Literature DB >> 34280647

Effects of Lactobacillus acidophilus on the growth performance, immune response, and intestinal barrier function of broiler chickens challenged with Escherichia coli O157.

Zhengke Wu1, Kexin Yang1, Anrong Zhang1, Wenhuan Chang1, Aijuan Zheng1, Zhimin Chen1, Huiyi Cai2, Guohua Liu3.   

Abstract

We studied the effects of Lactobacillus acidophilus (L. acidophilus) on the growth performance, intestinal morphology, barrier function, and immune response of broilers challenged with Escherichia coli O157 (E. Coli). A total of 360 1-day-old Cobb male broilers were tested in a 3 × 2 factorial arrangement with 3 dietary L. acidophilus levels (0, 5 × 108 CFU/kg, and 10 × 108 CFU/kg of diet) and 2 disease challenge treatments (control or E. coli challenged). Results showed that E. coli challenge decreased the ADG, ADFI, and BW of broilers from 15 to 21 d (P < 0.05), increased the jejunum intestinal wall thickness, and significantly increased the mortality rate. E. coli challenge significantly (P < 0.05) decreased the serum IgA and IgM contents and peripheral blood CD3+ T cell counts (P < 0.05), increased the serum CRP, DAO, and LPS levels at 21 d; upregulated the mRNA expression of iNOS, IL-8, IL-1β in the jejunum and iNOS in the spleen, and downregulated the occludin and ZO-1 mRNA expression in the ileum at 21 d compared with uninfected birds (P < 0.05). Dietary L. acidophilus supplementation consistently showed higher BW, ADG, ADFI, and jejunum and ileum V:C ratio at 14 d and 21 d in the presence and absence of E. coli challenge (P < 0.05). L. acidophilus supplementation reduced the mortality rate caused by E. coli challenge (P < 0.05), decreased the serum CRP, DAO, and LPS levels at 14 d and 21 d; upregulated the mRNA expression of occludin and ZO-1 in the jejunum and ileum, and downregulated the mRNA expression of iNOS, IL-8, and IL-1β in the jejunum in E. coli challenged birds at 21 d (P < 0.05). Dietary supplementation with L. acidophilus can improve the growth performance, intestinal health, and survival of broilers challenged with E. coli.
Copyright © 2021 The Authors. Published by Elsevier Inc. All rights reserved.

Entities:  

Keywords:  Escherichia coli; Lactobacillus acidophilus; broiler; intestinal barrier function

Year:  2021        PMID: 34280647      PMCID: PMC8319008          DOI: 10.1016/j.psj.2021.101323

Source DB:  PubMed          Journal:  Poult Sci        ISSN: 0032-5791            Impact factor:   3.352


INTRODUCTION

Escherichia coli () infection is common in commercial animal breeding situations on a world basic (Reda et al., 2019). In poultry, E. coli infection causes severe health issues and reduces production (Landman et al., 2015; Ronco et al., 2017). Infected chickens and contaminated poultry meat or eggs are important carriers of E. coli, which is a threat to human health. E. Co, 51li O157 is a common serotypes of E. coli bacteria reported worldwide. It is important to control E. coli outbreaks in the poultry industry. For many decades, antibiotics have typically been used to prevent infections of E. coli and other pathogens in animals and humans (Kabir and Lutful, 2009). However, excessive use of antibiotics in animal feed has increased the number of drug-resistant pathogen strains. This has led to animals harboring these strains being reservoir hosts of antibiotic resistance genes (Gao et al., 2017). The intestinal microbiota of domestic animals might then be a reservoir for resistance genes in pathogens that may be transmitted to humans (Smet et al., 2011). Many countries have banned the use of antibiotics in animals feed as growth promoters (Cogliani et al., 2011). The European Union-wide ban on the use of antibiotic growth promoters in farm animals in 2006 was an initial step in dealing with the antibiotic resistance issue. In China, the use of antibiotics as growth promoters has been banned since July 1, 2020. Enteric diseases have seen become a prime concern in the poultry industry after the exclusion of antibiotics. To maintain a healthy intestinal status and improve animal growth without using antibiotics, there are growing demands for safe, effective, and economical antibiotic alternatives. Probiotics are nonpathogenic, microorganisms that have a beneficial effect on the growth performance, immune function, intestinal microbiology or physiology of the host when administered in adequate amounts (Gill, 2008; Hou et al., 2016). Probiotics can be provided as a live microbial feed supplement, also known as direct fed microbials, in the poultry diet or administered to the developing embryo using in vivo feeding technology (Pender et al., 2016). The addition of probiotics to poultry feed has been studied to improve nutrient digestibility and absorption, modulate the intestinal microbiota balance, keep the intestinal tract healthy, improve the immune response, and relieve stress (Patterson and Burkholder, 2003; Revolledo et al., 2006; Prado-Rebolledo et al., 2016; Li et al., 2018). These studies demonstrated that probiotics may provide a potential alternative strategy to the use of antibiotics in poultry feed. Lactobacillus acidophilus () is a species of gram positive bacteria in the genus Lactobacillus and is widely used as a probiotic for humans and animals (Li et al., 2018). L. acidophilus can inhibit pathogen invasion (Lin et al., 2008) and modulate immunity response in vitro and and in vivo (Lin et al., 2010). L. acidophilus can produce bacteriostatic bacteriocin-like compounds as well as acids which decrease the gut pH (Chateau et al., 2010). Adding L. acidophilus to poultry feed helps prevent the proliferation of pathogenic bacteria and regulates the intestinal flora through competitive exclusion and antagonism (Fuller, 1989; Frece et al., 2009). These studies demonstrated that L. acidophilus has the potential to control animal pathogens. However, it is unclear whether dietary L. acidophilus supplementation can improve the intestinal health and growth performance of broilers in an E. coli challenge model. Therefore, our objective was to evaluate the efficacy of L. acidophilus in controlling E. coli infection in broiler chickens by determining its effect on growth performance, intestinal morphology, immune responses, and cytokine mRNA expression.

MATERIALS AND METHODS

Animal Ethics Statement

All animal management and experimental procedures for this study were approved by the Animal Ethic Committee of the Chinese Academy of Agricultural Sciences and performed according to the guidelines for animal experiments set by the National Institute of Animal Health.

Experimental Design and Animal Management

A 3 × 2 factorial arrangement of treatments was used in a completely randomized design to investigate the effects of 3 levels of L. acidophilus supplementation (0, 5 × 108 CFU/kg, and 10 × 108 CFU/kg of diet) and 2 disease treatments (control or E. coli challenged). A total of 360 one-day-old Cobb male broilers were allocated to 6 treatments in a completely randomized design ensuring the average body weight was the same for all the treatments. The 6 treatment groups were as follows: group 1, control diet, uninfected; groups 2 and 3, L. acidophilus supplemented diet (5 × 108 CFU/kg and 10 × 108 CFU/kg of diet), uninfected; group 4, control diet, infected with E. coli; groups 5 and 6, L. acidophilus supplemented diet (5 × 108 CFU/kg and 10 × 108 CFU/kg of diet), infected with E. coli. Each group had 6 replicate cages with 10 birds per cage. All birds were reared under identical conditions according to the Cobb Broiler management guide. Birds were raised on floor monolayer stainless steel cage (1.2 × 0.9 × 0.7 m) and allowed free access to clean water and experiment feed during the entire experiment period. During the first 3 d, the ambient temperature in the room was maintained at 35°C and was gradually reduced reaching 25°C at 21 d of age. The photoperiod was 17:7 h (L:D).

Diets and L. Acidophilus Supplementation

Chickens were fed an antibiotic-free corn-soybean meal basal diet in the form of mash. All nutrients were formulated to meet or exceed the feeding standard of China (NY/T 2004) for broilers. L. acidophilus (CGMCC 14437) used in this study was provided by the China General Microbiological Culture Collection Center (Beijing, China) and it was added to the basal diet in the form a bacterial suspension, providing 5 × 108 CFU/kg and 10 × 108 CFU/kg of diet. To ensure the homogeneity of the additives, approximately 20 kg of the basal diet was mixed with the calculated amount of bacteria using a 60-L horizontal mixer. Fresh experimental diets were produced manually every 3 d. L. acidophilus was stored at –80°C in their media containing 10% glycerol (Solarbio, China). Before the experiment, L. acidophilus was propagated in Mane Rogosae Sharpe (MRS, Aobox, China) agar at 37°C for 18 h. MRS broth was aseptically inoculated at 37°C for 21 h and centrifuged at 4°C for 10 min at 2,000 g. After removal of the supernatant, the bacteria precipitate was washed twice with phosphate-buffered saline (PBS) and was suspended in PBS medium at a final concentration of 1 × 109 CFU/mL.

E. Coli Challenge

The E. coli O157(CAU0771) was obtained from the China Veterinary Culture Collection Center, the China Institute of Veterinary Drug Control (Beijing, China). Briefly, E. coli O157 was cultured under aerobic condition on Luria-Bertani agar for 12 h at 37℃, and then aseptically inoculated into cooked Luria-Bertani meat medium and incubated aerophile for 18 h at 37℃, 200 r/min. Birds in the challenge groups were orally perfused once daily with actively growing E. coli O157 (3 × 108 cfu/mL, 0.5 mL per bird) during d 9 to 11, while the unchallenged birds were perfused with the same volume of sterilized cooked Luria-Bertani meat medium (Aoboxing, China).

Measurement of Growth Performance

Birds’ body weight and feed intake were group measured by cage at 1, 14, and 21 d of age. Average daily gain (ADG), average daily feed intake (ADFI), and feed conversion ratio (feed: body weight gain, FCR) were calculated during the different period (1–14 d and 15–21 d). Mortality was recorded (along with the birds’ body weight and cause of death, if known) during d 9 to 21. Birds were checked at least once daily and birds were euthanized by intravenous injection of pentobarbitone if they were in an unusual state (e.g., lame, visibly smaller than cage-mates, ruffled feathers, and lethargic), or had a serious injury or disease (e.g., broken wing and severe diarrhea). Mortality is reported as the percentage of the birds culled and found dead.

Peripheral Blood Mononuclear Cell Isolation and Analysis by Flow Cytometry

At 21 d, peripheral blood mononuclear cell (PBMC) was isolated from peripheral blood samples using Ficoll density centrifugation according to the method of Tan et al. (2015). Briefly, wing venous blood was collected and layered on top of the separation medium (Histopaque 1077; Sigma Chemical Company, Boston, MA) in tubes (1:1) and centrifuged at 200 g for 30 min (25°C). Then the PBMC at the plasma–Ficoll interface were collected. Cold RPMI-1640 medium (containing 5.0% inactivated fetal bovine serum, 100 U (0.0599 mg) penicillin/mL, 100 mg streptomycin/mL, and 10 mM-HEPES) was added to the tube containing the PBMC. After that, the cells were washed 3 times with cold RPMI-1640 medium by centrifugation at 100 g for 10 min (4°C). Then the samples were measured and analyzed using a FACSort flow cytometer (Becton Dickinson, Mountain View, CA) and Cell Quest software. First, the PBMC were incubated with specific antileucocyte monoclonal antibodies. The monoclonal antibodies (CD3-PE, CD4-APC, CD8-FITC) were purchased from Southern Biotech (Birmingham, AL). The cells were incubated with antibody at 4°C for 30 min then washed 3 times with PBS. Then samples were analyzed using the flow cytometer. Lymphocyte and monocyte subpopulations were gated based on forward and side-scatter characteristics, and the PBMC subpopulation counts were calculated based on 100 gated lymphocytes.

Measurement of Serum Immune Globulin, C-Reactive Protein, Diamine Oxidase, and Lipopolysaccharide Content

Blood samples from 6 birds per group (1 subsample /replicate cage) were collected into a disposable vacuum blood tubes containing procoagulant and separation gel at the end of the experiment period (21 d). All blood samples were centrifuged at 3,000 rpm for 10 min and the serum part was transferred into three separate tubes and stored at −20°C for analysis. The blood serum samples of immune globulin A (IgA, kit No. E027-1-1), immune globulin M (IgM, kit No. E025-1-1), C-reactive protein (CRP, kit No. E024-1-1), diamine oxidase (DAO, kit No. A088-1-1), and endotoxin lipopolysaccharide (LPS, kit No. E039-1-1) were determined according to the protocols of the kits of Nanjing Jiancheng Bioengineering Institute (Nanjing, China).

Total RNA Extraction and Quantitative Real-Time PCR for Measuring Related Gene Transcript Levels in the Jejunum, Ileum, and Spleen

At 3 and 10 d postinfection (at 14 and 21 d of age), 1 bird from each cage was euthanized by intravenous injection of pentobarbitone. The middle segments (2 cm in length) of jejunum and ileum of each bird were excised and snap-frozen in liquid nitrogen and stored at −80°C until further mRNA analysis. At 10 d postinfection (at 21 d of age), spleen samples of each bird were also excised and snap-frozen in liquid nitrogen and stored at −80℃ until further mRNA analysis . Total RNA was isolated from snap-frozen jejunum, ileum and spleen tissue samples (50 mg) by using TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA) according to manufacturer instructions. The concentration and purity of the total RNA were measured in a Microplate Readers (Multiskan Sky, 1.00.55, Thermo Fisher Scientific, Waltham, MA) using the 260:280 nm absorbance ratio. The absorption ratio (OD260/ OD280) of total RNA samples ranged between 1.8 and 2.0 and was considered to be of qualified purity. First, complementary DNA (cDNA) was synthesized from 1 μg of total RNA using Fast King RT Kit (Tiangen, China, kit No. KR116) according to the manufacturer's instructions and stored at −20°C until further processing. Quantitative real-time PCR was performed by Applied Biosystems Bio-Rad Real-Time PCR system (Bio-Rad, Carlsbad, CA) and a Premix Ex Taq with SYBR Green (Tiangen, China, kit No. FP205). Reactions were conducted in a 20-μL reaction mixture which contain 10.0 μL of 2 × SYBR PreMix plus, 1.0 μL of cDNA, 0.6 μL of each primer (10 mmol/L), and 7.8 μL of RNase-free water. For PCR, the thermocycle protocol lasted for 15 min at 95°C, followed by 40 cycles of 10 s denaturation at 95°C, 34 s annealing/extension at 60°C, and then a final melting curve analysis to monitor purity of the PCR product. Oligonucleotide primers for chicken iNOS, IL-6, IL-8, IL-1β, NF-kB, occludin, ZO-1, claduin, and chicken β-actin (Table 1) were designed based upon sequences available from public databases using Primer Express 5.0. The average gene expression of each sample relative to that of β-actin was calculated using the 2−ΔΔCt method as previously described (Livak and Schmittgen, 2001).
Table 1

Primers used for relative real-time polymerase chain reaction.

Gene nameForward primer sequence (5′ to 3′)Reverse primer sequence (5′ to 3′)GenBank number
β-actionGAGAAATTGTGCGTGACATCACCTGAACCTCTCATTGCCANM_205518.1
iNOSCAGCTGATTGGGTGTGGATTTTCTTTGGCCTACGGGTCNM_204961.1
IL-6AGGGCCGTTCGCTATTTGAACAGAGGATTGTGCCCGAACTXM_015281283.2
IL-8ATGAACGGCAAGCTTGGAGCTGTCCAAGCACACCTCTCTTCCATCCNM_205498.1
IL-1βACTGGGCATCAAGGGCTAGGTA GAAGATGAAGCGGGTCXM_015297469
NF-kBGTGTGAAGAAACGGGAACTGGGCACGGTTGTCATAGATGGXM_025145278.1
OccludinACGGCAGCACCTACCTCAAGGGCGAAGAAGCAGATGAGXM_025144248
ZO-1CTTCAGGTGTTTCTCTTCCTCCTGTGGTTTCATGGCTGGATCXM_015278981
Claudin-1CATACTCCTGGGTCTGGTTGGTGACAGCCATCCGCATCTTCTNM_001013611.2

Abbreviations: iNOS, inducible nitric oxide synthase; IL, interleukin; NF-kB, nuclear factor kappa; ZO-1, zona occludens protein-1.

Primers used for relative real-time polymerase chain reaction. Abbreviations: iNOS, inducible nitric oxide synthase; IL, interleukin; NF-kB, nuclear factor kappa; ZO-1, zona occludens protein-1.

Jejunum and Ileum Morphology

At 14 and 21 d, 1 bird from per cage was euthanized by intravenous injection of pentobarbitone. The intestinal samples were processed following a previously published protocol (Gungor and Erener, 2020). Intestinal segment samples (approximately 2–3 cm in length) of jejunum and ileum were excised and flushed with 0.9% saline to remove the feed contents and fixed in 10% neutral-buffered formalin for histology. Duodenal tissues were embedded in paraffin, and 20 cross-sections 2-mm thick of each sample were cut. Each of 5 semiserial cuts were placed on one microscopic slide and stained with Alcian blue and Periodic Acid-Schiff reagent (Solarbio G1281, Beijing, China). Ten well-oriented villi of each sample were selected to measure duodenal morphology. Villus height was measured from the tip to the villus-crypt junction of each villus. Afterward, the thickness of the jejunal and ileal wall (including the mucosa, submucosa, muscularis, and serosa) was measured. Crypt depth was calculated based on the distance from the junction to the basement membrane of the epithelial cells at the bottom of each 227crypt. Then, the ratio of villus height and crypt depth (V/C) was calculated.

Statistical Analysis

All data in this experiment were analyzed with SPSS version 17.0 (SPSS Inc., Chicago, IL). Data in tables represent the mean and standard error (SE) of 6 replicates. The main effects of L. acidophilus supplementation, E. coli challenge, and their interactive effects were analyzed as a 3 × 2 factorial arrangement of treatments. Duncan's multiple comparison test was used to separate means when interactive effects significantly differed. Results were also analyzed by one-way ANOVA, and were subjected to ground tables of the GraphPad Prism 7 (GraphPad Software, San Diego, Inc., CA). When a significant difference was observed, Duncan's multiple comparison was used to compare the differences among the 6 groups. Statistical significance was considered to be a P < 0.05, and a probability of P < 0.05 < P < 0.10 was considered as indicating a trend.

RESULTS

Growth Performance and Mortality Parameters

The growth performance and mortality rates of broiler chickens are present in Table 2 and Figure 1. Dietary L. acidophilus supplementation was associated with higher BW, ADG, ADFI, and FCR of broilers at different time periods (P < 0.05). Compared with uninfected groups, E. coli challenge did not significantly affect BW, ADG, ADFI, and FCR of broilers during 1 to 14 d (P >0.05), but decreased the ADG (P < 0.05), ADFI (P < 0.05), and BW (P = 0.083) of broilers from 15 to 21 d. No significant interaction (P > 0.05) in growth performance between E. coli challenge and L. acidophilus supplementation was observed. The E. coli challenge significantly increased the mortality rate (P < 0.05) of broilers at 21 d. L. acidophilus supplementation significantly reduced the mortality rate of E. coli challenged broilers (P < 0.05).
Table 2

Effect of L. acidophilus on growth performance of broilers challenged with E. coli.

d 1–14
d 15–21
L. acidophilusE. coli challenge2BW, gADG, g/dADFI, g/dFCRBW, gADG, g/dADFI, g/dFCR
0377.37a25.61a34.68ab1.36a762.71ab54.20ab80.29ab1.48
5 × 108 CFU/kg412.50b28.32b36.77a1.30b829.63c59.72c89.75c1.51
10 × 108 CFU/kg415.45b28.57b36.75a1.29b851.14c60.70c89.78c1.48
0+369.56a25.12a33.65b1.34ab751.33a50.68a74.59a1.47
5 × 108 CFU/kg+403.92b27.66b36.07a1.31ab800.81ab55.32b83.21bc1.51
10 × 108 CFU/kg+404.72b27.68b36.47a1.32ab813.73bc57.89bc84.57bc1.46
SEM6.390.320.340.018.890.781.210.01
Main effects
E. coli challenge
 Positive401.7727.5036.071.314814.5058.21a86.61a1.489
 Negative392.7326.6435.361.330788.6254.63b80.79b1.480
L. acidophilus supplementation
 0373.46a25.10a34.11a1.362a757.01a52.44a77.44a1.477
 5 × 108 CFU/kg408.21b27.99b36.42b1.302b815.22b57.52b86.45b1.507
 10 × 108 CFU/kg410.08b28.12b36.61b1.303b832.43b59.29b87.18b1.470
P-value1
 E. coli challenge0.1740.1120.2430.3460.0830.0050.0030.760
 L. acidophilus0.0010.0010.0030.0070.0010.0010.0010.450
 E. coli challenge × L. acidophilus0.9820.9610.8320.8140.7600.8530.9530.951

a,b,cMeans within the same column with different superscripts differ significantly (P < 0.05).

Abbreviations: ADG, average daily gain; ADFI, average daily feed intake; BW, body weight; FCR, feed conversion ratio, g of feed intake / g of BW gain, g/g.

P-values represent the main effect of the L. acidophilus, the main effect of E. coli challenge, and the interaction between the dietary L. acidophilus and E. coli challenge.

Without E. coli challenge; +, with E. coli challenge.

Figure 1

Effect of E. Coli challenge and L. acidophilus on mortality rates in broiler chickens during d 9–21.

Effect of L. acidophilus on growth performance of broilers challenged with E. coli. a,b,cMeans within the same column with different superscripts differ significantly (P < 0.05). Abbreviations: ADG, average daily gain; ADFI, average daily feed intake; BW, body weight; FCR, feed conversion ratio, g of feed intake / g of BW gain, g/g. P-values represent the main effect of the L. acidophilus, the main effect of E. coli challenge, and the interaction between the dietary L. acidophilus and E. coli challenge. Without E. coli challenge; +, with E. coli challenge. Effect of E. Coli challenge and L. acidophilus on mortality rates in broiler chickens during d 9–21.

Intestinal Morphology

There was an interaction effect (P < 0.05) on the jejunum V:C ratio between L. acidophilus supplementation and E. coli challenge (Table 3). Broilers fed diets supplemented with L. acidophilus (5 × 108 CFU/kg) had a significant increase of the jejunum V/C ratio and ileum villus height at 14 d but this favorable change disappeared when the broilers were infected with E. coli. Based on the main effects analysis, a decreasing trend in ileum villus height of E. coli challenged birds was observed at 14 d (P = 0.100).
Table 3

Effect of L. acidophilus on jejunum and ileum histomorphology of broilers infected with E. coli on d 14.

Jejunum
Ileum
L. acidophilusE. coli challenge2Villus height, μmCrypt depth, μmV/CIntestinal wall thickness, μmVillus height, μmCrypt depth, μmV/CIntestinal wall thickness, μm
01094.52201.285.33a200.93810.90b205.894.06217.56
5 × 108 CFU/kg1070.26159.946.71b188.77965.77a211.504.64191.63
10 × 108 CFU/kg974.55211.444.65a199.44810.77b223.843.70221.98
0+994.73200.425.24a189.40794.94b193.174.22227.39
5 × 108 CFU/kg+874.33179.035.04a188.78820.96b219.493.79218.98
10 × 108 CFU/kg+974.09171.216.03ab181.27790.52b204.964.32221.85
SEM33.217.990.236.0420.578.180.185.83
Main effects
E. coli challenge
 Negative1046.44190.885.57196.38862.48216.244.21209.78
 Positive947.71183.555.44186.48802.14205.874.11222.74
L. acidophilus supplementation
 01044.62200.855.29195.17802.92a199.834.14222.48
 5 × 108 CFU/kg972.29169.485.88188.78893.36b209.254.32204.39
 10×108 CFU/kg974.31191.335.34190.35800.64a204.014.10221.90
P-value1
 E. coli challenge0.1510.6510.5780.4500.1000.5640.8110.294
 L. acidophilus0.5990.2770.6130.9130.0980.6420.8320.407
 E. coli challenge × L. acidophilus0.5100.3220.0350.8490.3230.9040.2750.615

a,bMeans within the same column with different superscripts differ significantly (P < 0.05).

P-values represent the main effect of the L. acidophilus, the main effect of E. coli challenge, and the interaction between the dietary L.acidophilus and E. coli challenge.

Without E. coli challenge; +, with E. coli challenge.

Effect of L. acidophilus on jejunum and ileum histomorphology of broilers infected with E. coli on d 14. a,bMeans within the same column with different superscripts differ significantly (P < 0.05). P-values represent the main effect of the L. acidophilus, the main effect of E. coli challenge, and the interaction between the dietary L.acidophilus and E. coli challenge. Without E. coli challenge; +, with E. coli challenge. Compared with birds fed basal diet, L. acidophilus treatment tended to increase the ileum V:C ratio at 21 d (Table 4, P = 0.052) and an interaction effect was also observed between L. acidophilus supplementation and E. coli challenge (P < 0.05). E. Coli challenge significantly increased the jejunum intestinal wall thickness at 21 d compared with unchallenged birds and E. coli challenge birds fed with L. acidophilus (10 × 108 CFU/kg).
Table 4

Effect of L. acidophilus on jejunum and ileum histomorphology of broilers infected with E. coli on d 21.

Jejunum
Ileum
L. acidophilusE. coli challenge2Villusheight, μmCrypt depth, μmV/CIntestinal wall thickness, μmVillusheight, μmCrypt depth, μmV/CIntestinal wall thickness, μm
0979.70b214.864.73a175.77b634.43187.043.47b227.64
5 × 108 CFU/kg962.46b203.204.96a177.02b538.19148.813.71b191.48
10 × 108 CFU/kg1247.91a236.215.55b188.01ab706.71156.324.56a214.51
0+1182.63ab237.895.08ab195.47a640.99181.923.58b239.69
5 × 108 CFU/kg+1105.64ab213.195.31b199.58a703.35175.703.99ab233.33
10×108 CFU/kg+1136.93ab187.966.33c187.11ab649.71180.063.62b209.20
SEM36.749.100.235.5324.006.740.108.11
Main effects
E. coli challenge
 Negative1063.36218.095.07180.26626.44164.063.91211.21
 Positive1141.73213.025.57194.06664.68179.233.73227.41
L. acidophilus supplementation
 01081.16226.384.905a185.62637.71184.483.521a233.67
 5 × 108 CFU/kg1034.05208.195.135a188.30620.77162.253.848ab212.40
 10 × 108 CFU/kg1192.42212.095.938b187.56678.21168.194.088b211.85
P-value1
 E. coli challenge0.2670.7910.3050.0860.4320.2790.3250.340
 L. acidophilus0.1950.7000.0210.1720.6160.3950.0520.480
 E. coli challenge × L. acidophilus0.1760.2950.9160.1270.1700.5770.0230.515

a,b,cMeans within the same column with different superscripts differ significantly (P < 0.05).

P-values represent the main effect of the L.acidophilus, the main effect of E. coli challenge, and the interaction between the dietary L. acidophilus and E. coli challenge.

Without E. coli challenge; +, with E. coli challenge.

Effect of L. acidophilus on jejunum and ileum histomorphology of broilers infected with E. coli on d 21. a,b,cMeans within the same column with different superscripts differ significantly (P < 0.05). P-values represent the main effect of the L.acidophilus, the main effect of E. coli challenge, and the interaction between the dietary L. acidophilus and E. coli challenge. Without E. coli challenge; +, with E. coli challenge.

Immune Cell Phenotypes

The immune cell subpopulation data on d 21 are shown in Figure 2. E. coli challenge significantly decreased (P < 0.05) the CD3+ T cell counts compared with unchallenged birds and challenged birds fed with L. acidophilus. The subpopulation of CD4+ T cells subpopulation were highest in E. coli challenge birds fed 10 × 108 CFU/kg of L. acidophilus. No significant differences (P > 0.05) were observed for CD8+T cells subpopulation's changes between groups. In addition, the ratio of CD4+ T cells and CD8+ T cells in the peripheral blood lymphocyte subpopulations were not significantly different.
Figure 2

The distribution of CD3+, CD4+, and CD8+ of lymphocytes isolated from peripheral blood in 21-day-old chickens treated with control diet , 5 × 108 CFU/kg L. acidophilus, 10 × 108 CFU/kg L. acidophilus, E. Coli, E. Coli + 5 × 108 CFU/kg L. acidophilus, E. Coli + 10 × 108 CFU/kg L. acidophilus, The collected cells from each treatment were stained with mice anti-chicken monoclonal antibodies (PE-labeled anti-CD3, PE-labeled anti-CD4, and PE-labeled anti-CD8) and analyzed in a flow cytometer. The graphs show the ratio of CD3+/CD4+ (E) and CD3+/CD8+ (F) divided by the total T cells of peripheral blood mononuclear cells. Each bar represents mean ± standard error (SE) of 6 replicates. Means with no common letter differ significantly (P < 0.05).

The distribution of CD3+, CD4+, and CD8+ of lymphocytes isolated from peripheral blood in 21-day-old chickens treated with control diet , 5 × 108 CFU/kg L. acidophilus, 10 × 108 CFU/kg L. acidophilus, E. Coli, E. Coli + 5 × 108 CFU/kg L. acidophilus, E. Coli + 10 × 108 CFU/kg L. acidophilus, The collected cells from each treatment were stained with mice anti-chicken monoclonal antibodies (PE-labeled anti-CD3, PE-labeled anti-CD4, and PE-labeled anti-CD8) and analyzed in a flow cytometer. The graphs show the ratio of CD3+/CD4+ (E) and CD3+/CD8+ (F) divided by the total T cells of peripheral blood mononuclear cells. Each bar represents mean ± standard error (SE) of 6 replicates. Means with no common letter differ significantly (P < 0.05).

Serum IgA, IgM, CRP, DAO, and LPS Content

The serum index was measured to estimate the humoral immunity (Table 5) and intestinal barrier function (Table 6). No significant interaction effect was observed between L. acidophilus supplementation and E. coli challenge in terms of serum specific IgA and IgM content of broilers. Compared with the unchallenged birds, E. coli challenge significantly (P < 0.05) resulted in an increase in the serum concentration of IgA and IgM at the early stage of infection at d 14 (at 3 d postinfection), but the serum IgA and IgM level were decreased and significantly lower than unchallenged birds at 21 d (at 10 d postinfection). Large increases in serum IgA and IgM were observed in E. coli challenged birds fed with L. acidophilus (10 × 108 CFU/kg) compared with infected birds at 21d.
Table 5

Effect of L. acidophilus on serum immune globulin content of broilers infected with E. coli on d 14 and d 21.

d 14
d 21
L. acidophilusE. coli challenge1IgA2, g/LIgM3, g/LIgA, g/LIgM, g/L
01.23a1.96abc3.22b3.21b
5 × 108 CFU/kg1.48a1.81ab3.26b3.62b
10 × 108 CFU/kg1.63ab1.72a2.90b3.32b
0+1.98ab2.29c2.19a2.18a
5 × 108 CFU/kg+2.46b2.10bc3.47b3.04b
10 × 108 CFU/kg+2.31b2.05abc2.46ab2.69ab
SEM0.160.060.170.15
Main effects
E. coli challenge
 Negative1.49a1.830a3.458a3.380a
 Positive2.25b2.147b3.127b2.637b
L. acidophilus supplementation
 01.602.1262.707a2.69
 5 × 108 CFU/kg1.971.9543.362b3.33
 10 × 108 CFU/kg1.971.8852.678a3.00
P-value4
 E. coli challenge0.0100.0030.0430.009
 L. acidophilus0.4670.1130.0690.156
 E. coli challenge × L. acidophilus0.8980.9820.6150.733

a,b,cMeans within the same column with different superscripts differ significantly (P < 0.05).

Without E. coli challenge; +, with E. coli challenge.

IgA, immune globulin A.

IgM, immune globulin M.

P-values represent the main effect of the L. acidophilus, the main effect of E. coli challenge, and the interaction between the dietary L. acidophilus and E. coli challenge.

Table 6

Effect of L. acidophilus on serum endotoxin content serum of broilers infected with E. coli on d 14 and d 21.

d 14
d 21
L. acidophilusE. coli challenge1CRP2 (mg/L)DAO3 (U/L)LPS4 (EU/mL)CRP (mg/L)DAO (U/L)LPS (EU/mL)
03.29a2.15b0.43bc1.65a1.97a0.26a
5 × 108 CFU/kg2.87a1.41a0.34a2.00ab2.04a0.28a
10 × 108 CFU/kg3.15a1.48a0.49c2.52bc2.60b0.34b
0+6.57b3.5810.5613.0114.7920.41c
5 × 108 CFU/kg+3.31a2.80c0.39ab2.26bc3.8910.37b
10 × 108 CFU/kg+4.55c2.29bc0.46bc2.34bc3.07c0.44c
SEM0.250.160.020.090.200.01
Main effects
E. coli challenge
 Negative3.10a1.68a0.42a2.05a2.14a0.29a
 Positive4.81b2.95b0.47b2.57b3.88b0.41b
L. acidophilus supplementation
 04.90a2.87a0.51a2.333.40a0.340a
 5 × 108 CFU/kg3.09b2.20b0.37b2.132.84b0.32a
 10 × 108 CFU/kg3.85c1.86b0.47a2.482.81b0.39b
P-value5
 E. coli challenge0.0010.0010.0340.0010.0010.001
 L. acidophilus0.0030.0010.0010.1120.0260.001
 E. coli challenge × L. acidophilus0.0010.1460.0200.0010.0100.066

a,b,cMeans within the same column with different superscripts differ significantly (P < 0.05).

Without E. coli challenge; +, with E. coli challenge.

CRP, diamine oxidase.

CRP, C-reactive protein.

LPS, lipopolysaccharide.

P-values represent the main effect of the L.acidophilus, the main effect of E. coli challenge, and the interaction between the dietary L.acidophilus and E. coli challenge.

Effect of L. acidophilus on serum immune globulin content of broilers infected with E. coli on d 14 and d 21. a,b,cMeans within the same column with different superscripts differ significantly (P < 0.05). Without E. coli challenge; +, with E. coli challenge. IgA, immune globulin A. IgM, immune globulin M. P-values represent the main effect of the L. acidophilus, the main effect of E. coli challenge, and the interaction between the dietary L. acidophilus and E. coli challenge. Effect of L. acidophilus on serum endotoxin content serum of broilers infected with E. coli on d 14 and d 21. a,b,cMeans within the same column with different superscripts differ significantly (P < 0.05). Without E. coli challenge; +, with E. coli challenge. CRP, diamine oxidase. CRP, C-reactive protein. LPS, lipopolysaccharide. P-values represent the main effect of the L.acidophilus, the main effect of E. coli challenge, and the interaction between the dietary L.acidophilus and E. coli challenge. The serum CRP, DAO, and LPS concentrations were considered as important symbols of intestinal permeability and barrier function. Main effects showed that dietary L. acidophilus supplementation reduced the serum concentration of CRP, DAO, and LPS in the serum at d 14 (P < 0.05). E. coli challenge significantly increased the serum concentration of CRP, DAO, and LPS (P < 0.05) compared with unchallenged birds and challenged birds fed with L. acidophilus over the whole infection period (14 d and 21 d).

Inflammatory Cytokines mRNA Expression in the Jejunum and Spleen

Changes in the mRNA expression of inflammatory cytokines in the jejunum are shown in Table 7. At 21 d, the mRNA expression of iNOS, IL-8, and IL-1β were significantly (P < 0.05) upregulated by E. coli challenge, while L. acidophilus supplementation significantly (P < 0.05) downregulated the expression of IL-8. An interactive effect on the NF-kB mRNA expression (P < 0.05) in the jejunum was observed between E. coli challenge and L. acidophilus supplementation. In unchallenged groups, increasing L. acidophilus supplementation significantly (P < 0.05) downregulated the mRNA expression of NF-kB. However, the NF-kB mRNA expression was the lowest in E. coli challenged birds fed with lower dietary level of L. acidophilus (5 × 108 CFU/kg).
Table 7

Effect of L. acidophilus on cytokine mRNA expressions in the jejunum of broilers infected with E. coli on d 21 (log2 relative).

L. acidophilusE. coli challenge1iNOS2IL-63IL-8IL-1βNF-kB4
01.01a0.961.17a1.04a0.95ab
5 × 108 CFU/kg1.02a0.851.22a1.17ab1.25b
10 × 108 CFU/kg0.92a0.761.12a1.13ab0.80a
0+1.78b1.123.14b1.88b1.34b
5 × 108 CFU/kg+1.43ab0.711.16a1.24ab0.80a
10 × 108 CFU/kg+1.16a1.011.37a1.91b1.23b
SEM0.090.100.200.120.07
Main effects
E. coli challenge
 Negative0.97a0.871.12a1.10a1.02
 Positive1.46b0.951.87b1.68b1.12
L. acidophilus supplementation
 01.390.782.06a1.441.17
 5 × 108 CFU/kg1.220.891.18b1.201.03
 10 × 108 CFU/kg1.040.861.23b1.521.02
P-value5
 E. coli challenge0.0050.7340.0020.0100.312
 L. acidophilus0.1720.5950.0040.4020.388
 E. coli challenge × L. acidophilus0.3210.7690.0010.2100.007

a,bMeans within the same column with different superscripts differ significantly (P < 0.05).

Without E. coli challenge; +, with E. coli challenge.

iNOS, inducible nitric oxide synthase.

IL, interleukin.

NF-kB, nuclear factor kappa.

P-values represent the main effect of the L. acidophilus, the main effect of E. coli challenge, and the interaction between the dietary L. acidophilus and E. coli challenge.

Effect of L. acidophilus on cytokine mRNA expressions in the jejunum of broilers infected with E. coli on d 21 (log2 relative). a,bMeans within the same column with different superscripts differ significantly (P < 0.05). Without E. coli challenge; +, with E. coli challenge. iNOS, inducible nitric oxide synthase. IL, interleukin. NF-kB, nuclear factor kappa. P-values represent the main effect of the L. acidophilus, the main effect of E. coli challenge, and the interaction between the dietary L. acidophilus and E. coli challenge. E. coli challenge and L. acidophilus supplementation showed an interactive effect on the mRNA expression of iNOS (P < 0.05) in the spleen (Table 8). The expression of iNOS in the spleen was significantly (P < 0.05) upregulated by E. coli challenge, while L. acidophilus supplementation significantly (P < 0.05) downregulated the expression of iNOS of birds when challenged by E. coli. The relative mRNA expression levels of IL-8, IL-1β, and NF-kB in the spleen were not significantly affected by E. coli. challenge or by L. acidophilus supplementation (P > 0.05).
Table 8

Effect of L. acidophilus on cytokine mRNA expressions in the spleen of broilers infected with E. coli on d 21 (log2 relative).

L. acidophilusE. coli challenge1iNOS2IL-63IL-8IL-1βNF-kB4
01.06a0.98ab1.041.121.10
5 × 108 CFU/kg1.17ab1.14b0.971.391.34
10 × 108 CFU/kg1.92b0.68a0.951.821.35
0+3.17c1.02ab0.900.681.35
5 × 108 CFU/kg+1.22ab0.81ab1.061.221.37
10 × 108 CFU/kg+1.21ab0.87ab1.170.851.32
SEM0.190.060.090.170.08
Main effects
E. coli challenge
 Negative (−)1.362a0.940.971.401.23
 Positive (+)1.864b0.901.050.921.35
L. acidophilus supplementation
 02.08a1.010.950.901.22
 5 × 108 CFU/kg1.19b0.971.011.311.39
 10 × 108 CFU/kg1.56ab0.781.071.341.37
P-value5
 E. coli challenge0.0370.7260.7210.1780.521
 L. acidophilus0.0140.1970.8980.4420.665
 E. coli challenge × L. acidophilus0.0010.1690.8020.6160.642

a,bMeans within the same column with different superscripts differ significantly (P < 0.05).

Without E. coli challenge; +, with E. coli challenge.

iNOS, inducible nitric oxide synthase.

IL, interleukin.

NF-kB, nuclear factor kappa.

P-values represent the main effect of the L. acidophilus, the main effect of E. coli challenge, and the interaction between the dietary L.acidophilus and E. coli challenge.

Effect of L. acidophilus on cytokine mRNA expressions in the spleen of broilers infected with E. coli on d 21 (log2 relative). a,bMeans within the same column with different superscripts differ significantly (P < 0.05). Without E. coli challenge; +, with E. coli challenge. iNOS, inducible nitric oxide synthase. IL, interleukin. NF-kB, nuclear factor kappa. P-values represent the main effect of the L. acidophilus, the main effect of E. coli challenge, and the interaction between the dietary L.acidophilus and E. coli challenge.

Occludin, ZO-1, and Claudin mRNA Expression in the Jejunum and Ileum

No significant interaction effects were observed on occludin, ZO-1, and claudin mRNA expression in jejunum and ileum between E. coli challenge and L. acidophilus supplementation (Table 9). Compared with the control group and E. coli challenged broilers, L. acidophilus supplementation significantly upregulated the mRNA expression of occludin, ZO-1, and claudin in the jejunum, and occludin and ZO-1 in the ileum at 21 d (P < 0.05). E. coli challenge had no negative effect on the mRNA expression of occludin, ZO-1, and claudin mRNA expression in the jejunum (P > 0.05), but significantly downregulated the Occludin mRNA expression in the ileum (P < 0.05), and showed a reduced trend for ZO-1 mRNA expression (P < 0.10).
Table 9

Effect of L. acidophilus on mRNA expressions of Occludin, ZO-1, and Cladin-1 in the jejunum and ileum of broilers infected with E. coli on d 21 (log2 relative).

Jejunum
Ileum
L. acidophilusE. coli challenge1OccludinZO-12Cladin-1OccludinZO-1Cladin-1
00.94a1.10a1.05a1.08ab0.95abc0.94ab
5 × 108 CFU/kg1.88b1.39ab1.72abc1.37c1.18bc0.88a
10 × 108 CFU/kg1.81b1.54ab1.95bc1.24bc1.15bc1.19ab
0+0.93a1.04a1.16ab0.71a0.76a0.72a
5 × 108 CFU/kg+1.88b1.65ab1.89bc0.89ab0.89ab1.08ab
10 × 108 CFU/kg+1.61b1.92b2.24c1.11bc1.24c1.52b
SEM0.110.120.140.060.050.09
Main effects
E. coli challenge
 Negative1.5641.311.561.20a1.111.02
 Positive1.4781.541.760.91b0.961.10
L. acidophilus supplementation
 00.97a1.02a1.08a0.85a0.88a0.86a
 5 × 108 CFU/kg1.88b1.52b1.81b1.13b1.03ab0.98a
 10 × 108 CFU/kg1.71b1.74b2.11b1.18b1.20b1.35b
P-value3
 E. coli challenge0.5220.2970.3250.0050.0980.602
 L. acidophilus0.0010.0410.0400.0250.0270.054
 E. coli challenge × L. acidophilus0.8450.7930.9560.3060.1590.266

a,b,cMeans within the same column with different superscripts differ significantly (P < 0.05).

Without E. coli challenge; +, with E. coli challenge.

ZO-1, zona occludens protein-1.

P-values represent the main effect of the L. acidophilus, the main effect of E. coli challenge, and the interaction between the dietary L. acidophilus and E. coli challenge.

Effect of L. acidophilus on mRNA expressions of Occludin, ZO-1, and Cladin-1 in the jejunum and ileum of broilers infected with E. coli on d 21 (log2 relative). a,b,cMeans within the same column with different superscripts differ significantly (P < 0.05). Without E. coli challenge; +, with E. coli challenge. ZO-1, zona occludens protein-1. P-values represent the main effect of the L. acidophilus, the main effect of E. coli challenge, and the interaction between the dietary L. acidophilus and E. coli challenge.

DISCUSSION

Lactobacilli can alleviate pathogenic inflammatory reactions and modulate the expression of key immune cytokines to improve host gut health and growth performance in poultry after pathogen exposure (Wang et al., 2017) and pig (Lee et al., 2012). The current study highlighted the significance of L. acidophilus supplementation in broiler production and intestinal health. Dietary L. acidophilus supplementation also increased the BW and ADG in broilers in a previous study (Wu et al., 2019). This indicated that L. acidophilus improved broiler growth. For E. coli challenged birds, the BW, ADG, and ADI were also improved with L. acidophilus supplementation compared with values in the control group. These results are consistent with other studies showing that the use of probiotic Lactobacilli positively improved the growth performance of pathogen challenged birds (Li et al., 2018; Redweik et al., 2019). The mechanism of probiotic action of Lactobacilli is multifactorial and not fully characterized. Possible mechanisms include secretion of antimicrobial substances, strengthening of the intestinal epithelial barrier function, competitive adherence to the mucosa, and modulation of the immune response (Broom and Kogut, 2018). Lactobacilli can prevent the growth of E. coli and Salmonella in vitro (Lin et al., 2008; Tejero et al., 2012), increase the Lactobacillus numbers in the ileum and cecum, and decrease the ileal Escherichia counts in vivo (Li et al., 2018). Improved intestinal flora may counteract the increased serum endotoxin content induced by intestinal pathogens. Fukata reported that L. acidophilus decreased the toxins produced by intestinal pathogens, which explained the beneficial effect resulting from L. acidophilus addition. Growth improvement after L. acidophilus supplementation may also be due to its ability to produce endogenous enzymes or growth-promoting factors by directly fermenting nutrients in the gut. This could stimulate small intestine peristalsis, boost feed digestibility and availability, and promote gut health (Jin et al., 2000; Hung et al., 2012; Wu et al., 2019). Immunity stress can cause a mass of energy consumption to synthesize inflammatory factors, so it is possible that L. acidophilus reduced the immunity stress and preserved available energy for growth and maintenance. Intestinal morphology, including villus height, crypt depth, and intestinal wall thickness, as well as the V/C ratio, are important parts of intestinal health and function (Wu et al., 2018). In this study, L. acidophilus supplementation of L. acidophilus in broiler diet increased the jejunum V/C ratio and ileum villus height, which is consistent with previous reports that Lactobacilli can improve the intestinal morphology development of broilers (Wang et al., 2012; Forte et al., 2017). The villus height and V:C ratio is meaningful indexes of the intestine absorptive ability and important parameters of healthy bird intestines (Jia et al., 2010; Li et al., 2018). In this study, the mortality rate of E. coli challenged birds was the highest among all groups examined. This indicated that E. coli challenge led to inflammatory responses and reduced the broilers intestinal health. Wu et al. (2018) reported that birds infected with necrotic enteritis (NE) pathogens had shorter villi height and decreased villus height to crypt depth V/C ratio in the jejunum. However, we found no remarkable differences on intestine villus height and V/C ratio in E. coli challenged birds. The specific strain of E. coli used in this study might not damage the host by disrupting the intestinal morphology. Tight junctions are the most important components of the intestinal epithelial cell barrier function and intestinal permeability that protects the host from foreign pathogens and limits macromolecular transmission (Ballard et al., 1995). Tight junctions and intestinal permeability are formed by several types of proteins, including occludin, ZO-1, and claudin (Schneeberger, 2004). Wang et al. (2017) showed that E. coli infection greatly damaged the intestinal epithelial permeability and mucosal barrier function of broilers, resulting in gut pathogen translocation to liver and blood. We observed that E. coli challenge significantly increased the serum CRP and DAO concentration compared with unchallenged birds and challenged birds fed with L. acidophilus over the entire infection period. CRP is an acute phase protein and a component of the innate immune system. It is always regarded as a metabolic inflammatory marker (Wang et al., 2014; Bhattacharya et al., 2017). DAO is located mainly in the small intestinal mucosa. It is a marker for the assessment of gut barrier function, and enters the bloodstream when the gut barrier is impaired (Liu et al., 2020; Zhang et al., 2020). Increased serum CRP and DAO concentrations reflect changes in intestinal permeability, suggesting that E. coli challenge disrupts the intestinal barrier function. In addition, E. coli challenge downregulated the ileum barrier protein (occludin and ZO-1) mRNA expression and increased the jejunum wall thickness. Increased intestinal wall thickness is often accompanied with inflammatory bowel disease and affects the absorption and utilization of nutrients (Rudorf et al., 2010). Several studies demonstrated that Lactobacilli can inhibit intestinal pathogen growth and enhance poultry growth performance, by way of maintaining normal intestinal barrier function when faced with a pathogen challenge (Geier et al., 2010; Wang. et al., 2017). We found that the serum CRP and DAO levels of broiler chickens in the L. acidophilus groups were similar to the control group, regardless of E. coli challenge. L. acidophilus supplementation also significantly upregulated the mRNA expression of occludin, ZO-1, and claudin in the jejunum, and occludin and ZO-1 in the ileum, which corresponds to our results of lower serum LPS content. These results here indicated that dietary L. acidophilus supplementation reduced the intestinal damage caused by E. coli by improving the mRNA expression of intestinal barrier functional proteins. This is a significant finding that can be used to improve the intestinal health of broilers. Host inflammatory responses are triggered when broilers are infected by pathogens from feed or the environment. LPS is the major component of the gram-negative bacteria cell wall and plays a key role in the inflammatory responses of hosts challenged by E. coli (Lim et al., 2016). If the pathogen-induced inflammatory response is severe, tissue damage can occur, accompanied by increased serum LPS content and reduced growth performance as was observed in the present study. In addition, due to E. coli infection induced cellular immunosuppression and infected birds had lower related total T (CD3+) cells counts than uninfected birds. Dietary L. acidophilus supplementation alleviated the decrease in CD3+ T cell counts caused by E. coli challenge, which is consistent with previous findings (Wang et al., 2015). The T cell mediated immunity response plays a key role in the clearance of pathogens by influx into the intestine. The increase in circulating CD3+ T cell counts endowed the birds with a stronger immunity against E. coli or challenge from other pathogens. However, research on the effect of L. acidophilus on the cellular immunity of broilers is limited. The increase in intestinal T regulatory cells can be accelerated by Lactobacillus administration to animal diet (Liu et al., 2013; Meyer et al., 2020), which may explain how L. acidophilus increases the proportion of CD3+ cell in the blood of broilers as observed in the present study. The CD4+ (helper) and CD8+ (cytotoxic) T lymphocytes subsets are components of cell-mediated immunity and the stimulation of CD4+ and CD8+ T cells is necessary and essential in maintaining the cellular immune response in animals and humans when facing pathogen challenge (Ashraf and Shah, 2014). We found that increased CD4+ T cells counts in infected birds was a normal immune response and host self-protection process. Previous studies showed that Lactobacilli supplementation can increase the CD4+ and CD8+ T cells populations in broilers in the absence of pathogens challenge, indicating that Lactobacillus may benefit the host in maintaining the normal intestinal immune status and preventing disease invasion (Bai et al., 2013; Wang et al., 2015). However, these beneficial effects on CD4+ and CD8+ T cells of broilers were not observed in this study, which is contrary to previous reports. Similarly, Sefcova et al. (2020) also did not observe the benefit of CD4+ and CD8+ T cells counts when they fed Lactobacillus fermentum to broilers. This may have been caused by the difference between Lactobacilli strains. Wang et al. (2015) observed increased CD4+ T cells in broiler jejunum rather than in blood, suggesting that changes to lymphocyte populations by Lactobacillus are more likely to occur at local sites of colonization with minimal systemic effects. The immune globulin is the first antibody isotype in the primary humoral immunity response. It is produced by mature B cells in response to antigen stimulation and co-stimulatory signals received from CD4+ T helper cells (Zhang et al., 2016). The immune globulin levels in serum are an indicator of long-term exposure to foreign antigen from feed or environment. We found that compared with unchallenged birds, E. coli challenge resulted in an increase in the serum IgA and IgM levels at the early stage of infection at d 14 (at 3 d postinfection), but decreased and were significantly lower than in unchallenged birds at 21 d (at 10 d postinfection). This is a classic phenomenon during the switch from acute to chronic inflammation. When broilers are in the early infection stage, E. coli acts as foreign antigen stimulate to B cells to regulate the immune system. Activated B cells then differentiate into plasmocytes and become plasma cells that secrete antibodies to neutralize viruses or become long-lived memory B cells (Chen et al., 2017). At the late infection stage, E. coli challenge induced cellular immunosuppression. Infected chickens showed lower circulating T cell counts and damaged cellular immune function, which was observed in the present study. We hypothesized that E. coli challenge led to B cell migration and impaired B-cell proliferation and viability, and then inhibited IgM and IgA secretion in the late infection stage. Previous studies showed that Lactobacillus administration increased levels of immune globulins such as IgA and IgM, suggesting that L. acidophilus presupplementation may have enhanced the defense ability of the broilers in the present study (Sefcova et al., 2020). Our data showed that L. acidophilus supplementation alone did not affect the serum IgA and IgM levels at 14 d, but produced large increases in serum IgA and IgM levels. IgA is widely distributed in the mucous secretions of the gastrointestinal and respiratory tracts and it helps prevent attachment of viruses and bacteria to epithelial surfaces and to neutralize toxins (Mccoy et al., 2008). These result may be due to a reduction in the number of pathogens in the intestinal tract of E. coli infected chickens fed L. acidophilus during the infection period, which was insufficient to stimulate the immune system to produce more specific immune globulin. The total number of T-lymphocytes is tightly controlled by cytokines. Activated T-lymphocytes are able to act on inflammation through the secretion of IL-17, and stimulation of IL-8 and IL-6 expression (Kawasaki et al., 2009; Minmin et al., 2018). Lactobacilli were previously shown to regulate the transcript levels of inflammation related cytokines in previous studies (Kawasaki et al., 2009; Tan et al., 2015). Li et al. (2018) reported that L. acidophilus decreased the transcription of IL-8, IL-1β, and TNF-α in the spleen, and decreased the transcription of IL-8, IFN-γ, and IL-10 jejunum of broilers, irrespective of Clostridium perfringens challenge. Wang et al. (2015) showed that a L. plantarum strain increased the jejunal transcription of IFN-γ, IL-12, and IL-4 at 14 d post-treatment in the absence of pathogens. These studies demonstrated that Lactobacilli can increase host immunity in the presence or absence of pathogens. However, little is known about the effects of L. acidophilus on the cytokine expression under an E. coli challenge model. In the present study, L. acidophilus supplementation decreased the transcription of IL-8, iNOS and IL-1β in the jejunum, and decreased the transcription of iNOS in the spleen of E. coli challenged broilers. We also observed differences in cytokine expression of E. coli challenged birds in the jejunum and spleen. This may be because the inflammatory responses appeared more intense in the jejunum than in the spleen, which might lead to intestinal damage, higher nutrient consumption, and poor growth performance. IL-6 is involved in several immune responses. The main function of IL-6 is to activate B cells to proliferate and secrete antibodies, stimulate T cell proliferation, and activate cytotoxic T lymphocytes (Zhou et al., 2019). Tan et al. (2015) found that IBDV inoculation reduced broiler serum IL-6 concentration. The result may have involved either innate or adaptive immunity and was illustrated by immunosuppression. However, no significant changes were found on IL-6 gene expression, both in jejunum and spleen, in the present study. This may be due to the differences of the infection model. Lactobacilli exhibit different regulatory functions when hosts are under different conditions. IL-8 acts as a chemotactic for neutrophils and monocytes in inflammation. The upregulation of IL-8 mRNA expression is a protective response of chickens for the clearance of invading host pathogens. In the present study, E. coli challenge upregulated the mRNA expression of jejunum IL-8 and this was similar to previous results (Sreedhar et al., 2008). These findings indicate that dietary L. acidophilus supplementation enhanced the immunity of chickens against E. coli challenge. Macrophages can produce proinflammatory cytokines IL-1β during the inflammatory responses, and mediate the inflammation at the early infection period. Local inflammatory response recruits phagocytic and non-phagocytic lymphoid cells to remove foreign pathogens. The upregulation expression of IL-1β during E. coli infection is critical for birds through the clearing of foreign pathogens. The iNOS has a synergistic effect with some inflammatory mediators, which may cause cellular swelling and apoptosis (Zhang et al., 2017). NO is an important inflammatory product produced by iNOS, and it is mainly involved in promoting inflammatory responses(Xu et al., 2017). NO typically acts by inhibiting the inflammatory response. Under pathological conditions, the iNOS synthesizes a large amount of NO, which has a cytotoxic effect and aggravates the inflammatory response. In this study, dietary L. acidophilus (10 × 108 CFU/kg) supplementation increased the mRNA expression of jejunum. Therefore, L. acidophilus may enhance the host defense function by increasing NO production in the intestinal epithelium of broilers.

CONCLUSIONS

The protective effects of dietary L. acidophilus supplementation on E. coli challenged birds resulted from an enhancement in cellular and humoral immunity and improvement in intestinal barrier function. These effects resulted in improved growth performance and reduced mortality of birds. L. acidophilus can be used as an intervention strategy to reduce E. coli infection in broilers. However, the mechanism by which dietary L. acidophilus supplementation exerts protective effects against intestinal microflora and intestinal diseases requires further study.

DISCLOSURES

The authors declare no conflicts of interest.
  4 in total

1.  Recombinant Limosilactobacillus (Lactobacillus) delivering nanobodies against Clostridium perfringens NetB and alpha toxin confers potential protection from necrotic enteritis.

Authors:  Dharanesh Gangaiah; Valerie Ryan; Daphne Van Hoesel; Shrinivasrao P Mane; Enid T Mckinley; Nallakannu Lakshmanan; Nandakumar D Reddy; Edward Dolk; Arvind Kumar
Journal:  Microbiologyopen       Date:  2022-04       Impact factor: 3.904

2.  Lactobacillus salivarius CML352 Isolated from Chinese Local Breed Chicken Modulates the Gut Microbiota and Improves Intestinal Health and Egg Quality in Late-Phase Laying Hens.

Authors:  Chang Xu; Fuxiao Wei; Xinyue Yang; Yuqing Feng; Dan Liu; Yongfei Hu
Journal:  Microorganisms       Date:  2022-03-28

3.  Escherichia coli O88 induces intestinal damage and inflammatory response through the oxidative phosphorylation and ribosome pathway in Pekin ducks.

Authors:  Chong Li; Shuzhen Li; Jinmei Liu; Huiyi Cai; Guohua Liu; Xuejuan Deng; Wenhuan Chang
Journal:  Front Cell Infect Microbiol       Date:  2022-08-17       Impact factor: 6.073

Review 4.  Probiotics and Postbiotics as Substitutes of Antibiotics in Farm Animals: A Review.

Authors:  Daria Zamojska; Adriana Nowak; Ireneusz Nowak; Ewa Macierzyńska-Piotrowska
Journal:  Animals (Basel)       Date:  2021-12-01       Impact factor: 2.752

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.