| Literature DB >> 34278335 |
Yu Huang1, Myles McLean2, Chen Liang2, Fei Guo1.
Abstract
The cyclic GMP-AMP synthase (cGAS) is the principal DNA sensor, which binds DNA and triggers the type I interferon production. We used ISD45 or inactivated Vaccinia Virus (VACV) to stimulate cGAS and monitored cellular localization by immunofluorescence microscopy, Operetta high-content screening, and cytoplasmic/nuclear fractionation. LocNES server was used to predict cGAS nuclear export signal (NES) sequence and characterized the function by mutagenesis. This protocol provides a prototype of cGAS subcellular distribution or the identification of NES in other proteins. For complete details on the use and execution of this protocol, please refer to Sun et al. Sun et al. (2021).Entities:
Keywords: Cell Biology; Immunology; Molecular Biology
Mesh:
Substances:
Year: 2021 PMID: 34278335 PMCID: PMC8261000 DOI: 10.1016/j.xpro.2021.100649
Source DB: PubMed Journal: STAR Protoc ISSN: 2666-1667
Figure 1Identification of a functional nuclear export signal in cGAS
(A) cGAS NES directs nuclear export of EGFP. Schematic presentation of the EGFP protein fusion with the NLS from SV40 large T antigen and/or the NES of cGAS. The SV40/SV40NES EGFP signals were observed by confocal microscopy 24 h after transfection. Graphs show mean±SEM (n=3 independent experiments) representing six different microscopic fields with over 200 cells. Scale bars, 20 μm.
(B) The Operetta High-Content Screen system (PerkinElmer) was used to calculate the ratios of transfected EGFP DNA fluorescence signals between the nucleus and cytoplasm in HeLa cells shown in (A). N, predominantly nuclear; C, predominately cytosolic; C+N, nucleus and the cytoplasm. Relative scored cells are presented as the percentages of N, C or N+C containing cells in all EGFP-positive cells. The results are summarized in the bar graphs (n=3 independent experiments).
(C) Subcellular localization of cGAS mutant NES6A in HeLa cells 24 h after transfection. N, predominantly nuclear; C, predominately cytosolic; C+N, evenly distributed in the nucleus and the cytoplasm. Relative scored cells are presented as the percentages of N, C or N+C containing cells in all EGFP-positive cells. Graphs show mean±SEM (n=3 independent experiments) representing six different microscopic fields with over 200 cells. Scale bars, 20 μm.
(D) The Operetta High-Content Screen system was used to calculate the ratios of fluorescence signals between the nucleus and cytoplasm for cGAS and its mutant NES6A. The results are summarized in the bar graphs (n=3 independent experiments).
(E) Subcellular localization of cGAS and its mutant NES6A were examined by nuclear and cytoplasmic protein extraction experiment 24 h after transfection. P values of statistical significance are represented as ∗∗P <0.01,∗P<0.05. These data are from the original Figures 3B–3F in (Sun et al., 2021)
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| ISD45 (5’- TACAGATCTACTAGTGATCTATGACTGATCTGTACA | InvivoGen | tlrl-isdn |
| P1F (5’-AATTCGCCACCATGCCCAAGAAGAAGAGGAAGGTGC | Home designed and synthesized | N/A |
| P1R (5’-GATCCCGCACCTTCCTCTTCTTCTTGGGCATGGTG | Home designed and synthesized | N/A |
| P2F (5’-AATTCGCCACCATGTTGGAGAAGTTGAAGCTCCCCAA | Home designed and synthesized | N/A |
| P2R (5’-GATCCCGCACCTTCCTCTTCTTCTTGGGGAGC | Home designed and synthesized | N/A |
| cGASE-F (5’-GGCGAATTCGCCACCATGCAGCCTTGGC | Home designed and synthesized | N/A |
| cGASE-R (5’-TGGGAATCCCGAAATTCATCAAAAACTGG | Home designed and synthesized | N/A |
| NES6A-R (5’-TCGAAGCTCCGGGCGGTTGCGGCGGC | Home designed and synthesized | N/A |
| NES6A-F (5’-GGAGATATCATCGCGGCTGGCCGCCGCC | Home designed and synthesized | N/A |
| Anti-Lamin A antibody | Sigma-Aldrich | Cat# L1293, RRID: |
| Anti-β-Actin antibody | Sigma-Aldrich | Cat# A1978, RRID: |
| Anti-beta-Tubulin | ProteinTech | Cat# 10094-1AP,RRID: |
| Anti-cGAS antibody | Cell Signaling Technology | Cat# 15102, RRID: |
| IRDye 800CW Goat anti-Mouse IgG Antibody | LI-COR Biosciences | Cat# 926-32210, RRID: |
| IRDye 800CW Goat anti-Rabbit IgG Antibody | LI-COR Biosciences | Cat# 926-32211, RRID: |
| Alexa Fluor Plus 488 | Invitrogen | A32766 |
| DH5α | Transgene | CD201 |
| VACV (Tiantan strain) | Li Ruan, China CDC | N/A |
| HeLa | ATCC | CCL-2 |
| pEGFP-N1 | Clontech | 6085-1 |
| pEGFP-N1-cGAS | Home saved | N/A |
| PEI | Sigma-Aldrich | 408727 |
| PBS | Gibco | 20012027 |
| Trypsin-EDTA | Gibco | 25200-056 |
| DMEM basic (1 | Gibco | A4192101 |
| Protease inhibitors | Sigma-Aldrich | S8830 |
| Nonidet P-40 | Solarbio | N8030 |
| FBS | Gibco | 10091 |
| SDS | Solarbio | S8010 |
| Tris | Sigma-Aldrich | V900483 |
| Na3VO4 | Sigma-Aldrich | S6508 |
| NaF | Sigma-Aldrich | 201154 |
| Glycine | Sigma-Aldrich | V900144 |
| DAPI | Sigma-Aldrich | 324355 |
| DTT | Sigma-Aldrich | D9779 |
| BSA | Solarbio | A8010 |
| Triton X-100 | Solarbio | T8200 |
| Tween-20 | Solarbio | T8220 |
| Paraformaldehyde | Solarbio | P1110 |
| EDTA | Solarbio | E8040 |
| KOD plus | Toyobo | KMM-201 |
| T4 ligase | NEB | M0202S |
| T4 PNK | NEB | M0201S |
| EcoRI-HF | NEB | R3101S |
| BamH1-HF | NEB | R3136S |
| GraphPad | GraphPad Prism 7 | N/A |
| ImageJ | NIH | N/A |
| ZEN microscope software | Zeiss | N/A |
| Operetta High-Content Screen System | PerkinElmer | N/A |
| Elyra 7 Lattice SIM | Zeiss | N/A |
| LiCor Odyssey instrument | LI-COR Biosciences | N/A |
| Nitrocellulose membranes | Whatman | N/A |
| CellCarrier-96 plate | PerkinElmer | 6005550 |
| Cell culture dish (φ20 mm) | NEST | 801001 |
Buffer A (stocks can be kept at 4°C for 6 months)
| Reagents | Final concentration |
|---|---|
| 20 mM(pH7.6) | |
| 0.1 mM | |
| 2 mM | |
| 0.5 mM | |
| 0.5 mM |
Buffer B (stocks can be kept at 4°C for 6 months)
| Reagents | Final concentration |
|---|---|
| 20 mM (pH7.9) | |
| 400 mM | |
| 25%(vol/vol) | |
| 1 mM | |
| 0.5 mM | |
| 0.5 mM | |
| 0.5 mM |
RIPA (stocks can be kept at 4°C for 6 months)
| Reagents | Final concentration |
|---|---|
| 1% (vol/vol) | |
| 50 mM (pH7.4) | |
| 150 mM | |
| 0.25% | |
| 1 |
10× Running buffer (stocks can be kept at 25°C for 6 months)
| Reagents | Final concentration | Amount (for a 1 L stock) |
|---|---|---|
| 250 mM | 30.3 g | |
| 2 M | 144 g | |
| 1% | 10 g | |
| To 1 L | ||
Transfer buffer (stocks can be kept at 25°C for 6 months)
| Reagents | Final concentration | Amount (for a 1 L stock) |
|---|---|---|
| 250 mM | 30.3 g | |
| 2 M | 144 g | |
| 1% | 10 g | |
| 20% | 200 mL | |
| To 1 L | ||
PBST (stocks can be kept at 25°C for 6 months)
| Reagents | Final concentration | Amount (for a 1 L stock) |
|---|---|---|
| 0.5% | 1L | |
| 500 μL |
Permeabilization buffer (stocks can be kept at 25°C for 6 months)
| Reagents | Final concentration | Amount (for a 1 L stock) |
|---|---|---|
| 0.3% | 1L | |
| 300 μL |
Blocking buffer (compound when it is in need and stock in 4°C for 1 day)
| Reagents | Final concentration | Amount (for a 50 mL stock) |
|---|---|---|
| 5% | 50 mL | |
| 2.5 g |
| pEGFP-N1 | 1 μg |
|---|---|
| EcoRI-HF (20 U/μL) | 1 μL |
| BamHI-HF (20 U/μL) | 1 μL |
| 10 X Cutsmart buffer | 2 μL |
| ddH2O | X μL |
| Total | 20 μL |
| SV40 | Oligo P1F (100 μL) | 1 μL |
|---|---|---|
| Oligo P1R (100 μL) | 1 μL | |
| 10 | 1 μL | |
| T4 PNK | 0.5 μL | |
| ddH2O | 6.5 μL | |
| Total | 10 μL |
| SV40-NES | Oligo P2F (100 μL) | 1 μL | |
|---|---|---|---|
| Oligo P2R (100 μL) | 1 μL | ||
| 10 | 1 μL | ||
| T4 PNK | 0.5 μL | ||
| ddH2O | 6.5 μL | ||
| Total | 10 μL |
| 37°C | 30 min |
| 95°C | 5 min |
| ramp down to 25°C at 5°C/min | |
| Digested pEGFP-N1 plasmid | 1 μL |
|---|---|
| Diluted oligo | 1 μL |
| 10 | 1 μL |
| T4 Ligase (40 U/μL) | 1 μL |
| ddH2O | 6 μL |
| Total | 10 μL |
Incubate at 16°C for 12 h.
| Upstream PCR mix | |
|---|---|
| Template (pEGFP-N1-cGAS plasmid) | 1 μL (about 50 pg) |
| cGASE-F | 1 μL |
| NES6A-R | 1 μL |
| KOD Mix | 10 μL |
| ddH2O | 7 μL |
| Total | 20 μL |
| Downstream PCR mix | |
|---|---|
| Template (cGAS-EGFP plasmid) | 1 μL (about 50 pg) |
| NES6A-F | 1 μL |
| cGASE-R | 1 μL |
| KOD Mix | 10 μL |
| ddH2O | 7 μL |
| Total | 20 μL |
| PCR program | |||
|---|---|---|---|
| Step | Temperature | Time | Cycle |
| 1 | 98°C | 5min | 1 cycle |
| 2 | 98°C | 30s | Step 2–4 |
| 3 | 57°C | 30s | |
| 4 | 68°C | 1min | |
| 5 | 68°C | 1min | 1 cycle |
| 6 | 4°C | Hold | |
Gel purification of the PCR DNA products using Axygen Gel Extraction Kit.
| Mix 1 | ||
|---|---|---|
| Components | Volume | |
| Template | Upstream DNA | 1 μL |
| Downstream DNA | 1 μL | |
| KOD Mix | 10 μL | |
| ddH2O | 6 μL | |
| Total | 18 μL | |
| PCR program | |||
|---|---|---|---|
| Step | Temperature | Time | Cycle |
| 1 | 98°C | 5min | 1 cycle |
| 2 | 98°C | 30s | Step 2–4 |
| 3 | 57°C | 30s | |
| 4 | 68°C | 1min | |
| 5 | 68°C | 1min | 1 cycle |
| 6 | 4°C | Hold | |
| Step | Temperature | Time | Cycle |
|---|---|---|---|
| 1 | 98°C | 5min | 1 cycle |
| 2 | 98°C | 30s | Step 2–4 |
| 3 | 57°C | 30s | |
| 4 | 68°C | 1min | |
| 5 | 68°C | 1min | 1 cycle |
| 6 | 4°C | Hold |
| Digested pEGFP-N1 plasmid | 1 μL |
| Digested cGAS NES6A DNA | 7 μL |
| 10X T4 Ligase Buffer | 1 μL |
| T4 Ligase (40 U/μL) | 1 μL |
| Total | 10 μL |