Aziza A El-Nekeety1, Marwa E Hassan2, Rasha R Hassan3, Ola I Elshafey4, Zeinab K Hamza1, Sekena H Abdel-Aziem5, Nabila S Hassan6, Mosaad A Abdel-Wahhab1. 1. Food Toxicology & Contaminants Dept., National Research Centre, Dokki, Cairo, Egypt. 2. Toxicology Dept., Research Institute of Medical Entomology, Giza, Egypt. 3. Immunology Dept., Research Institute of Medical Entomology, Giza, Egypt. 4. Physical Chemistry Dept., National Research Centre, Dokki, Cairo, Egypt. 5. Cell Biology Dept., National Research Centre, Dokki, Cairo, Egypt. 6. Pathology Dept. National Research Centre, Dokki, Cairo, Egypt.
Abstract
The application of essential oils in food and pharmaceutical sectors face several challenges due to their sensitivity to oxidation process. Additionally, the biosynthesis of nanometals is growing rapidly; however, the toxicity of these particles against living organisms did not well explore yet. This study aimed to determine the bioactive compounds in basil essential oil (BEO) using GC-MS, to encapsulate and characterize BEO and to evaluate its protective role against the oxidative stress and genotoxicity of biosynthesized iron nanoparticles (Fe-NPs) in rats. Six groups of male Sprague-Dawley rats were treated orally for 4 weeks included the control group, Fe-NPs-treated group (100 mg/kg b.w.); EBEO-treated groups at low (100 mg/kg b.w.) or high (200 mg/kg b.w.) dose and the groups treated with Fe-NPs plus the low or the high dose of EBEO. The GC-MS analysis revealed the identification of 48 compounds and linalool was the major compound. The average sizes and zeta potential of the synthesized Fe-NPs and EBEO were 60 ± 4.76 and 120 ± 3.2 nm and 42.42 mV and -6.4 mV, respectively. Animals treated with Fe-NPs showed significant increase in serum biochemical analysis, oxidative stress markers, cytokines, lipid profile, DNA fragmentation and antioxidant enzymes and their gene expression and severe changes in the histology of liver and kidney tissues. Administration of Fe-NPs plus EBEO alleviated these disturbances and the high dose could normalize most of the tested parameters and improved the histology of liver and kidney. It could be concluded that caution should be taken in using the biosynthesized metal nanoparticles in different application. EBEO is a potent candidate to protect against the hazards of metal nanoparticles and can be applied in food and medical applications.
The application of essential oils in food and pharmaceutical sectors face several challenges due to their sensitivity to oxidation process. Additionally, the biosynthesis of nanometals is growing rapidly; however, the toxicity of these particles against living organisms did not well explore yet. This study aimed to determine the bioactive compounds in basil essential oil (BEO) using GC-MS, to encapsulate and characterize BEO and to evaluate its protective role against the oxidative stress and genotoxicity of biosynthesized iron nanoparticles (Fe-NPs) in rats. Six groups of male Sprague-Dawley rats were treated orally for 4 weeks included the control group, Fe-NPs-treated group (100 mg/kg b.w.); EBEO-treated groups at low (100 mg/kg b.w.) or high (200 mg/kg b.w.) dose and the groups treated with Fe-NPs plus the low or the high dose of EBEO. The GC-MS analysis revealed the identification of 48 compounds and linalool was the major compound. The average sizes and zeta potential of the synthesized Fe-NPs and EBEO were 60 ± 4.76 and 120 ± 3.2 nm and 42.42 mV and -6.4 mV, respectively. Animals treated with Fe-NPs showed significant increase in serum biochemical analysis, oxidative stress markers, cytokines, lipid profile, DNA fragmentation and antioxidant enzymes and their gene expression and severe changes in the histology of liver and kidney tissues. Administration of Fe-NPs plus EBEO alleviated these disturbances and the high dose could normalize most of the tested parameters and improved the histology of liver and kidney. It could be concluded that caution should be taken in using the biosynthesized metal nanoparticles in different application. EBEO is a potent candidate to protect against the hazards of metal nanoparticles and can be applied in food and medical applications.
Nowadays, nanotechnology seems a promising revolution in the construction and characterization of the functional properties of the nanoparticles to incur into different branches of sciences (Jothirethinam et al., 2015). Basil (Ocimum basilicum L) is an herb widely used in folk medicine, food flavoring. The essential oil of basil is rich in terpenoid and phenolic components (Chitprasert and Sutaphanit, 2014). This oil has several health benefits such as enhance digestion and inhibit cholesterol synthesis (Majdi et al., 2020), antioxidant (Rezzoug et al., 2019), anti-inflammatory (Eftekhar et al., 2019), antimicrobial (Ebani et al., 2018), anthelmintic (Dawood et al., 2021), and chemopreventive agents (Fitsiou and Pappa, 2019). However, the challenge of using essential oil for any application is to maintain its chemical stability. These essential oils are unstable to oxygen, temperature, light, water content and pH (Aguilar-Veloz et al., 2020; Sandra et al., 2019; Fitsiou and Pappa, 2019). Therefore, a system offering essential oil protection against these deterioration factors is required. Encapsulation technique is an attractive method for the protection of the active components in these essential oils and also to improve their delivery and controlled release in the core of the nano-capsule structure of membrane wall (Abdel-Wahhab et al., 2018; Lammari et al., 2020).Nanometals (NMs) have specific potentials based on their bioavailability, enhanced absorption, and the ability to cross biological barriers (Wang et al., 2010). The toxicity of NMs is extensively reported in vitro models (Dönmez Güngüneş et al., 2017) such as delayed the development and maturation in rabbits and mice (Noori et al., 2011), embryonic malformations, and mortality in the embryos of zebrafish (Zhu et al., 2012). Iron oxide nanoparticles (Fe-NPs) are widely used for different biomedical and bioengineering applications including cell labeling and cancer therapy (Zhu et al., 2017), drug delivery and magnetic resonance imaging (Dadfar et al., 2019; Mohammed et al., 2017). Moreover, iron works as a double-edged sword where it is used as a food supplement at fairly low levels but if its level exceeds the range of human tolerance, toxic effects such as nausea, celialgia, and even death occurred (Ajinkya et al., 2020).Despite these beneficial effects of Fe-NPs, several studies reported that Fe-NPs generate reactive oxygen species (ROS)-mediated toxicity and peroxidation of lipid membrane (Fernández-Bertólez et al., 2019; Malhotra et al., 2020). Contradicting research reports on the toxicity of Fe-NPs include low-grade toxicity with intracellular ROS generation (Yarjanli et al., 2017) or absence of any form of toxicity at lower doses (Malhotra et al., 2020). However, higher doses of Fe-NPs cause a decline in cellular physiological functions primarily due to oxidative damage of DNA (Florencia et al., 2016), gene transcription modulation, mitochondrial damage, and altered calcium-dependent signaling cascade (Krzywoszyńska et al., 2020). There is public concern regarding the toxicity and adverse effect of NMs on human health and the environment. However, the reports on their toxicological effects on the environment and humans are scarce; thus, the need for a proper solution for NMs toxicity is an urgent demand. The current study aimed to determine the bioactive compounds in basil essential oil using GC-MS, preparation and characterization of encapsulated basil essential oil (EBEO) and determination of the potential protective role of EBEO against the oxidative stress and genotoxicity of biosynthesized Fe-NPs in rats.
Materials and methods
Chemicals and kits
Ferrous sulfate heptahydrate (FeSO4.7H2O) was purchased from Sigma Chemical Co. (St Louis, MO, USA). Kits for triglycerides (TG), cholesterol (Cho), high-density lipoprotein (HDL), low-density lipoprotein (LDL), total protein (TP), creatinine, urea alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were supplied by FAR Diagnostics Company (Via Fermi, Italy). Kits for nitric oxide (NO), Catalase (CAT), glutathione peroxidase (GPx) and superoxide dismutase (SOD) were supplied by Eagle diagnostics (Dallas, TX, USA). However, malondialdehyde (MDA) kits were supplied by OxisResearch™ Co. (USA). Tumor necrosis factor-alpha (TNF-α) ELISA kit was supplied by Orgenium Laboratories (Helsinki, Finland). Alpha-fetoprotein (AFP) ELISA kit was supplied by BioChem ImmunoSystems Canada Inc. (Montreal, Canada). Carcinoembryonic antigen (CEA) ELISA kit was supplied by Bio diagnostic (Giza, Egypt). TRIZOL was supplied by Invitrogen™ (CA, USA). All other chemicals used were of the highest analytical grade available.
Basil essential oil (BEO) extraction
The essential oil of basil was extracted using Clevenger-type apparatus as described by Alsaraf et al. (2020) and was dried over anhydrous sodium sulfate then stored at 4 °C until used.
GC-MS analysis of BEO
The analysis of BEO was carried out by Hewlett-Packard GC-MS model 5890 with a flame ionization detector (FID) and DB-5 fused silica capillary column (60 m × 0.32 mm) using the conditions described in details in our previous work (Hassan et al., 2021). Kovats index of the volatile components were calculated according to Adams (2007) using hydrocarbons as references (C7–C20, Aldrich Co).
Preparation of encapsulated basil essential oil (EBEO)
The encapsulation of BEO was carried out using whey protein isolate (WPI) and tween 80 (80 mg) as an emulsifier according to Jinapong et al. (2008). The emulsion solution was encapsulated by spray drying.
Synthesis of iron nanoparticles (Fe-NPs)
Fresh leaves of holy basil were collected from the agriculture area in Dakahlia governorate, Egypt and were washed thoroughly with deionized water then dried at room temperature. The aqueous extract of the leaves was prepared using 12 mg of the dried leaves in 50 ml deionized water in a temperature-controlled water bath at 80 °C. After 1 h, the mixture was filtered and used for the synthesis of Fe-NPs as described by Wonsawat and Panprom (2016). FeSO4 (0.1 mol/L) was mixed with the extract with a volume ratio 5:1 and stirred until the color of the solution turned to dark brown indicating the reduction of Fe2+. The Fe-NPs were collected by centrifugation at 10000 rpm (10 min), washed with distilled water and sonicated several times before subjected to centrifugation again. The collected Fe-NPs were then dried at 90 °C and the powder was used for further experiments.
Characterization of Fe-NPs and EBEO
Scanning electron micrographs (SEM) were recorded on JEOL JAX-840A and JEOL JEM- 1230 electron micro-analyzers, respectively. The Fe-NPs samples were scattered in ethanol and then treated ultrasonically to disperse the individual particle over the gold grids. However, the SEM analysis of EBEO was carried out as described in details in our previous work (Hassan et al., 2021) and an Orius 1000 CCD camera (GATAN, Warrendale, PA, USA) was used for image acquisition. Zeta potential was determined for Fe-NPs or EBEO immediately after being sonicated for 30–60 min. The size distribution, average diameter, and zeta potential of Fe-NPs and EBEO were determined by a particle size analyzer (Nano-ZS, Malvern Instruments Ltd., UK).
Experimental animals
Three-month-old sexually mature female Sprague-Dawley rats (150–160 g) were obtained from the Animal House Lab, National Research Center (NRC), Dokki, Cairo, Egypt. The animals were fed on a standard pellet diet and kept under suitable conditions for one week for adaptation. The animals were maintained in filter top polycarbonate cages in a good validation room free from any source of chemical contamination, under normal temperature (25 ± 1 °C) and 12:12-h dark-light cycle at the Animal House Lab, NRC. The protocol of the study was approved by the Committee of Scientific Ethics ate NRC, Dokki, Cairo, Egypt and was carried out following the guidelines of National Institute of Health (NIH publication 86-23 revised 1985).
Experimental design
Six groups of animals (10 rats/group) were treated orally for 28 days using a stomach tube as follows: group 1; normal control animals which received saline, group 2; rats treated with an aqueous solution of Fe-NPs (100 mg/kg b.w), groups 3 and 4, rats treated with low dose (LD) or high dose (HD) of an aqueous solution of EBEO (100 and 200 mg/kg b.w, respectively), groups 5 and 6; rats treated with Fe-NPs plus EBEO (LD) or EBEO (HD). At the end of the treatment period, all animals have fasted for 12 h, then blood samples were collected via the retro-orbital venous plexus under isoflurane anesthesia. Sera were separated using cooling centrifugation and stored at -20 °C until analysis of ALT, AST, TP, creatinine, urea, lipid profile, AFP, TNF-α and CEA according to the kit's instructions. After the collection of blood samples, animals were euthanized and samples of the liver and kidney of each animal were dissected, weighed and homogenized in phosphate buffer (pH 7.4) and the supernatant was used for the determination of MDA, and NO, GPx, CAT and SOD according to Lin et al. (1998). Another sample of each organ from each animal was fixed in 10% neutral formalin and paraffin-embedded. Sections (5 μm thickness) were stained with hematoxylin and eosin (H & E) for the histological examination (Bancroft et al., 1996). A sample of the liver from each animal was kept at -80 °C for gene expression analysis.
Cytogenetic analyses
RNA isolation and RT-PCR analysis
Total RNA was isolated from liver specimens using TRIZOL reagent according to the instructions of the manufacturer. The extracted RNA was dissolved in 30 μL nuclease-free distilled water and stored at -80 °C until used. The purity and concentration of RNA were determined by NanoDrop™ 1000 Spectrophotometer (Thermo Fisher Scientific, USA). The integrity of the RNA was confirmed with agarose gel electrophoresis. RNase-free DNase kit (Promega) was used to remove any DNA contamination. Total RNA (1μg) was converted to cDNA using a PreMix cDNA Kit (iNtRON Biotechnology, Korea). The resulting cDNA was stored at 20°С for later use or directly used as a semi-quantitative PCR template. The expression of the selected genes was quantified using quantitative real-time PCR performed in a One-Step SYBR Select Master Mix Kit as previously described (Kim et al., 2009). The gene-specific primer sequences for GAPDH, GPx, SOD and CAT are shown in Table 1. Real-time quantitative PCR (RT-qPCR) was carried out on Stratagene Mx3005P Real-Time PCR System (Agilent Technologies) in a 20-μL reaction volume using, 1 μL cDNA, 10 μM of forward and reverse primers, 10 μL TOP real™ qPCR 2× Pre MIX (SYBR Green with low ROX) (Enzynomics) and DNAse-free water. All samples were amplified in a minimum of triplicates. Amplification was performed with a 15-min denaturation at 95 °C, then 40 cycles of 95 °C for 12 s, 58–63 °C for 15 s, and 72 °C for 30 s. To assess amplification specificity, melting curve analysis was performed. Relative gene expression levels normalized to GAPDH were calculated using the 2−ΔΔCt method according to Livak and Schmittgen (2001) and El-makawy et al. (2020).
Table 1
Details giving primer sequences for the genes amplified.
cDNA
Accession number
Forward primer
Reverse primer
RT-PCR product size
Reference
GAPDH
NM_017008.4
CAAGGTCATCCATGACAACTTTG
GTCCACCACCCTGTTGCTGTAG
496
Abdel-Wahhab et al. (2021)
Cu–Zn SOD
FQ210282.1
GCAGAAGGCAAGCGGTGAAC
TAGCAGGACAGCAGATGAGT
477
Limaye et al. (2003)
GPx
NM_030826.4
CTCTCCGCGGTGGCACAGT
CCACCACCGGGTCGGACATAC
290
Limaye et al. (2003)
CAT
NM_012520.2
GCGAATGGAGAGGCAGTGTAC
GAGTGACGTTGTCTTCATTAGCACTG
652
Gandhi et al. (2013)
Details giving primer sequences for the genes amplified.
DNA fragmentation assays for apoptosis
The changes in apoptotic of the liver tissue were assayed colorimetrically by the DNA fragmentation and by the agarose gel electrophoresis following the method of Lu et al. (2002).
DNA gel electrophoresis laddering assay
DNA was electrophoresed using agarose gels (1%) containing ethidium bromide (0.71 g/ml) and the gels were then examined by UV transillumination. The reaction of diphenyl amine (DPA) assay was applied for the detection of fragmented and intact DNA as suggested by Gibb et al. (1997) and modified by Abdel-Wahhab et al. (2017).
Statistical analysis
Statistical analyses were carried using SPSS 16. Data were expressed as mean ± SE. Variables were compared using one-way ANOVA; post hoc Duncan's test and the significance of differences among means were determined at p ≤ 0.05.
Results
The GC-MS results of BEEO (Table 2) revealed the isolation of 48 compounds representing 98.8 % of the oil. The eight major compounds represented 74.4% of the oil were linalool (42.1%), 1,8-Cineole (7.8%), (z)-isoeugeno (6.3%), α-trans-bergamotene (4.9%), 1-epi-cubenol (4.6%), (Z)-Anethole (3.8%), trans-muurola-4-(14),5-diene (2.6%) and €-Caryophyllene (2.3%); however, the other compounds were found in a concentration less than 2% (Table 2).
Table 2
GC/MS analysis of the composition of basil essential oil.a
No
Identified compoundb
%
1
Linalool
42.1
2
1,8-Cineole
7.8
3
(z)-isoeugeno
6.3
4
α-trans-bergamotene
4.9
5
1-epi-cubenol
4.6
6
(Z)-Anethole
3.8
7
trans-muurola-4-(14),5-diene
2.6
8
€-Caryophyllene
2.3
9
isobornyl acetate
1.9
10
α-pinene
1.7
11
Aristolochene
1.6
12
cis-sabinene hydrate
1.3
13
1,10-di-epi-cubenol
1.3
14
Santolina triene
1.1
15
allo-aromadendrene
1.1
16
β-Ylangene
1.0
17
Spathulenol
1.0
18
β-pinene
1.0
19
cis-muurola-4-(14),5-diene
0.8
20
γ-muurolene
0.8
21
α-humulene
0.7
22
iso-isopulegol
0.7
23
trans-pulegol
0.7
24
β-copaene
0.6
25
α-gurjunene
0.6
26
γ-gurjunene
0.5
27
δ-cadinene
0.5
28
cis-β-elemenone
0.4
29
γ-himalachene
0.4
30
germacrene B
0.4
31
cis-calamenene
0.4
32
neo-isopulegol
0.4
33
Aromadendrene
0.4
34
iso-borneol
0.3
35
dehydro-sabina ketone
0.3
36
iso-3-thujanol
0.2
37
thuj-3-en-10-al
0.2
38
δ-elemene
0.2
39
trans-p-menth-6-en-2,8-diol
0.2
40
trans-cadina-1,4-diene
0.2
41
Terpinolene
0.1
42
p-Cymene
0.1
43
cis-muurol-5-en-4-β-ol
0.1
44
cis-dihydrocarvone
0.1
45
(6Z)-Nonenal
0.1
46
α-ylangene
0.1
47
10-epi-cubebol
0.1
48
neo-allo-ocimene
0.1
Compound identified by GC/MS and/or by comparison of MS and LRI of standard compounds (ST) under the same conditions.
The compounds are listed according to their concentration order, Linear retention index relative to n-alkanes (C7–C20) on DB-5 column.
GC/MS analysis of the composition of basil essential oil.aCompound identified by GC/MS and/or by comparison of MS and LRI of standard compounds (ST) under the same conditions.The compounds are listed according to their concentration order, Linear retention index relative to n-alkanes (C7–C20) on DB-5 column.The characterizations of Fe-NPs and EBEO are detailed in Figure 1. The synthesized Fe-NPs showed a spherical shape (Figure 1A) with an average particle size 60 ± 4.76 nm (Figure 1B) and a zeta potential of 42.42 mV (Figure 1C). However, the synthesized EBEO showed a smooth rounded shape (Figure 1D) with an average size of 120 ± 3.2 nm (Figure 1E) and a zeta potential of -6.4 mV (Figure 1F).
Figure 1
(A) TEM image of Fe-NPs showing the particle shape and size, (B) DLS analysis showing the size distribution of Fe-NPs, (C) ZetaSizer chromatogram showing the zeta potential of Fe-NPs, (D) TEM image of EBEO showing the particle shape and size (E) DLS analysis showing particles distribution of EBEO, and (F) ZetaSizer chromatogram showing the zeta potential of EBEO.
(A) TEM image of Fe-NPs showing the particle shape and size, (B) DLS analysis showing the size distribution of Fe-NPs, (C) ZetaSizer chromatogram showing the zeta potential of Fe-NPs, (D) TEM image of EBEO showing the particle shape and size (E) DLS analysis showing particles distribution of EBEO, and (F) ZetaSizer chromatogram showing the zeta potential of EBEO.The effect of EBEO on the body weight of animals exposed to Fe-NPs and/or EBEO is presented in Figure 2. Animals treated with Fe-NPs lost weight; however, no significant change in body weight was noticed in the groups administrated EBEO (LD) or EBEO (HD) compared with the control animals. Animals administrated Fe-NPs plus EBEO gained weight and the final body weight was higher than the control but no difference was noticed between those received the low or high dose.
Figure 2
Effect of EBEO on body weight in animals treated with Fe-NPs.
Effect of EBEO on body weight in animals treated with Fe-NPs.The results of liver and kidney function (Table 3) showed that administration of Fe-NPs induced a significant increase in AST, ALT, creatinine and urea; however; TP was significantly decreased. EBEO at the two doses did induce significant effects of these parameters. The combined administration with Fe-NPs plus EBEO improved the biochemical parameters and EBEO (HD) could normalize them. Additionally, the data given in Table 4 showed that Fe-NPs administration increased (p < 0.05) cholesterol, TG and LDL and decreased (p < 0.05) HDL. Treatment with EBEO at both dose levels did not affect lipid profile parameters except HDL which was increased significantly in a dose-dependent. Co-administration of Fe-NPs plus EBEO could normalize all lipid parameters except TG level in rats treated with Fe-NPs plus EBEO (LD) which was significantly decreased compare to the control group.
Table 3
Effects of EBEO on serum biochemical parameters in rats treated with Fe-NPs.
ParameterGroups
ALT (U/L)
AST (U/L)
TP (g/dl)
Creatinine (mg/dl)
Urea (mg/dl)
Control
49.16 ± 4.23a
163.53 ± 6.04a
8.33 ± 0.41a
0.47 ± 0.03a
30.33 ± 0.67a
Fe -NPs
153.67 ± 6.53b
187.45 ± 5.86b
6.32 ± 0.27b
0.77 ± 0.03b
38.67 ± 1.20b
EBEO (LD)
47.95 ± 3.63a
162.07 ± 3.44a
8.77 ± 0.13a
0.50 ± 0.01a
31.33 ± 0.67a
EBEO (HD)
48.95 ± 5.93a
164.25 ± 2.89a
8.27 ± 0.18a
0.50 ± 0.06a
32.33 ± 1.45a
Fe-NPs + EBEO (LD)
58.58 ± 6.06c
180.60 ± 9.18c
7.64 ± 0.25c
0.51 ± 0.03a
34.67 ± 0.67c
Fe-NPs + EBEO (HD)
48.8 1 ± 1.35a
164.91 ± 5.98a
8.38 ± 0.23a
0.47 ± 0.03a
29.80 ± 0.58a
Within each column, means superscripts with different letters are significantly different (P < 0.05).
Table 4
Effects of EBEO on lipid profile parameters in rats treated with Fe-NPs.
ParameterGroups
Cholesterol (mg/dl)
TG (mg/dl)
HDL (mg/dl)
LDL (mg/dl)
Control
62.35 ± 4.39a
28.32 ± 3.0a
31.33 ± 0.33a
47.71 ± 1.88a
Fe -NPs
87.98 ± 1.96b
34.52 ± 3.86b
23.73 ± 0.92b
66.13 ± 1.90b
EBEO (LD)
63.34 ± 1.29a
26.78 ± 1.97a
44.90 ± 2.35c
46.64 ± 1.06a
EBEO (HD)
61.87 ± 1.4a
26.57 ± 2.20a
53.15 ± 1.45d
48.85 ± 0.75a
Fe-NPs + EBEO (LD)
76.63 ± 2.16a
24.94 ± 2.30c
30.47 ± 0.50a
46.72 ± 0.95a
Fe-NPs + EBEO (HD)
72.77 ± 3.80a
28.33 ± 1.83a
32.01 ± 2.91a
47.22 ± 1.12a
Within each column, means superscripts with different letters are significantly different (P < 0.05).
Effects of EBEO on serum biochemical parameters in rats treated with Fe-NPs.Within each column, means superscripts with different letters are significantly different (P < 0.05).Effects of EBEO on lipid profile parameters in rats treated with Fe-NPs.Within each column, means superscripts with different letters are significantly different (P < 0.05).The current results also revealed that AFP, TNF-α and CEA were increased (p < 0.05) in rats that administrated Fe-NPs (Table 5). EBEO did not affect these cytokines at the low or the high dose; however, co-administration of EBEO and Fe-NPs significantly improved these cytokines and could normalize TNF-α, and CEA at the high dose. Additionally, administration of Fe-NPs induced oxidative damage in the renal and hepatic tissue as manifested by the significant increase of hepatic MDA and NO (Table 6). Treatment with EBEO (LD) or EBEO (HD) did not affect NO or MDA in both organs except NO in the kidney which was higher than the control level. The combined treatment restored this elevation of MDA and NO and EBEO (LD) could normalize renal NO and hepatic MDA; however, EBEO (HD) could normalize hepatic and renal NO, hepatic MDA and decreased renal MDA than the untreated control group. The results of hepatic and renal antioxidant enzyme activity (Table 7) indicated that Fe-NPs decreased (p < 0.05) hepatic and renal GPx, CAT, and SOD. Treatment with EBEO (LD) did not induce a significant effect on these enzymes; however, EBEO (HD) increased hepatic GPx, CAT and SOD and only SOD in both organs compared with the untreated control group. Co-administration of Fe-NPs plus EBEO succeeded to improve these antioxidant enzymes in both tissues since the low dose could normalize renal CAT and the high dose could normalize hepatic and renal CAT and hepatic SOD.
Table 5
Effects of EBEO on tumor markers in rats treated with Fe-NPs.
ParameterGroups
AFP (ng/ml)
TNF-α (ng/ml)
CEA (ng/ml)
Control
0.02 ± 0.01a
0.30 ± 0.04a
2.57 ± 0.23a
Fe-NPs
0.42 ± 0.01b
0.42 ± 0.04b
4.77 ± 0.26b
EBEO (LD)
0.02 ± 0.01a
0.31 ± 0.02a
2.23 ± 0.15a
EBEO (HD)
0.02 ± 0.01a
0.31 ± 0.01a
2.63 ± 0.22a
Fe-NPs + EBEO (LD)
0.28 ± 0.03c
0.33 ± 0.01c
3.30 ± 0.12c
Fe-NPs + EBEO (HD)
0.06 ± 0.02d
0.31 ± 0.01a
2.25 ± 0.21a
Within each column, means superscripts with different letters are significantly different (P < 0.05).
Table 6
Effects of EBEO on hepatic and real No and MDA in rats treated with Fe-NPs.
ParameterGroups
NO (μmol/g tissue)
MDA (nmol/g tissue)
Liver
Kidney
Liver
Kidney
Control
2.01 ± 0.15a
1.99 ± 0.07a
44.87 ± 2.07a
92.48 ± 1.69a
Fe -NPs
6.01 ± 0.40b
3.54 ± 0.25b
78.84 ± 2.42b
145.51 ± 13.16b
EBEO (LD)
2.03 ± 0.05a
2.26 ± 0.20c
43.63 ± 1.50a
101.27 ± 2.22a
EBEO (HD)
2.02 ± 0.40a
2.21 ± 0.18c
44.46 ± 2.40a
104.96 ± 2.46a
Fe-NPs + EBEO (LD)
3.13 ± 0.09c
2.12 ± 0.07a
46.07 ± 1.89a
85.34 ± 2.35c
Fe-NPs + EBEO (HD)
2.05 ± 0.12a
2.02 ± 0.10a
42.44 ± 2.20a
84.23 ± 1.36c
Within each column for each organ, means superscripts with different letters are significantly different (P < 0.05).
Table 7
Effects of EBEO on hepatic and renal antioxidant enzymes in rats treated with Fe-NPs.
ParameterGroups
GPx (U/g)
CAT (mU/g)
SOD (U/g)
Liver
Kidney
Liver
Kidney
Liver
Kidney
Control
320.78 ± 2.21a
219.00 ± 0.88a
9.44 ± 0.05a
9.68 ± 0.08a
36.77 ± 0.90a
34.79 ± 2.37a
Fe -NPs
128.28 ± 2.95b
111.47 ± 0.14b
6.38 ± 0.27b
7.55 ± 0.13b
21.91 ± 1.28b
14.64 ± 1.84b
EBEO (LD)
326.27 ± 3.48a
218.71 ± 1.68a
9.52 ± 0.13a
9.40 ± 0.14a
37.43 ± 1.56a
39.01 ± 0.32a
EBEO (HD)
331.96 ± 1.30c
222.59 ± 1.76a
10.79 ± 0.10c
9.56 ± 0.05a
42.89 ± 0.79c
39.14 ± 1.20c
Fe-NPs + EBEO (LD)
216.76 ± 3.54d
144.79 ± 0.66c
8.18 ± 0.29d
9.22 ± 0.01a
29.26 ± 1.95d
24.84 ± 0.54d
Fe-NPs + EBEO (HD)
219.46 ± 2.58d
147.54 ± 0.07c
9.01 ± 0.06a
9.31 ± 0.04a
36.54 ± 0.77a
27.68 ± 0.52d
Within each column, means superscripts with different letters are significantly different (P < 0.05).
Effects of EBEO on tumor markers in rats treated with Fe-NPs.Within each column, means superscripts with different letters are significantly different (P < 0.05).Effects of EBEO on hepatic and real No and MDA in rats treated with Fe-NPs.Within each column for each organ, means superscripts with different letters are significantly different (P < 0.05).Effects of EBEO on hepatic and renal antioxidant enzymes in rats treated with Fe-NPs.Within each column, means superscripts with different letters are significantly different (P < 0.05).To clarify these changes in the antioxidant enzymes, their relevant hepatic mRNA expression profile was examined using RT-qPCR (Figure 3). The results revealed that Fe-NPs induced a significant down-regulation in mRNA gene expression of GPx (Figure 3A), Cu–Zn SOD (Figure 3B) and CAT (Figure 3C) in hepatic tissues. EBEO alone did not induce any notable alterations in the expression of these genes. However, co-administration of EBEO plus Fe-NPs resulted in the up-regulation of mRNA expression and the declined expression was improved towards the level of the control group. Furthermore, no significant differences were noticed between the high or low-dose treated groups.
Figure 3
Effect of EBEO on relative expression of (A) GPx, (B) SOD and (C) CAT gene in liver of rats treated with Fe-NPs. Analyses were performed in triplicate. Data are the mean ± SE of three different liver samples in same group. Means within columns carrying different superscript letters are significantly different at P ≤ 0.05.
Effect of EBEO on relative expression of (A) GPx, (B) SOD and (C) CAT gene in liver of rats treated with Fe-NPs. Analyses were performed in triplicate. Data are the mean ± SE of three different liver samples in same group. Means within columns carrying different superscript letters are significantly different at P ≤ 0.05.The present results showed that Fe-NPs increased significantly DNA fragmentation percentage (Table 8). However, insignificant difference was observed in DNA fragmentation of the normal control animals and those treated with EBEO. The co-treatment with EBEO (LD) or (HD) plus Fe-NPs reduced significantly the percent of DNA fragmentation compared with the Fe-NPs alone-treated group. The inhibition percent of DNA fragmentation reached 32.7 and 44.9% in the groups received the EBEO (LD) and (HD), respectively. As presented in Figure 4, the results of agarose gel electrophoresis of DNA confirmed the other results of colorimetric assays of DNA fragmentation and the antioxidant status, and corroborated the changed levels of the gene transcripts. The liver samples of rats administrated Fe-NPs showed a smear (hallmark of necrosis), DNA fragmentation without ladder formation, indicating random DNA degradation (Figure 4, Lane 2) compared with the control (Figure 4, Lane 1) and the EBEO-treated groups (Figure 4, Lanes 3 and 4). Treatment with EBEO at both dose levels markedly suppressed DNA fragmentation in rats received Fe-NPs (Figure 4, Lanes 5 and 6); where DNA was still localized at the starting point. Moreover, there was no significant difference between the DNA electrophoretic patterns of the EBEO-treated rats and the control groups.
Table 8
Effect of EBEO on DNA fragmentation in the liver of rats treated with Fe-NPs.
Treatment
DNA fragmentation %
DNA fragmentation inhibition %
Control
9.8 ± 0.1a
Fe -NPs
24.5 ± 0.76c
EBEO (LD)
10.4 ± 0.31a
EBEO (HD)
9.6 ± 0.35a
Fe-NPs + EBEO (LD)
16.5 ± 0.61b
32.7
Fe-NPs + EBEO (HD)
13.5 ± 0.87b
44.9
Means superscripts with different letters are significantly different (P < 0.05).
Figure 4
Agarose gel electrophoresis of extracted DNA from liver of rats treated with Fe-NPs alone or plus EBEO at low and high dose. These results confirmed that treatment with EBEO attenuates Fe-NPs-induced hepatotoxicity in rats. Lane M, 100 bpDNA ladder; Lane 1 untreated control group; Lane2, Fe-NPs-treated group; Lane3, EBEO (LD)-treated group, lane 4, EBEO (HD); Lane 5, EBEO (LD) plus Fe-NPs-treated group and lane 6, EBEO (HD) plus Fe-NPs-treated group.
Effect of EBEO on DNA fragmentation in the liver of rats treated with Fe-NPs.Means superscripts with different letters are significantly different (P < 0.05).Agarose gel electrophoresis of extracted DNA from liver of rats treated with Fe-NPs alone or plus EBEO at low and high dose. These results confirmed that treatment with EBEO attenuates Fe-NPs-induced hepatotoxicity in rats. Lane M, 100 bpDNA ladder; Lane 1 untreated control group; Lane2, Fe-NPs-treated group; Lane3, EBEO (LD)-treated group, lane 4, EBEO (HD); Lane 5, EBEO (LD) plus Fe-NPs-treated group and lane 6, EBEO (HD) plus Fe-NPs-treated group.The histological study of the liver in the untreated control group showed normal architecture with a classic hepatic lobule-containing central vein and radiating cords of hepatocytes with blood sinusoids in between, polyhedral hepatocytes with large and rounded vesicular nuclei. The blood sinusoids are presented between the cords of the hepatic cells and are lined by flattened endothelial and Kupffer cells (Figure 5A). The liver of animals in the Fe-NPs group showed hepatocytes vacuolar degeneration with pyknotic nuclei congested and enlarged portal vein and hyperplasia of the bile duct with periportal lymphocytic infiltration and fibrous tissues (Figure 5B). The liver of rats received EBEO (LD) showed normal hepatocytes around the central vein zone with remarkable hepatocellular vacuolar degeneration and nuclear pyknosis around the congested portal tract (Figure 5C). Moreover, the rats that received EBEO (HD) showed semi normal hepatocytes around the normal central vein a) and around the dilated and congested portal tract with hyperplasia in bile ducts lobules (Figure 5D). The examination of hepatic sections of rats treated with Fe-NPs plus EBEO (LD) showed no remarkable changes in hepatocytes and their blood vessels histological architecture (Figure 5E). Furthermore, the rats that received Fe-NPs plus EBEO (HD) showed marked improvement in hepatocytes histological architecture and a marked decrease in inflammatory cells (Figure 5F).
Figure 5
Photomicrographs of liver sections of: (A) control group showing normal liver architecture, a classic hepatic lobule-containing central vein (cv) and radiating cords of hepatocytes with blood sinusoids in between (arrow), polyhedral hepatocytes with large, rounded vesicular nuclei (arrow), blood sinusoids (s) are present in between the cords of hepatocytes and are lined by flattened endothelial cells and Kupffer cells; (B) rats treated with Fe-NPs showing hepatocytes vacular degeneration with pyknotic nuclei (arrow & inset), congested and enlarged portal vein (CG) and hyperplasia of bile duct (BL) with periportal lymphocytic infiltration and fibrous tissues; (C) rats treated with EBEO(LD) showing (a) normal hepatocytes around the central vein zone while remarkable hepatocelular vacuolar degeneration and nuclear pyknosis around the congested portal tract are seen; (D) rats treated with EBEO (HD) showing nearly normal hepatocytes around the normal central vein and around the dilated and congested portal tract with a hyperplasia in bile ducts lobules; (E) rats treated with Fe-NPs plus EBEO(LD) showing no remarkable changes in hepatocytes and their blood vessels with normal histological architecture and (F) rats treated with Fe-NPs plus EBEO(HD) showing marked improvement in hepatocytes histological architecture and marked decrease in inflammatory cells.
Photomicrographs of liver sections of: (A) control group showing normal liver architecture, a classic hepatic lobule-containing central vein (cv) and radiating cords of hepatocytes with blood sinusoids in between (arrow), polyhedral hepatocytes with large, rounded vesicular nuclei (arrow), blood sinusoids (s) are present in between the cords of hepatocytes and are lined by flattened endothelial cells and Kupffer cells; (B) rats treated with Fe-NPs showing hepatocytes vacular degeneration with pyknotic nuclei (arrow & inset), congested and enlarged portal vein (CG) and hyperplasia of bile duct (BL) with periportal lymphocytic infiltration and fibrous tissues; (C) rats treated with EBEO(LD) showing (a) normal hepatocytes around the central vein zone while remarkable hepatocelular vacuolar degeneration and nuclear pyknosis around the congested portal tract are seen; (D) rats treated with EBEO (HD) showing nearly normal hepatocytes around the normal central vein and around the dilated and congested portal tract with a hyperplasia in bile ducts lobules; (E) rats treated with Fe-NPs plus EBEO(LD) showing no remarkable changes in hepatocytes and their blood vessels with normal histological architecture and (F) rats treated with Fe-NPs plus EBEO(HD) showing marked improvement in hepatocytes histological architecture and marked decrease in inflammatory cells.The examination of control kidney sections showed normal histology of glomeruli and proximal and distal convoluted tubules (Figure 6A). The kidney of rats exposed to Fe-NPs showed the different distribution of histological changes including necrosis in renal tubules and cellular debris in their lumen (N) and damaged glomeruli (D-G) interstitial dilation with inflammatory cellular and hemorrhagic spaces (Figure 6B). The kidney of rats received EBEO (LD) or EBEO (HD) showed a different distribution of histological structure where the renal tubules and glomeruli mesangial cells are nearly normal and interstitial spaces of inflammatory cells (Figure 6C). The kidney of the rats received Fe-NPs plus EBEO (LD) showed showing marked improvement in renal tubules and glomeruli cellularity (Figure 6D). The kidney of the rats in the Fe-NPs plus EBEO (HD) group showed a different distribution of nearly normal renal tubules and interstitial congestion and inflammatory cells (Figure 6E). Moreover, the same group showed deformed glomeruli with wide urinary spaces, shrinking in mesangial cells and some necrosis in the renal tubular epithelium, focal congestion and inflammation, and some tubules epithelial cells were damaged (Figure 6F).
Figure 6
Photomicrograph of kidney sections of (A) control rats showing normal histology of glomeruli (F), renal tubules proximal (PT) and distal (DT) convoluted tubules; (B) rats treated with Fe-NPs showing different distribution of histological changes in the form of necrosis in renal tubules and cellular debris in their lumen (N) and damaged glomeruli (D–F) interstitial dilation with inflammatory cellular and haemohrrageic spaces (arrow); (C) rats treated with EBEO (LD) showing different distribution of histological structure where the renal tubules and glomeruli mesangial cells are nearly normal with interstitial spaces of inflammatory cells (arrow); (D) rats treated with EBEO (HD) showing different distribution of nearly normal renal tubules and interstitial congestion and inflammatory cells also seen (arrow); (E) rats treated with Fe-NPs plus EBEO (LD) showing marked improvement in renal tubules and glomeruli cellularity, and (E) rats treated with Fe-NPs plus EBEO (HD) showing deformed glomeruli with wide urinary spaces, shrinking in mesangial cells and some necrosis in renal tubular epithelium (F). Focal congestion and inflammation, some tubule s epithelial cells are damaged (arrow).
Photomicrograph of kidney sections of (A) control rats showing normal histology of glomeruli (F), renal tubules proximal (PT) and distal (DT) convoluted tubules; (B) rats treated with Fe-NPs showing different distribution of histological changes in the form of necrosis in renal tubules and cellular debris in their lumen (N) and damaged glomeruli (D–F) interstitial dilation with inflammatory cellular and haemohrrageic spaces (arrow); (C) rats treated with EBEO (LD) showing different distribution of histological structure where the renal tubules and glomeruli mesangial cells are nearly normal with interstitial spaces of inflammatory cells (arrow); (D) rats treated with EBEO (HD) showing different distribution of nearly normal renal tubules and interstitial congestion and inflammatory cells also seen (arrow); (E) rats treated with Fe-NPs plus EBEO (LD) showing marked improvement in renal tubules and glomeruli cellularity, and (E) rats treated with Fe-NPs plus EBEO (HD) showing deformed glomeruli with wide urinary spaces, shrinking in mesangial cells and some necrosis in renal tubular epithelium (F). Focal congestion and inflammation, some tubule s epithelial cells are damaged (arrow).
Discussion
The GC-MS analysis of BEO showed the isolation of 48 compounds and Linalool, 1,8-Cineole, (z)-isoeugeno, α-trans-bergamotene, 1-epi-cubenol, (Z)-Anethole, trans-muurola-4-(14),5-diene and €-Caryophyllene besides some other compounds were found in a concentration less than 2%. These results are similar to the recent report by Amor et al. (2021) and Benedec et al. (2013) who showed that linalool was the major compound in BEO. However, Olugbade et al. (2017) reported that methyl eugenol was the major compound followed by methyl chavicol and Ghasemi Pirbalouti et al. (2017) reported that methyl chavicol is the major compound followed by linalool. The percentage of the major components varied according to geographical origin (Ahmed et al., 2019; Diniz do Nascimento et al., 2020).The synthesized EBEO showed a smooth round shape with an average particle size of 120 nm and a zeta potential of -6.4 mV suggesting that WPI enhanced the droplet coalescence (Goula and Adamopoulos, 2012). Moreover, the uniform size distribution of oil droplets and the smooth round shape indicated the formation of a droplet wall material by WPI (Noello et al., 2016; Eratte et al., 2014). A previous study reported that the shape, surface property and size of the nanoparticles have a pivotal role in the uptake of nanosized particles by the cells and the size between 50-300 nm has a favorable uptake than the counterparts (Roger et al., 2010). Besides, the size of nanoparticles affects the distribution, clearance and pharmacokinetics (Sadat et al., 2016). Furthermore, zeta potential plays an important role in the distribution of the droplets and increases their stability (McClements and Rao, 2011). The -ve zeta potential reported herein for the NEBO is attributed to the negative charge of carboxylate groups in WPI which is the only functional charge in the globulars of WPI (Eratte et al., 2014). Further, the addition of basil leaves extracts to FeSO4 resulted in the synthesis of Fe-NPs. This indicated that basil leaves extract acted as a reducing agent in the synthesis process of Fe-NPs. In previous work, Hafiz et al. (2018) synthesized different shapes of Fe-NPs e.g. spikes, rod shape, spherical and cube using the extract of Spinacia oleracea leaves with particle size range from 100-205 nm. The variation in size and morphology of nanoparticles synthesized from different metal ions using plant extracts significantly affect their electronic, chemical and physical properties (Khan et al., 2019). The formation of Fe-NPs in the current study may be due to the ability of different metabolites in the basil extract including the polyphenols, terpenoids, alkaloids, sugars, proteins and phenolic acids which play a vital role in the bioreduction of the metal ions resulting in heterogeneous shapes and sizes of nanoparticles (Bibi et al., 2019; Fahmy et al., 2018; Hafiz et al., 2018). The zeta potential value reported herein for Fe-NPs was 42.42 mV suggested that the synthesized Fe-NPs are stable. In this concern, previous reports revealed that zeta potential over 60 mV indicates excellent stability, zeta potential above 30 mV and below 20 mV indicate physical and limited stability, respectively; however, zeta potential lower than 5 mV are the index of agglomeration (Mahbubul, 2019).In this investigation, we evaluated the effect of subchronic oral administration of Fe-NPs on liver and kidney and the possible protective role of EBEO in rats. The selected dose of Fe-NPs and EBEO were based on the literature (Kulkarni et al., 2020; Yacout et al., 2012, respectively). Our results showed that treatment with Fe-NPs induced significant effects on body weight, liver and kidney parameters, serum cytokines, lipid profile accompanied by an elevation of oxidative markers and the decrease of antioxidant enzyme activity in the liver and kidney.Administration of Fe-NPs increased in ALT, AST, and decreased the level of TP. The elevated in these enzymes suggested that Fe-NPs cause hepatic injury or necrosis (Nasrin et al., 2018) and altered the permeability of the hepatocellular membrane (Mohamed et al., 2015; Ates et al., 2016). In this concern, Sadauskas et al. (2007) and Bao et al. (2015) demonstrated that Fe-NPs are taken up by the hepatocytes and Kupffer cells (specialized macrophages located in the liver). Fe-NPs are degraded Fe+2 and Fe+3 products that are incorporated into the storage or utilization pathways (e.g. hemoglobin, ferritin, and transferrin). In contrast, Parivar et al. (2016) reported that oral administration of Fe-NP significantly reduced the activity of ALT, AST, and LDH. Taken together, the obtained data imply that conventional serum biochemical assessments should be cautiously used in safety evaluations of NMs (Garcia-Fernandez et al., 2020).Creatinine and urea are the indices for renal function and they increase during kidney dysfunction. The increase in kidney indices in the Fe-NPs-treated group proposed that these particles affect the filtration rate of the glomerular and the ability of the kidney to induce blood filtration (Du et al., 2018; Mohammed et al., 2020). Moreover, the decreased level of total protein suggested liver necrosis and/or protein catabolism escort kidney dysfunction (Abdel-Wahhab et al., 2007; Parivar et al., 2016; Nasrin et al., 2018). Treatment with Fe-NPs increased cholesterol, TG, LDL, and decreased HDL suggesting dyslipidemia. Dyslipidemia is considered a high-risk factor for coronary heart diseases (Litvinov et al., 2012). Consequently, the present results suggested that Fe-NPs are probably responsible for the disturbances in the lipid metabolism and atherosclerosis with cardiovascular disease risk (Litvinov et al., 2012). In this concern, Nemmar et al. (2016) reported that Fe-NPs increase CK-MB levels in the heart and plasma tissues. Also, Shen et al. (2015) demonstrated that Fe-NPs attack the myocardium muscles inducing myocardial iron overload, resulting in myocardial injury and deterioration of cardiac function (Nasrin et al., 2018).The reduction in GPx, CAT, and SOD and their mRNA gene expression in hepatic and renal tissue of rats after Fe-NPs administration and the elevation of MDA and NO indicated the occurrence of oxidative damage in both liver and kidney. According to Zhu et al. (2017), MDA is the main degradation product of the peroxidation of lipid; whereas, NO is critical free radical which induces severe damage to cells when produced excessively in the tissues or serum (Birben et al., 2015). Therefore, the oxidative damage of Fe-NPs may lead to enzymatic degradation in lysosome due to high acidic environment and release Fe+2 which react with H2O2 in mitochondria induces production of ROS such as hydroxyl particles through Fenton reaction (Chen 2019; Toyokuni, 2009). Moreover, ROS lead to mitochondrial damage, lipid peroxidation, or protein oxidation, which can then induce a cascade of Ca2-dependent signaling mechanisms resulting in cell death (Soenen et al., 2012).One of the principal mechanisms of Fe-NPs-induced toxicity is the generation of ROS that resulted in oxidative stress. Oxidative stress is the subsequent production of inflammatory mediators and DNA damage (Helm and Rudel, 2020). In this concern, Toyokuni (2009) suggested that Fe-NPs increase ROS, MDA and decrease GPx, SOD, and CAT and their mRNA expression as a mechanism of liver damage. Moreover, Fe-NPs caused membrane damage, leakage of lactate dehydrogenase, reduction in SOD, and CAT activity (Hasanuzzaman et al., 2020). These results agree with the previous study of Arbab et al. (2005). Taken together, the decreased of antioxidants levels and the increased MDA and NO levels confirmed that Fe-NPs induce the generation of ROS which include hydrogen peroxide, hydroxyl radicals, and superoxide anions, thus causing oxidative stress and disrupt the antioxidant system, resulting in membrane lipid peroxidation, oxidation of the enzymes and structural proteins, DNA damage, and cell death (Toyokuni, 2009; Singh et al., 2010). Additionally, Rim et al. (2013) and Yousef et al. (2019) reported that nanoparticles induce oxidative DNA damage not only through corrosion and the release of metal ions, but also as a result of chronic inflammatory responses.The current results also showed that Fe-NPs administration increased the serum AFP, TNF-α, and CEA suggested the disturbance of the immune system. Previous reports revealed that macrophages are the most AFP, TNF-α, and CEA producers and these markers are playing a critical role in tumor conditions (Aldubayan et al., 2019). TNF-α is an important factor in the promotion of tumors (Choi et al., 2010). It is also considered a key factor in the regulation of several cytokines production responsible for the chronic inflammation and the development of tumor via the NF-kB pathway (Karabela et al., 2011). Generally, the increased level of MDA, NO, AFP, TNF-α, and CEA and the decreased in GPx, CAT and SOD and their corresponding gene expression revealed that the toxicity of Fe-NPs is mainly via the production of ROS and inflammation (Reddy et al., 2017; Soenen et al., 2012).Another mechanism of Fe-NPs-induced toxicity is the accumulation of these particles in the cytoplasm leading to damage of mitochondria, disruption in ATP synthesis, and Ca2+ buffering. When the iron entrance to the mitochondria, it is used in heme and Fe–S cluster synthesis or stored by mitochondrial ferritin. Excess Fe+2 in the mitochondria altered the permeability causing Ca2+ and cytochrome C release into the cytoplasm and result in apoptosis activation (Sripetchwandee et al., 2016). Moreover, the increase of free iron concentration within the cell stimulates OH production via the Fenton-like reaction due to mobilization of Fe2+ by Ca2+ resulting in further cell damage suggesting other mechanisms of Fe-NPstoxicity (Malvindi et al., 2014). The histological study of liver and kidney sections in rats in the Fe-NPs group showed severe histological changes typical to those reported in the previous studies (Talesh et al., 2019). These findings confirmed the biochemical results of the current study and supported that Fe-NPs administration induced hepato-nephrotoxicity mainly through the generation of oxidative damage and the immunodeficiency response.Several reports demonstrated that the main constituents of O. basilicum essential oil were linalool and the methyl chavicol (Avetisyan et al., 2017; Theodosiou et al., 2014). Previously, the protective role of linalool against oxidative DNA damage has been evaluated with alkaline Comet assay on S. cerevisiae (Nikolić et al., 2019). Encapsulation as a promising technique manages a controlled release and boosted the stability and bioavailability of bioactive compounds/drugs (Liang et al., 2012; Donsi et al., 2012). Animals treated with EBEO alone at both dose levels were comparable with the control however, the combined treatments with Fe-NPs plus EBEO showed a protective against Fe-NPstoxicity. Most of the tested parameters showed significant improvement towards the control values and the high dose was more effective. Similar results were stated by Rafael et al. (2018), Ahmed et al. (2019) who showed the higher antioxidant property of linalool. Moreover, linalool act as pro-oxidants and induce DNA strand breaks (Tamoghna et al., 2018) and decreased ROS production.Huo et al. (2013) showed that linalool reduces the production of IL-6 and TNF-α induced by LPS in vitro and in vivo; block phosphorylation of IkBa protein, c-Jun terminal kinase, p38 and extracellular signal-regulated kinase. Moreover, another study suggested that it's beneficial for the treatment of kidney damage in diabetic subjects through the attenuation of TGF-b1 and NF-kB expression (Deepa and Venkatraman Anuradha, 2013). Additionally, linalool act on inflammatory by preventing pro-inflammatory factors secretion via the decrease of lipopolysaccharide (LPS)/D-galactosamine (GalN)-induced liver injury in mice through inhibition of the expression of caspase-8 and caspase-3 and the elimination of inflammatory response via NF-kB suppression (Li et al., 2014; De Andrade et al., 2017).Moreover, the Cis-verbenol another phytochemical constituent of the essential oil of O. basilicum has been anti-inflammatory property via the suppression of pro-inflammatory cytokines expression levels in the ischemic brain and immune stimulated glial cells (Rashidian et al., 2016). Also, phenolicthymol and Cis-verbenol were found to induce the high antioxidative effect of LDL and decrease plasma levels of TG and cholesterol with no adverse effects in kidneys or liver (Ebenyi et al., 2012). These compounds also are important free radicals scavengers’ natural products and possess antioxidant properties (Ebenyi et al., 2012). In addition, EBEO increases the levels of other natural antioxidants in the body, such as SOD and CAT which protect the liver from PAR-induced hepatotoxicity (El-Banna et al., 2013). The mechanisms postulated to BEO as antioxidants including (1) scavenging of ROS; (2) chelation of iron which initiates radical reactions and inhibition of enzymes responsible for the generation of ROS (Edenharder and Gruñhage, 2003); (3) antioxidants can interfere with xenobiotic-metabolizing enzymes, block activated mutagens/carcinogens, modulate DNA repair and even regulate gene expression (Paramasivan et al., 2019). All these mechanisms may be important for their antimutagenic and anticarcinogenic properties (De Flora and Ferguson, 2005). In the present study, whey protein (WP) was used as wall material in the encapsulation of the essential oil; hence, we can suggest another mechanism for EBEO-induced protection. WP is a well-known antioxidant and hepatoprotective agent (Gad et al., 2011) due to its high content of amino acids cysteine, α-lactoglobulin, bovine serum albumin, and β-lactoglobulin (Minj and Anand, 2020). Generally, the protective and antimutagenic activity of EBEO is mainly attributed to the antioxidative properties of different phenolic components in the oil.
Conclusion
The present work indicated that spherical shape Fe-NPs with an average particle size of 60 ± 4.76 nm and zeta potential of 42.42 mV can be synthesized by green chemistry using basil leave extract. The encapsulated basin essential oil using WPI resulted in an average capsule size of 120 ± 3.2 nm and a zeta potential of -6.4 mV. The GC-Ms data revealed the identification of 48 compounds in the basin essential oil and the major compounds were Linalool, 1,8-Cineole, (z)-isoeugeno, α-trans-bergamotene, 1-epi-cubenol, (Z)-Anethole, trans-muurola-4-(14),5-dieneand €-Caryophyllene. The in vivo results showed that Fe-NPs induced significant toxic effects as manifested by the alterations in the biochemical parameters related to liver and kidney function. Fe-NPs increased oxidative damage markers, cytokines and decreased the activity of antioxidant enzymes and their corresponding gene expression and induced histological alterations in liver and kidney. Additionally, these particles increased the hepatic DNA fragmentation. EBEO did not induce any notable changes although it enhances the antioxidant capacity, especially at the high dose. EBEO could mitigate Fe-NPstoxicity and the higher dose succeeded to normalize almost all the tested parameters. The current results concluded that EBEO is a promising agent can be used safely in food or pharmaceutical application for the protection against Fe-NPs.
Declarations
Author contribution statement
Aziza A. El-Nekeety; Marwa E Hassan; Rasha R. Hassan; Ola I Elshafey; Zeinab K. Hamza; Sekena H. Abdel-Aziem; Nabila S. Hassan: Performed the experiments; Analyzed and interpreted the data; Contributed reagents, materials, analysis tools or data.Mosaad A. Abdel-Wahhab: Conceived and designed the experiments; Wrote the paper.
Funding statement
This work was supported by the National Research Centre, Dokki, Cairo, Egypt project #12050305.
Data availability statement
Data will be made available on request.
Declaration of interests statement
The authors declare no conflict of interest.
Additional information
No additional information is available for this paper.
Authors: Mahmoud A O Dawood; Mohammed F El Basuini; Amr I Zaineldin; Sevdan Yilmaz; Md Tawheed Hasan; Ehsan Ahmadifar; Amel M El Asely; Hany M R Abdel-Latif; Mahmoud Alagawany; Nermeen M Abu-Elala; Hien Van Doan; Hani Sewilam Journal: Pathogens Date: 2021-02-09
Authors: Mosaad A Abdel-Wahhab; Aziza A El-Nekeety; Hagar E Mohammed; Tamer M El-Messery; Mohamed H Roby; Sekena H Abdel-Aziem; Nabila S Hassan Journal: Heliyon Date: 2021-11-24