| Literature DB >> 34276358 |
Zhen Wang1,2,3, Menglin Liu4, Di Ye1,2,3, Jing Ye1,2,3, Menglong Wang1,2,3, Jianfang Liu1,2,3, Yao Xu1,2,3, Jishou Zhang1,2,3, Mengmeng Zhao1,2,3, Yongqi Feng1,2,3, Shuwan Xu1,2,3, Wei Pan1,2,3, Zhen Luo1,2,3, Dan Li5, Jun Wan1,2,3.
Abstract
Cardiac dysfunction is a well-recognized complication of sepsis and is associated with the outcome and prognosis of septic patients. Evidence suggests that Il12a participates in the regulation of various cardiovascular diseases, including heart failure, hypertension and acute myocardial infarction. However, the effects of Il12a in sepsis-induced cardiac dysfunction remain unknown. In our study, lipopolysaccharide (LPS) and cecal ligation and puncture (CLP) model were used to mimic sepsis, and cardiac Il12a expression was assessed. In addition, Il12a knockout mice were used to detect the role of Il12a in sepsis-related cardiac dysfunction. We observed for the first time that Il12a expression is upregulated in mice after LPS treatment and macrophages were the main sources of Il12a. In addition, our findings demonstrated that Il12a deletion aggravates LPS-induced cardiac dysfunction and injury, as evidenced by the increased serum and cardiac levels of lactate dehydrogenase (LDH) and cardiac creatine kinase-myocardial band (CK-MB). Moreover, Il12a deletion enhances LPS-induced macrophage accumulation and drives macrophages toward the M1 phenotype in LPS-treated mice. Il12a deletion also downregulated the activity of AMP-activated protein kinase (AMPK) but increased the phosphorylation levels of p65 (p-p65) and NF-κB inhibitor alpha (p-IκBα). In addition, Il12a deletion aggravates CLP-induced cardiac dysfunction and injury. Treatment with the AMPK activator AICAR abolishes the deterioration effect of Il12a deletion on LPS-induced cardiac dysfunction. In conclusion, Il12a deletion aggravated LPS-induced cardiac dysfunction and injury by exacerbating the imbalance of M1 and M2 macrophages. Our data provide evidence that Il12a may represent an attractive target for sepsis-induced cardiac dysfunction.Entities:
Keywords: cardiac dysfunction; inflammation; ll12a; macrophage; sepsis
Year: 2021 PMID: 34276358 PMCID: PMC8284189 DOI: 10.3389/fphar.2021.632912
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.810
Primers for quantitative polymerase chain reaction.
| Gene | Forward primer (5′-3′) | Reverse primer (5′-3′) |
|---|---|---|
| IL-12p35 | AGTTTGGCCAGGGTCATTCC | TCTCTGGCCGTCTTCACCAT |
| IL-1β | GGGCCTCAAAGGAAAGAATC | TACCAGTTGGGGAACTCTGC |
| IL-6 | AGTTGCCTTCTTGGGACTGA | TCCACGATTTCCCAGAGAAC |
| TNF-α | CCCAGGGACCTCTCTCTAATC | ATGGGCTACAGGCTTGTCACT |
| CD80 | GGCCTGAAGAAGCATTAGCTG | GAGGCTTCACCTAGAGAACCG |
| CD86 | GCTTCAGTTACTGTGGCCCT | TGTCAGCGTTACTATCCCGC |
| CD163 | TCCACACGTCCAGAACAGTC | CCTTGGAAACAGAGACAGGC |
| CD206 | CAGGTGTGGGCTCAGGTAGT | TGTGGTGAGCTGAAAGGTGA |
| iNOS | CGAAACGCTTCACTTCCAA | TGAGCCTATATTGCTGTGGCT |
| Arg-1 | AACACGGCAGTGGCTTTAACC | GGTTTTCATGTGGCGCATTC |
| GAPDH | ACTCCACTCACGGCAAATTC | TCTCCATGGTGGTGAAGACA |
FIGURE 1Il12a expression is upregulated in mice after LPS treatment. (A,B) Western blot and RT-PCR analysis of Il12a protein and mRNA expression levels in the hearts of each group (n = 4). (C) Immunofluorescence staining for Il12a in the hearts of each group (n = 4; scale bar, 50 μm). (D) The source of Il12a in the heart of mice after LPS treatment was detected by double immunofluorescence staining (n = 4; scale bar, 50 μm). *p < 0.05 compared with the sham group.
FIGURE 2Il12a deletion aggravates LPS-induced cardiac injury. (A) Effect of Il12a deficiency on the survival rate after LPS treatment (n = 10). (B,C) CK-MB and LDH serum levels were assessed in each group (n = 4). (D,E) The cardiac levels of CK-MB and LDH were measured in each group (n = 4). *p < 0.05 compared with the sham + WT group; # p < 0.05 compared with the LPS + WT group.
FIGURE 3Il12a deletion exacerbates LPS-induced cardiac dysfunction. (A–D) Echocardiographic analysis of LVEDd, LVESd, LVEF and LVFS in each group (n = 8). (D–E) Hemodynamic analysis of +dP/dt and -dP/dt in each group (n = 6). *p < 0.05 compared with the sham + WT group; # p < 0.05 compared with the LPS + WT group.
FIGURE 4Il12a deletion mediates macrophage polarization in the heart. (A–C) RT-PCR analysis of IL-1β, IL-6 and TNF-α mRNA expression in each group (n = 4). (D) Immunohistochemical analysis of CD68 in heart sections (n = 4; scale bar, 50 μm). *p < 0.05 compared with the sham + WT group; # p < 0.05 compared with the LPS + WT group.
FIGURE 5Il12a deletion mediates macrophage polarization in the heart. (A) Immunofluorescence analysis of CD80 and CD206 in the hearts of each group (n = 4; scale bar, 50 μm) (B) RT-PCR analysis of CD80, CD86, iNOS, CD163, CD206 and Arg-1 mRNA expression in hearts of each group (n = 4). *p < 0.05 compared with the sham + WT group; # p < 0.05 compared with the LPS + WT group.
FIGURE 6Il12a deletion aggravates LPS-induced myocardial apoptosis. (A) Western blot analysis of Bax, Bcl-2 and c-caspase-3 protein in each group (n = 4). (C) TUNEL staining and the quantitative results of heart tissues in each group (n = 4; scale bar, 50 μm). *p < 0.05 compared with the sham + WT group; #p < 0.05 compared with the LPS + WT group.
FIGURE 7Il12a deletion mediates macrophage polarization via the AMPK/NF-κB pathway. (A) Western blot analysis of p-AMPK, AMPK, p-p65, p65, p-IκBα and IκBα protein in each group (n = 4). *p < 0.05 compared with the sham + WT group; # p < 0.05 compared with the LPS + WT group.
FIGURE 8Il12a deletion aggravates CLP-induced cardiac injury. (A) Effect of Il12a deficiency on the survival rate after CLP treatment (n = 10). (B–C) CK-MB and LDH serum levels were assessed in each group (n = 4). (D–E) The cardiac levels of CK-MB and LDH were measured in each group (n = 4). *p < 0.05 compared with the sham + WT group; # p < 0.05 compared with the CLP + WT group.
FIGURE 9Il12a deletion exacerbates CLP-induced cardiac dysfunction. (A–D) Echocardiographic analysis of LVEDd, LVESd, LVEF and LVFS in each group (n = 8). (D,E) Hemodynamic analysis of +dP/dt and -dP/dt in each group (n = 6). *p < 0.05 compared with the sham + WT group; # p < 0.05 compared with the CLP + WT group.
FIGURE 10AMPK activation abolishes the deterioration effect of Il12a deletion on LPS-induced cardiac dysfunction. (A) Effect of Il12a deficiency on the survival rate after CLP treatment (n = 10). (B,C) CK-MB and LDH serum levels were assessed in each group (n = 4). (D,E) Echocardiographic analysis of LVEF and LVFS in each group (n = 4). *p < 0.05 compared with the LPS + WT group; # p < 0.05 compared with the LPS + KO group.
FIGURE 11AMPK activation abolishes Il12a deletion mediated M1 macrophage polarization RT-PCR analysis of CD80 (A), iNOS (B), CD206 (C), Arg-1 (D), IL-1 (E), IL-6 (F) and TNF-α (G) mRNA expression in each group (n = 4). *p < 0.05 compared with the LPS + WT group; # p < 0.05 compared with the LPS + KO group.