 1:1,000; Affinity), anti-p-Akt antibody (Cat.No. AF0016; dilution 1:1,000;
Affinity), anti-α-SMA antibody (Cat.No. AF1032; dilution 1:1,000; Affinity), and anti-Collagen I antibody (Cat.No. AF7001; dilution 1:1,000; Affinity) at 4°C overnight, followed by the
secondary antibody horseradish peroxidase-linked IgG (Cat.No. SA00001-2; dilution, 1:10,000; Proteintech Group, Rosemont, IL, USA) for 40 min at 37°C. All protein bands became visible using
enhanced chemiluminescence (ECL; Seven-sea pharmtech, Shanghai, China), and the density of each band was quantified.
Measurement of myocardial infarct size
Infarct size was determined by TTC staining. After euthanasia, the left ventricular was excised from the heart and frozen at −20°C immediately for 3 h. Then they were cut into five
1-mm-thick transverse slices parallel to the atrioventricular groove. Five sections in each group were incubated with 2% TCC (Solarbio) solution in the dark at 37°C for 30 min. The ratio of
infarct area (pale) to LV area was calculated using Image-Pro Plus software 6.0 (Media Cybernetics, Inc., Bethesda, MD, USA).
Histological analysis
Cardiomyocyte short axis diameter was measured on the images from hematoxylin (Solarbio) and eosin (Sangon, Shanghai, China) stained heart tissue sections. Short axis diameter was measured
in three different random areas at 600× magnification. Masson’s trichrome staining was performed to evaluate the severity of myocardial fibrosis. The tissue slides embedded in paraffin were
stained with hematoxylin (Solarbio) solution, ponceau (Sinopharm, Beijing, China), and acid fuchsin (Sinopharm) solution, and toluidine blue (Sinopharm) in turn. The images were captured at
200× magnification under a fluorescence microscope (BX53, Olympus, Tokyo, Japan). The collagen fibers were stained blue, and the cell cytoplasm was stained red. For quantification, the ratio
of fibrosis area to the entire area was measured using Image-Pro Plus software 6.0 (Media Cybernetics, Inc.).In immunohistochemical staining, the heart tissues fixed with 4% paraformaldehyde were embedded in paraffin and dissected into 5-µm sections. After subjected to
deparaffinization, rehydration, and antigen retrieval, the slides were incubated with 3% H2O2 (Sinopharm) solution for 15 min. Then the slides were blocked with goat
serum (Solarbio) and incubated with anti-CIB1 antibody (Cat.No. A4430; dilution,1:200; Abclonal) at 4°C overnight. After the tissues were washed, they were probed with horseradish
peroxidase-labeled goat anti-rabbit IgG (Cat.No. #31460; dilution, 1:500; ThermoFisher Scientific, Pittsburgh, PA, USA) at 37°C for 60 min. Subsequently, the tissue slides were stained with
3, 3’-diaminobenzidine (DAB; Solarbio) followed by counterstaining with hematoxylin (Solarbio) and dehydration with xylene. Representative photographs of immunohistochemistry were captured
under a microscope (BX53, Olympus). Integrated option density summation (IOD SUM) of CIB1-positive cells and area were measured by Image-Pro Plus software 6.0 (Media Cybernetics, Inc.). The
mean density was used to represent CIB1 expression.
Isolation and culture of murine primary cardiac fibroblasts
After euthanasia with sodium pentobarbital (200 mg/kg), hearts were separated from 3-day-old C57BL/6 mice and finely minced into small pieces under sterile conditions. The pieces were
digested with 0.025 mg/ml of Liberase TM solution containing collagenase I and II (Roche, Basel, Switzerland) and DNase (40 ug/ml; Aladdin) in serum-free Dulbecco’s modified Eagle’s (DMEM)
medium (Gibco, Grand Island, NY, USA) at 37°C for 45 min. Then cell suspensions were filtered through a 70-µm aperture sieve and centrifuged at 50 g for 2 min. The
supernatants were filtered through a 40-µm aperture sieve and centrifuged at 450 g for 4 min. Cells were gathered at the bottom of the tube, resuspended in DMEM medium
containing 10% fetal bovine serum (FBS; Biological Industries, Kibbutz Beit-Haemek, Israel), and then cultured at 37°C in 5% CO2. Fibroblast specific protein 1 (FSP1)
immunofluorescence staining was performed to identify the cardiac fibroblasts.
Immunofluorescence (IF) staining
The sections of heart tissues embedded in paraffin were put in citrate solution at a high temperature for antigen retrieval and blocked with goat serum (Solarbio) in a wet box at room
temperature for 15 min. Then the sections were incubated with anti-α-SMA antibody (Cat.No. AF1032; dilution, 1:200; Affinity) or anti-FSP1 antibody (Cat.No. A19109; dilution, 1:200;
Abclonal) at 4°C overnight followed by a 60-min incubation with the Cy3-labeled goat anti-rabbit IgG (Cat.No. A0516; dilution, 1:200; Beyotime) in the dark at room temperature. Finally, the
cells were counterstained with 4’,6-diamidino-2-phenylindole (DAPI; Beyotime), and fluorescence quenching agent resistance (Solarbio) was added. To detect α-SMA or FSP1 expression in the
CFs, the cell slides were fixed with paraformaldehyde and subjected to 0.1% Triton X-100 (Beyotime). The following processes were the same with heart tissues. The images were captured at
400× magnification under a fluorescence microscope (BX53, Olympus). IOD SUM of α-SMA and area were measured by Image-Pro Plus software 6.0 (Media Cybernetics, Inc.). The mean density was
used to quantify the protein expression.
Cell model
The CFs were infected with Cib1 RNA-interfering lentivirus or NC lentivirus in the culture medium. Forty-eight hours later, 0.1 µM angiotensin II (Ang II;
Aladdin) was added to the medium. The cells were cultured for another 24 h and then were collected for detection. To confirm the effects of CIB1 on the PI3K/Akt pathway, LY294002
(MedChemExpres, Monmouth Junction, NJ, USA), a specific PI3K/Akt pathway inhibitor, was added to treat the CFs before Ang II treatment. There were three replicates in each group.
Statistical analysis
The data were represented as mean ± SD and subjected to multiple comparisons with ANOVA. P value less than 0.05 suggested that the difference was statistically significant.
GraphPad Prism 7.0 software (GraphPad Software Inc., La Jolla, CA, USA) was used for analysis and histograms.
Results
The expression of CIB1 is upregulated in the heart of MI mice
The mRNA and protein expression of CIB1 was measured at 1 and 4 weeks post-MI. The immunohistochemistry staining of CIB1 in the penumbra of the ischemic heart showed an enhanced CIB1
expression in cardiomyocytes of MI mice compared with sham-operated mice both at 1 and 4 weeks post-MI (Figs. 2A and B). Likewise, the mRNA of Cib1 detected with real-time PCR also exhibited a higher level in the penumbra of the ischemic heart of MI mice than in sham-operated mice
(Fig. 2C), suggesting that MI strongly induces CIB1 expression in the heart.
Fig. 2.
CIB1 expression is upregulated in the heart of MI mice. A. The expression and location of CIB1 in the penumbra of ischemic heart at 1 and 4 weeks post-MI detected with
immunohistochemistry. Magnification: 400×. Scale bar=50 µm. B. Quantification of CIB1 expression in immunohistochemistry. C. The mRNA level of Cib1 in
the penumbra of ischemic heart at 1 and 4 weeks post-MI. Data are expressed as the mean ± SD (n=6/group). **P<0.01 vs.Sham group.
CIB1 expression is upregulated in the heart of MI mice. A. The expression and location of CIB1 in the penumbra of ischemic heart at 1 and 4 weeks post-MI detected with
immunohistochemistry. Magnification: 400×. Scale bar=50 µm. B. Quantification of CIB1 expression in immunohistochemistry. C. The mRNA level of Cib1 in
the penumbra of ischemic heart at 1 and 4 weeks post-MI. Data are expressed as the mean ± SD (n=6/group). **P<0.01 vs.Sham group.
CIB1 silencing relieves MI-induced myocardial damage and improves cardiac dysfunction
The decreased protein level of CIB1 in the penumbra of the ischemic heart of MI mice indicated that the infection of Cib1 RNA-interfering lentivirus knocked down CIB1 in
mice successfully (Figs. 3A and B). To investigate the effects of downregulation of CIB1 on cardiac function, the cardiac function indexes such as LVEDd, LVEDs, FS, and EF were measured with Echo. MI significantly
markedly increased LVEDd and LVESd but lowered FS and EF when compared with sham group. While the silencing of CIB1 mediated by LV-shCib1 reduced LVEDd and LVESd but
elevated FS and EF to levels close to those in sham group (Table 2), suggesting that CIB1 silencing improved MI-induced cardiac dysfunction in mice. Besides, the infarction area stained by TTC showed that the knockdown of CIB1 reduced the
infraction area of the heart, which was dramatically enlarged by MI (Figs. 3C and D). Moreover, the left ventricle-to-body weight ratio (LV/BW) was
calculated in MI mice. MI notably increased the value of LV/BW compared with sham group while the ratio was regressed because of the downregulation of CIB1 in MI mice (Fig. 3E). Furthermore, the mean of cardiomyocyte short axis diameter, which was increased by MI, was reduced in the heart tissues when CIB1 was knocked down (Fig. 3F). Therefore, the results above indicate that CIB1 silencing relieves MI-induced myocardial damage, including infarction and cardiac hypertrophy,
and improves cardiac dysfunction.
Fig. 3.
CIB1 silencing relieves MI-induced myocardial damage and improves cardiac dysfunction. A–B. The images (A) and quantification (B) of CIB1 expression in the penumbra of the ischemic
heart of the mice infected with Cib1 RNA-interfering lentivirus detected with western blot. C–D. Representative images (C) and quantification (D) of heart infarct size
detected with tetrazolium chloride (TTC) staining at 4 weeks post-MI. Normal tissue area (red) and infarcted tissue area (white) were measured, and the ratio of infarcted tissue area
to the entire area was calculated. N.D.: not detected. E. The left ventricle-to-body weight ratio (LV/BW) of mice at 4 weeks post-MI. F. Cardiomyocyte short axis diameter measured in
hematoxylin and eosin stained heart tissue sections at 4 weeks post-MI. Data are expressed as the mean ± SD (n=6/group). **P<0.01.
Table 2.
Cardiac function indexes in mice determined by Echo
Group
LVEDd (mm)
LVESd (mm)
FS (%)
EF (%)
Sham
2.267 ± 0.383
1.417 ± 0.2563
37.47 ± 4.306
67.43 ± 5.948
MI
4.017 ± 0.3971**
3.15 ± 0.2811**
21.47 ± 2.273**
46.95 ± 4.728**
MI+LV-shNC
4.233 ± 0.377
3.367 ± 0.2944
20.4 ± 3.718
44.65 ± 6.215
MI+LV-shCib1
2.983 ± 0.371##
1.933 ± 0.1506##
34.53 ± 7.736##
64.28 ± 7.951##
The FS and EF are significantly lower in MI group than those in sham group, while the LVEDd and LVESd are overtly higher in MI group than those in sham group, which are improved after
CIB1 knockdown. **P<0.01 vs. sham group, ##P<0.01 vs. MI+LV-shNC group.
CIB1 silencing relieves MI-induced myocardial damage and improves cardiac dysfunction. A–B. The images (A) and quantification (B) of CIB1 expression in the penumbra of the ischemic
heart of the mice infected with Cib1 RNA-interfering lentivirus detected with western blot. C–D. Representative images (C) and quantification (D) of heart infarct size
detected with tetrazolium chloride (TTC) staining at 4 weeks post-MI. Normal tissue area (red) and infarcted tissue area (white) were measured, and the ratio of infarcted tissue area
to the entire area was calculated. N.D.: not detected. E. The left ventricle-to-body weight ratio (LV/BW) of mice at 4 weeks post-MI. F. Cardiomyocyte short axis diameter measured in
hematoxylin and eosin stained heart tissue sections at 4 weeks post-MI. Data are expressed as the mean ± SD (n=6/group). **P<0.01.The FS and EF are significantly lower in MI group than those in sham group, while the LVEDd and LVESd are overtly higher in MI group than those in sham group, which are improved after
CIB1 knockdown. **P<0.01 vs. sham group, ##P<0.01 vs. MI+LV-shNC group.
CIB1 knockdown alleviates myocardial fibrosis caused by MI in mice
The fibrosis in the penumbra of ischemic heart was stained by Masson’s trichrome staining. Less collagen deposition in the penumbra of ischemic heart was observed in MI mice infected with
LV-shCib1, and quantitative analysis revealed that the percent of myocardial fibrosis area was reduced in MI mice after CIB1 knockdown (Figs. 4A and B). The expression of α-SMA is considered an indicator of differentiated myofibroblasts. Besides, FSP1 is also an indicator of fibroblast/myofibroblast phenotypes. Immunofluorescence
staining showed that the numbers of FSP1- and α-SMA-positive cells were increased by MI while regressed by CIB1 silencing (Fig. 4C). This was
supported by the quantification of α-SMA immunofluoresence staining (Fig. 4D), suggesting that CIB1 downregulation represses activation of
myofibroblasts induced by MI. Furthermore, the transcriptional levels of genes encoding vimentin (Vim), collagen I (Col1a1), and collagen III
(Col3a1) were detected by real-time PCR. The expressions of these genes in the penumbra of the ischemic heart were also strongly induced by MI but repressed by CIB1
silencing (Figs. 4E–G). These findings demonstrate that the downregulation of CIB1 mitigates MI-induced myocardial fibrosis by inhibiting the
expressions of proteins involved in collagen production in mice.
Fig. 4.
CIB1 knockdown alleviates myocardial fibrosis caused by MI in mice. A. Masson’s trichrome staining of heart slides at 4 weeks post-MI. The collagen fibers stained blue and the cell
cytoplasm stained red. Magnification: 200×. Scale bar=100 µm. B. Percentage of the fibrotic area in Masson’s trichrome staining. C. The representative images of FSP1
and α-SMA expression in the penumbra of ischemic heart in immunofluorescence staining. Magnification: 400×. Scale bar=50 µm. D. Quantification of α-SMA expression in
the penumbra of ischemic heart at 4 weeks after MI modeling. E–G. The mRNA level of Vim (E), Col1a1 (F), and Col3a1 (G) in the
penumbra of the ischemic heart measured with real-time PCR. Data are expressed as the mean ± SD (n=6/group). **P<0.01.
CIB1 knockdown alleviates myocardial fibrosis caused by MI in mice. A. Masson’s trichrome staining of heart slides at 4 weeks post-MI. The collagen fibers stained blue and the cell
cytoplasm stained red. Magnification: 200×. Scale bar=100 µm. B. Percentage of the fibrotic area in Masson’s trichrome staining. C. The representative images of FSP1
and α-SMA expression in the penumbra of ischemic heart in immunofluorescence staining. Magnification: 400×. Scale bar=50 µm. D. Quantification of α-SMA expression in
the penumbra of ischemic heart at 4 weeks after MI modeling. E–G. The mRNA level of Vim (E), Col1a1 (F), and Col3a1 (G) in the
penumbra of the ischemic heart measured with real-time PCR. Data are expressed as the mean ± SD (n=6/group). **P<0.01.
The downregulation of CIB1 restrains Ang II-induced CFs transformation and collagen production in vitro
The CFs isolated from mice hearts were used to confirm the effects of CIB1 on myocardial fibrosis in vitro. FSP1 is a marker for the identification of CFs.
Immunofluorescence staining of FSP1 showed that CFs were isolated from mice hearts successfully, and these cells could be used for modeling in vitro (Fig. 5A). The analysis of CIB1 protein level showed that the CFs infected with lentivirus expressing shRNA targeting Cib1 exhibited a lower CIB1 protein level compared with
normal cells (Figs. 5B and C). Ang II was used to induce cellular fibrosis in vitro, and the effects of CIB1 knockdown on CFs
fibrosis were investigated (Fig. 6). The expression of α-SMA detected by IF was enhanced by Ang II and weakened in Ang II-treated cells when CIB1 was knocked down (Figs. 7A and
B). Likewise, the mRNA levels of Vim, Col1a1, and Col3a1 were also analyzed in cells. Similar to the results in mice hearts, the
silencing of CIB1 also downregulated the expressions of these genes in Ang II-treated CFs in vitro (Figs. 7C–E). These results
indicate that the downregulation of CIB1 restrains Ang II-induced cardiac fibroblasts transformation and collagen production.
Fig. 5.
Identification of cardiac fibroblasts (CFs) and CIB1 expression in the CFs. A. Immunofluorescence staining of FSP1 for the identification of cardiac fibroblasts (CFs). Magnification:
400×. Scale bar=50 µm. B–C. Representative images (B) and quantification (C) of CIB1 protein expression in the CFs infected with Cib1 RNA-interfering
lentivirus. Data are expressed as the mean ± SD (n=3/group). **P<0.01.
Fig. 6.
The diagram of the investigation of CIB1 function in angiotensin II (Ang-II)-induced cardiac fibroblasts fibrosis in vitro. To analyze the effects of CIB1 knockdown
on CFs fibrosis, the CFs were infected with Cib1 RNA-interfering lentivirus (LV-shCib1) or its negative control lentivirus (LV-shNC) followed by
Ang-II treatment at 48 h post-injection. For the signaling pathway analysis, the CFs were subjected to an inhibitor of the PI3K/Akt pathway, LY294002, before Ang-II treatment.
Fig. 7.
Down-regulation of CIB1 restrains angiotensin II (Ang II)-induced cardiac fibroblasts (CFs) transformation and collagen production in vitro. A–B. The images (A) and
quantification (B) of immunofluorescent staining for α-SMA expression in Ang II-treated CFs. Magnification: 400×. Scale bar=50 µm. C–E. The mRNA level of Vim
(C), Col1a1 (D), and Col3a1 (E) in the Ang II-treated CFs measured with real-time PCR. Data are expressed as the mean ± SD (n=3/group).
**P<0.01.
Identification of cardiac fibroblasts (CFs) and CIB1 expression in the CFs. A. Immunofluorescence staining of FSP1 for the identification of cardiac fibroblasts (CFs). Magnification:
400×. Scale bar=50 µm. B–C. Representative images (B) and quantification (C) of CIB1 protein expression in the CFs infected with Cib1 RNA-interfering
lentivirus. Data are expressed as the mean ± SD (n=3/group). **P<0.01.The diagram of the investigation of CIB1 function in angiotensin II (Ang-II)-induced cardiac fibroblasts fibrosis in vitro. To analyze the effects of CIB1 knockdown
on CFs fibrosis, the CFs were infected with Cib1 RNA-interfering lentivirus (LV-shCib1) or its negative control lentivirus (LV-shNC) followed by
Ang-II treatment at 48 h post-injection. For the signaling pathway analysis, the CFs were subjected to an inhibitor of the PI3K/Akt pathway, LY294002, before Ang-II treatment.Down-regulation of CIB1 restrains angiotensin II (Ang II)-induced cardiac fibroblasts (CFs) transformation and collagen production in vitro. A–B. The images (A) and
quantification (B) of immunofluorescent staining for α-SMA expression in Ang II-treated CFs. Magnification: 400×. Scale bar=50 µm. C–E. The mRNA level of Vim
(C), Col1a1 (D), and Col3a1 (E) in the Ang II-treated CFs measured with real-time PCR. Data are expressed as the mean ± SD (n=3/group).
**P<0.01.
CIB1 depletion represses the PI3K/Akt signaling pathway activated by Ang II to prevent cellular fibrosis in vitro
To investigate the regulation of CIB1 to the PI3K/Akt signaling pathway, we analyzed the protein levels of phosphorylated p85 subunit of PI3K (p-PI3K-p85), total p85 subunit of PI3K
(PI3K-p85), phosphorylated Akt (p-Akt), and total Akt in CFs. Notably, Ang II elevated the level of p-PI3K-p85 in CFs, and CIB1 knockdown in Ang II-treated cells repressed the
phosphorylation of PI3K-p85. In contrast, the total level of PI3K-p85 between the different groups displays no significant difference (Figs. 8A and
B). Also, CIB1 silencing reduced the level of p-Akt which was increased by Ang II in cells without altering the total Akt level (Figs. 8C and
D). Therefore, the downregulation of CIB1 inhibited the activation of the PI3K/Akt signaling pathway in CFs induced by Ang II. To confirm that the effects of CIB1 on myocardial fibrosis were
mediated by the PIK3/Akt signaling pathway, LY294002, a PI3K/Akt pathway inhibitor, was added to pre-treat CFs before Ang II treatment (Fig. 6). The
protein level of α-SMA and collagen I detected by western blot showed that the inhibition of the PI3K/Akt signaling pathway suppressed the expressions of α-SMA and collagen I and CIB1
knockdown exert a similar effect on these two protein expressions with LY294002 (Figs. 8E and F). Further, CIB1 knockdown may play an anti-fibrosis
role by repressing the PI3K/Akt signaling pathway in CFs.
Fig. 8.
CIB1 depletion represses the PI3K/Akt signaling pathway activated by Ang II to prevent cardiac fibroblasts (CFs) fibrosis. A–B. Representative images (A) and quantification (B) of
phosphorylated PI3K-p85 (p-PI3K-p85) and total PI3K-p85 protein expression in Ang II-treated CFs, analyzed by western blot. C–D. Representative images (C) and quantification (D) of
phosphorylated Akt (p-Akt) and total Akt protein expression in Ang II-treated CFs. E–F. Representative images (E) and quantification (F) of α-SMA and Collagen I levels in Ang
II-treated CFs when CIB1 was knocked down or LY294002 (an inhibitor of the PI3K/Akt pathway) was added. Data are expressed as the mean ± SD (n=3/group). **P<0.01
vs. Ang II.
CIB1 depletion represses the PI3K/Akt signaling pathway activated by Ang II to prevent cardiac fibroblasts (CFs) fibrosis. A–B. Representative images (A) and quantification (B) of
phosphorylated PI3K-p85 (p-PI3K-p85) and total PI3K-p85 protein expression in Ang II-treated CFs, analyzed by western blot. C–D. Representative images (C) and quantification (D) of
phosphorylated Akt (p-Akt) and total Akt protein expression in Ang II-treated CFs. E–F. Representative images (E) and quantification (F) of α-SMA and Collagen I levels in Ang
II-treated CFs when CIB1 was knocked down or LY294002 (an inhibitor of the PI3K/Akt pathway) was added. Data are expressed as the mean ± SD (n=3/group). **P<0.01
vs. Ang II.
Discussion
CIB1 is upregulated in the urine of patients with both acute and chronic ischemic heart failure, the right atrial myocardium of patients with atrial fibrillation, and the peripheral blood
mononuclear cells of the patients with the acute coronary syndrome [14,15,16]. In this study, we proved that CIB1 was also upregulated in the heart tissues of MI mice, suggesting that MI strongly induced CIB1 expression. There has been little research
about the function of CIB1 in heart diseases, especially in MI. Heart failure following MI occurs with ventricular dilatation, scar thinning, and activation of interstitial fibrosis [27, 28]. Fluid overload, myocardial hypertrophy, and ongoing cardiomyocyte death lead to further deterioration in
ventricular function [29, 30]. Therefore, we analyzed cardiac dysfunction and fibrosis in MI after CIB1 silencing.
Our results showed that CIB1 silencing improved cardiac function impaired by MI, reduced the infarct size in the heart, and alleviated cardiac hypertrophy induced by MI. Similarly, Heineke’s
study shows that Cib1-deleted mice exhibit a marked alleviation in myocardial hypertrophy, and overexpression of CIB1 augments myocardial hypertrophy [17]. CIB1, as a hypertrophic activator of the calcineurin-nuclear factor of activated T cells (NFAT) signaling in maladaptive programming of cardiac growth, is necessary for
cardiac hypertrophy [17, 31, 32]. Moreover, fibrosis is the excessive
accumulation of collagen and other extracellular matrix (ECM) components which enhances ventricular stiffness and causes abnormal diastolic relaxation and filling, triggering cardiac
dysfunction [33]. The results of myocardial fibrosis both in vivo and in vitro indicated that CIB1 downregulation
repressed the expressions of related proteins, including α-SMA, vimentin, Collagen I, and Collagen III, resulting in the inhibition of collagen production and myocardial fibrosis. Likewise,
during pressure overload, the inhibition of CIB1 represses cardiac hypertrophy and fibrosis and initially improved cardiac function [17, 34]. In this research, we demonstrated that CIB1 contributed to the development of MI and its depletion played an anti-fibrotic role and preserved cardiac
function in MI.According to the previous studies, the PI3K/Akt signaling pathway is involved in fibrosis after MI, but the effect of this pathway in myocardial fibrosis is still controversial. On the one
hand, the activation of the PI3K/Akt pathway attenuates fibrosis in MI. For instance, astragaloside IV and grape seed proanthocyanidin extract both exert cardioprotection, including
attenuating fibrosis after MI by activating the PI3K/AKT pathway [35, 36]. Conversely, it has been reported that
the activation of the PI3K/Akt pathway also promotes myocardial fibrosis after MI. Apelin-13 alleviated cardiac fibrosis via inhibiting the PI3K/Akt pathway in MI-induced
heart failure [22]. We speculate that different molecules or drugs may target different downstream genes or proteins in the PI3K/Akt pathway, resulting
in the contrary effects of the PI3K/Akt pathway on fibrosis. In our study, deactivation of this pathway repressed fibrosis and reducing collagen production in CFs. In addition to fibrosis, the
deletion of genes encoding Akt1 caused reduced cardiac hypertrophy and the development of heart failure in mice [37]. However, the role of CIB1 in the
PI3K/Akt pathway is limited. In MDA-MB-468 breast cancer and SK-N-SH neuroblastoma cells, RNAi knockdown of Cib1 significantly reduced the activity of Akt, a vital component
of the PI3K/Akt pathway [38]. In the present study, we demonstrated that the PI3K/Akt pathway was activated by MI in vivo and in
vitro, and CIB1 silencing repressed the activation of this pathway. Consistent with the previous study, the deactivation of the PI3K/Akt pathway caused by CIB1 knockdown attenuates
myocardial fibrosis and cardiac dysfunction induced by MI, indicating that CIB1 downregulation may exert a protective effect in MI via inhibiting the PI3K/Akt signaling
pathway. We have confirmed the role of CIB1 in the activation of the PI3K/Akt pathway after MI in this study. Still, the following mechanism and the relationship between the PI3K/Akt pathway
and myocardial fibrosis remain to be investigated more deeply.CIB1 was first discovered as a binding partner of the αIIb integrin, but the binding partner of CIB1 in cardiac fibroblasts was unknown in this study. Besides αIIb integrin, CIB1 is reported
to interact with other integrins such as integrin α2, α3, α4, and α5 [8]. Some integrins are involved in the activation of the PI3K/Akt pathway. For
instance, the blockade of α2β1 weakens PI3K/Akt signal in human colorectal cancer cell line HCT-116 and mouse colorectal cancer cell line CT-26 [39].
Integrin α2 and α5 could activate PI3K/Akt signaling pathway [40, 41]. Activation of the integrin α5β1/PI3K/Akt
signaling pathway induces hepatic stellate cell activation, proliferation, and migration and leads to liver fibrosis [42]. Based on the previous research
and current study findings, we speculate that CIB1 knockdown may inhibit the PI3K/Akt signaling pathway by interacting with integrin α2, α5, or other integrins, thus alleviating MI-induced
cardiac fibrosis. However, whether or how CIB1 regulates MI-induced cardiac fibrosis via these integrins needs further exploration.Furthermore, the inactivation of the PI3K/Akt signaling pathway mediated by CIB1 knockdown is necessary for the abnormal translocation and accumulation of glyceraldehyde 3-phosphate
dehydrogenase in the nucleus which can lead to subsequent nonapoptotic and GAPDH-dependent cell death in cancer [38]. Also, CIB1 mitigated apoptotic cell
death of dopaminergic cells [43]. The overexpression of CIB1 in HeLa cells causes apoptosis [44]. Thereby, CIB1
may play contradictory roles in the apoptosis of diverse cell types under different environments. According to these findings, we hypothesize that CIB1 functions not only in myocardial
fibrosis but also in cell death or apoptosis in the heart after MI by regulating the PI3K/Akt signaling pathway, which was not explored in the current study but will be confirmed in the
future.In summary, CIB1 is upregulated in MI, which upregulates the expressions of proteins in collagen production, including vimentin, Collagen I, and Collagen III through activating the PI3K/Akt
signaling pathway and then induces myocardial fibrosis, resulting in cardiac dysfunction after MI (Fig. 9). Thus, CIB1 knockdown can attenuate these myocardial damages caused by MI, which may be a potential candidate for targeted therapies in cardiovascular disease, including MI.
Fig. 9.
The diagram of the potential mechanism of CIB1 in myocardial infarction (MI).
The diagram of the potential mechanism of CIB1 in myocardial infarction (MI).
Ethics Approval
The animal experiments were approved by the ethics committee of the First Affiliated Hospital of Anhui Medical University (No.LLSC20201117).
Conflict of Interests
The authors declare that there is no conflict of interest regarding the publication of this paper.
Author Contributions
All persons who meet authorship criteria are listed as authors. Guangquan Hu and Jiehua Li contributed to the conception of the work. Xiaojie Ding and Feng Gao performed the experiments.
Guangquan Hu and Xiaojie Ding analyzed the data. Guangquan Hu drafted the manuscript. Jiehua Li revised the manuscript.
Data Availability Statement
The data that support the findings of this study are available from the corresponding author upon reasonable request.
Authors: W Zhu; B L Gliddon; K E Jarman; P A B Moretti; T Tin; L V Parise; J M Woodcock; J A Powell; A Ruszkiewicz; M R Pitman; S M Pitson Journal: Oncogene Date: 2016-12-12 Impact factor: 9.867