Effects of dietary sodium butyrate on growth, digestive enzymes, body composition and nutrient retention-related gene expression of juvenile yellow catfish (Pelteobagrus fulvidraco).

An 8-week feeding trial was conducted to evaluate the effects of sodium butyrate (SB) on growth, digestive enzymes, body composition and nutrient retention-related gene expression of juvenile yellow catfish (Pelteobagrus fulvidraco). Five isonitrogenous and isolipidic diets (420 g/kg protein and 90 g/kg lipid) were formulated to contain 0 (control), 250, 500, 1,000 or 2,000 mg/kg SB. Triplicate groups of 40 fish (BW = 1.26 ± 0.01 g) per tank (300-L cylindrical fiberglass tanks) for each diet were fed to apparent satiation twice daily. Stomach, hepatopancreas and intestine samples were obtained for digestive enzymes activities analyses. A real-time quantitative PCR analysis was performed to determine the relative expression of target of rapamycin (TOR) and lipoprotein lipase (LPL) in the hepatopancreas and intestine. Fish fed the diets supplemented with SB at 500 and 1,000 mg/kg showed significantly higher specific growth rate and significantly lower feed conversion ratio compared to the control (P < 0.05). Dietary SB inclusion did not alter activities of intestinal amylase, creatine kinase and sodium-potassium adenosine triphosphatase (Na+/K+-ATPase), but increased activities of hepatic trypsin, stomachic lipase, intestinal lipase, alkaline phosphatase and γ-glutamyl transpeptidase for fish fed 1,000 mg/kg SB compared to the control (P < 0.05). Intestine length index, intestine somatic index, fold height and muscular thickness of distal intestine were significantly higher in 1,000 mg/kg SB groups compared to the control (P < 0.05). Significantly higher levels of whole-body crude protein, ash, calcium, phosphorus, nutrition retention and relative mRNA of intestinal TOR were observed in 1,000 mg/kg SB group (P < 0.05). Whole-body lipid content and hepatopancreas LPL mRNA expression in 2,000 mg/kg SB group were significantly higher than the control (P < 0.05). Relative mRNA levels of intestinal LPL and hepatopancreas TOR were significantly higher in the 500 mg/kg SB group compared to those in other groups (P < 0.05). The increased growth performance, digestive enzymes and nutrient retention in fish fed the diets supplemented with SB at 500 and 1,000 mg/kg suggests that SB can be a desirable growth promoter as an antibiotic alternative in diets.

Introduction

Organic acids are organic carboxylic compounds including acetic, butyric, citric, formic, lactic, propionic and sorbic acids (Hoseinifar et al., 2017; Ng and Koh, 2017). Feed supplementation with organic acids has been shown to improve health and growth performance in various fish and crustacean species by altering the gastrointestinal tract function and energy metabolism, improving nutrition retention, increasing the availability of nutrients and inhibiting the growth of pathogenic bacteria (Ng and Koh 2017; Hoseinifar et al., 2017). Butyrate is one of the most important short-chain fatty acids, which presents in the gastrointestinal tract as a main end product of anaerobic bacterial fermentation of carbohydrates. Sodium butyrate (SB) is solid, stabile and much less odorous compared to butyrate, and SB is more commonly added to animal feeds (Guilloteau et al., 2009). Increasingly, SB is being investigated as a dietary additive in various aquatic animals, to improve their growth, nutrient utilization and intestinal health (Abdel-Latif et al., 2020). Positive effects of dietary SB on growth performance have been confirmed in fish, such as sea bream Sparus aurata (Robles et al., 2013), common carp Cyprinus carpio (Liu et al., 2014), tilapia Oreochromis niloticus (Ahmed and Sadek, 2015), grass carp Ctenopharyngodon idellus (Liu et al., 2017), European sea bass Dicentrarchus labrax (Abdel-Mohsen et al., 2018), golden pompano Trachinotus ovatus (Zhou et al., 2019), Nile tilapia O. niloticus (Jesus et al., 2019a), turbot Scophthalmus maximus L. (Liu et al., 2019) and Asian seabass L. calcarifer (Aalamifar et al., 2020).

Fish growth is closely related to the digestive and absorptive abilities of digestive organs (Mitra et al., 2008). Jesus et al. (2019b) reported that protected forms of SB improved absorption capacity of nutrients through increasing length, perimeter and villus area of the anterior region of the intestinal tract during the sexual reversion period. The improvement of digestion and absorption of nutrients was characterized by the increase in activity of digestive enzymes, e.g., trypsin, chymotrypsin, lipase and amylase, and brush-border membrane enzymes, e.g., alkaline phosphatase, sodium–potassium adenosine triphosphatase (Na+/K+-ATPase) and creatine kinase (Krogdahl and Marie Bakke-McKellep, 2005; Tibaldi et al., 2006). Alkaline phosphatase is used as a marker of nutrient absorption and takes part in the absorption of lipid, glucose, calcium and inorganic phosphate (Villanueva et al., 1997). Na+/K+-ATPase created the potential energy of the Na gradient for many transport systems and the activity of this enzyme could indirectly reflect the absorption ability of the nutrient, such as amino acids, phosphate or glucose (Hakim et al., 2009). Creatine kinase is associated with energy metabolism and the coupling of ATP and kinase (Wallimann and Hemmer, 1994) and γ-glutamyl transpeptidase is related to peptide transport (Griffith and Meister, 1980). Dietary SB could enhance the activities of intestinal protease, amylase, alkaline phosphatase and Na+/K+-ATPase of golden pompano (Zhou et al., 2019). Furthermore, dietary SB enhanced intestinal physical barrier function referring to NF-E2-related factor 2 (Nrf2), c-Jun N-terminal protein kinase (JNK) and myosin light chain kinase (MLCK) signaling pathways of young grass carp (Wu et al., 2018). The syntheses of proteins and lipids are key processes involved in growth response (Mommsen, 2001). In gilthead sea bream and yellow drum (Nibea albiflora) (Richardson), the improvement of growth performance may be due to the increase in the availability of essential amino acids of fish fed SB diets (Robles et al., 2013; Wu et al., 2019). Wu et al. (2019) suggested that supplementation of 0.15% SB increased crude lipid content of the whole body in yellow drum. The limiting step in protein synthesis is translation initiation, which is regulated by the signaling pathway of target of rapamycin (TOR) (Seiliez et al., 2008). Similarly, lipoprotein lipase (LPL) is an important lipid regulatory enzyme involved in supplying free fatty acids for storage in adipocytes or for oxidation in other tissues (Zheng et al., 2013). Rainbow trout genetically selected for greater muscle fat content displays increased activation of liver TOR signaling and lipogenic gene expression (Skiba-Cassy et al., 2009). Although some preliminary work has been conducted in fish species previously, studies concerning intestinal health and nutrient retention of dietary SB in fish are still limited. Hence, it is necessary to address the effects of SB on intestinal health and nutrient retention of fish.

Yellow catfish (Pelteobagrus fulvidraco) is one of omnivorous freshwater fish species, which has a delicious quality and high nutritional value. Considering the increasing interest in dietary SB, and increasing popularity of yellow catfish as a food fish that is a promising farmed fish in aquaculture, evaluating the relationship of SB to growth, feed utilization and nutrient retention of this commercially important species would likely benefit the industry. Thus, this study was conducted to study the effects of SB on growth, digestive enzymes, body composition and nutrient retention related gene expression of juvenile yellow catfish (P. fulvidraco).

Materials and methods

All experimental procedures were carried out in accordance with the Guidelines for Experimental Animals by the Guangdong Academy of Agricultural Sciences, China. The animal use and care protocol was reviewed and approved by the Animal Care and Use Committee of Guangdong Academy of Agricultural Sciences (SC-GDAAS-2019-018).

Experimental design and diets

Formulation and proximate composition of experimental diets are presented in Table 1. Fishmeal, soybean, rapeseed meal and corn gluten meal were used as protein sources. Wheat flour, fish oil and soybean oil were used as carbohydrate and lipid sources. The levels of nutrients met the requirements of yellow catfish according to previous studies conducted in our laboratory (Cao et al., 2012; Chen et al., 2016; Zhao et al., 2020). Five isonitrogenous and isolipidic diets were formulated to contain SB at 0 (control), 250, 500, 1,000 or 2,000 mg/kg, by supplementing SB (purity ≥ 98%). All ingredients were ground through a 60-mesh screen. SB was mixed with dietary water sources and then mixed with the other feedstuffs. The diets were prepared by mixing the ingredients before adding fish oil, soybean oil and water using a kneading machine (NH-10, South China University of Technology, Guangzhou, China). The feed ingredients were thoroughly mixed with fish oil, soybean oil and the appropriate amount of water in a strong stirrer (B20, Guangzhou Panyu Lifeng Food Machinery Factory, Guangzhou, China) and the mixture was processed into 1.5-mm diameter pellets using a twin screw extruder (SLX-80, South China University of Technology, Guangzhou, China) and dried at 55 °C for 6 h. After drying, diets were stored at −20 °C in plastic bags until being used.

Table 1

Formulation and proximate composition of experimental diets (g/kg, DM basis).

Item	Dietary SB1 supplementation
	0 mg/kg	250 mg/kg	500 mg/kg	1,000 mg/kg	2,000 mg/kg
Ingredients
Peru fish meal2	250.0	250.0	250.0	250.0	250.0
Soybean meal2	300.0	300.0	300.0	300.0	300.0
Rapeseed meal2	90.0	90.0	90.0	90.0	90.0
Corn gluten meal2	60.0	60.0	60.0	60.0	60.0
Wheat flour2	223.0	223.0	223.0	223.0	223.0
Menhaden oil2	25.0	25.0	25.0	25.0	25.0
Soybean oil2	25.0	25.0	25.0	25.0	25.0
Vitamin premix3	1.0	1.0	1.0	1.0	1.0
Mineral premix4	5.0	5.0	5.0	5.0	5.0
Ca(H2PO4)22	15.0	15.0	15.0	15.0	15.0
Vitamin C ester2	1.0	1.0	1.0	1.0	1.0
Choline chloride2	3.0	3.0	3.0	3.0	3.0
Microcrystalline Cellulose2	2.0	1.75	1.5	1.0	0
SB	0.0	0.25	0.5	1.0	2.0
Proximate nutrition composition
Crude protein	426	423	420	425	422
Crude lipid	90.1	87.7	90.1	85.6	84.5
Ash	82.5	81.9	81.9	83.0	84.2
Moisture	77.9	86.9	85.7	80.7	81.8

SB = sodium butyrate.

Provided by Sigma–Aldrich, MO, USA. The actual SB concentrations were 0.0 (control), 158.1, 314.7, 612.3 and 1,193.5 mg/kg diet, which were determined by high-performance liquid chromatography (HPLC) (Liu et al., 2014).

Provided by Guangzhou Fishtech Fisheries Science & Technology Co., Ltd (Guangzhou, China).

One kilogram of vitamin premix contained the following: vitamin A 3,200,000 IU, vitamin B1 4 g, vitamin B2 8 g, vitamin B6 4.8 g, vitamin B12 0.016 g, vitamin D 1,600,000 IU, vitamin E 16 g, vitamin K 4 g, nicotinic acid 28 g, calcium pantothenate 16 g, folic acid 1.28 g, inositol 40 g, biotin 0.064 g, wheat middling, 876.84 g. Moisture ≤10%.

One kilogram of mineral premix contained the following: MgSO4·H2O 12 g, Ca(IO3)2 9 g, KCl 36 g, Met-Cu 1.5 g, ZnSO4·H2O 10 g, FeSO4·H2O 1 g, Met-Co 0.25 g, NaSeO3 0.0036 g, zeolite 930.25 g. Moisture ≤10%.

Fish and experimental conditions

Yellow catfish were obtained from Guangzhou Jinglong Fisheries (Guangzhou, China). The fish were acclimatised with the control diet for 2 weeks prior to this trial. The feeding trial was conducted in an indoor re-circulating aquaculture system at the Animal Science Institute of Guangdong Academy of Agricultural Sciences (Guangzhou, China). The circling waterflow rate in each aquarium was maintained at 1.5 L/min. Fish (1.26 ± 0.01 g) were randomly stocked into fifteen 330-L cylindrical fiberglass tanks (the water volume was 300 L) at 40 fish per tank in triplicate. Fish were fed 2 times per day at 8:30 and 18:30 to apparent satiation. The uneaten feed was collected to calculate total consumption. The amounts of diets consumed by the fish in each tank were recorded daily, and adjusted according to the amounts consumed the day before. The water source was drawn from underground and one-third of the water in the tank was exchanged weekly. Aeration was also provided to maintain enough dissolved oxygen. Water samples were collected twice a week for chemical analysis. During the 56-d feeding trial, natural water temperature ranged from 28 to 32 °C, pH 7.4 to 7.9, ammonia ≤0.02 mg/L, nitrite ≤0.2 mg/L and dissolved oxygen >6.0 mg/L. The experimental units were under a natural light and dark cycle (approximately 12 h light:12 h dark).

Sample collection and analysis

After a fasting period of 24 h, fish in each tank were individually weighed and counted at the end of the feeding trial. Prior to sampling, fish were anesthetized in tricaine methane sulfonate (120 mg/L). Ten fish before the experiment and 5 fish at the end of the experiment per tank were obtained to determinate the initial and final whole-body composition, respectively. The intestine, hepatopancreas and stomach of 6 fish per tank were collected and frozen in liquid nitrogen, then stored at −70 °C until analysis. Another 3 fish per tank were randomly selected to measure hepatosomatic index (HSI) and intestine somatic index (ISI).

The whole intestine, hepatopancreas and stomach samples from each tank were homogenized in ice-cold physiological saline solution and centrifuged at 6,000 × g at 4 °C for 20 min. The supernatant was stored at −70 °C for analysis of protein and enzyme activities. The protein concentrations of homogenates were determined by the method of Bradford (1976).

The moisture, crude protein, crude lipid and ash contents in the diets and whole body of fish were determined according to the Association of Official Analytical Chemists (Association of Official Analytical Chemists (AOAC), 1995). Moisture was determined by drying the samples to a constant weight at 105 °C. Crude protein (N × 6.25) was determined by the Kjeldahl method using a semi-automatic Kjeldahl System after acid digestion. Crude lipid was determined by using the Soxhlet extraction method. Crude ash was determined after burning at 550 °C in a muffle furnace. Commercial kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) were used to determine intestine enzyme activities of protease, lipase, amylase, alkaline phosphatase (AKP), γ-glutamyl transpeptidase (γ-GT), creatine kinase (CK) and Na+/K+-ATPase, following the corresponding manufacturer's instructions.

Three fish per tank were randomly sampled and dissected to obtain the proximal intestine (1 cm after the stomach), mid intestine and distal intestine (1 cm before the anus) according to the method described by Anguiano et al. (2013). The samples were dissected and fixed immediately in the 4% buffered formalin solution for 24 h, and then transferred to 70% ethanol. Subsequently, the tissues were sliced, embedded in paraffin and processed via standard hematoxylin and eosin staining (Cheng et al., 2011). Examination was done by light microscopy (Eclipse E100, Tokyo, Japan) with a photomicrograph attached to a computer with Image-Pro Plus 6 software (Media Cybernetics, Maryland, USA). Image collection, slices measurement (n = 9) and each slice (n = 8) for fold height and muscular thickness were determined.

RNA extraction and real-time quantitative PCR analysis

Total RNA was extracted from the intestine and hepatopancreas according to the Trizol protocols (Invitrogen, USA). Total RNA was incubated with RNase-free DNase (Dalian Takara Co. Ltd., China) to remove the contaminating genomic DNA. Then, the quality and quantity were assessed using agarose gel (1.2%) electrophoresis and spectrophotometric (a 260:280 nm ratio) analysis, respectively. The RNA was then reverse transcribed to cDNA using PrimeScript RT reagent kit (Takara, Japan). The real-time quantitative PCR (RT-qPCR) was performed in an ABI 7500 Real-Time PCR machine (Applied Biosystems, USA). The amplification was performed in a final volume of 20 μL containing 1 μL cDNA product, 10 μL SYBR Premix ExTaq II (Takara, Japan), 0.4 μL of each respective primer, and 8.2 μL dH2O. Primers (shown in Table 2) for TOR and lipoprotein lipase (LPL) were designed using primer 5.0 (PREMIER Biosoft International, Palo Alto, CA, USA) based on the sequences obtained from the published sequences of yellow catfish. A melting curve analysis was generated following the amplification to check and verify the specificity of RT-qPCR products. Beta-actin was used as a housekeeping gene to normalize target gene transcript levels. The target and housekeeping gene amplification efficiency were calculated according to the specific gene standard curves generated from 10-fold serial dilutions. After verifying that the primers amplified with an efficiency of approximately 100%, the 2−ΔΔCT method was used for calculating the expression results according to Livak and Schmittgen (2001).

Table 2

Primers used in real-time quantitative PCR.

Target	GenBank ID	Forward primer (5′- 3′)	Reverse primer (5′- 3′)
TOR	KY072931	GTGAAGGACCTGACTCAAGCC	TGATAGACTGGATGCGTATGATTGG
LPL	JX992743	GACCAGAGAGATGATGCCGT	TAGCTTAGCTGGCTCTTGCTG
β-Actin	XM027148463	TTCGCTGGAGATGATGCT	CGTGCTCAATGGGGTACT

TOR = target of rapamycin; LPL = lipoprotein lipase.

Statistical analysis

Statistical analyses were carried out using the SPSS version 20.0 software package (SPSS Inc., Chicago, IL, USA). All data were subjected to the homogeneity of variance tests before one-way ANOVA and a multiple range test (Tukey's test) was used. The significance criterion was P < 0.05. Data were presented as means ± SD.

Results

Growth performance

Weight gain (WG), specific growth rate (SGR), feed conversion ratio (FCR) and survival rate (SR) are presented in Table 3. The WG, SGR and FCR were affected by the dietary SB levels (P < 0.05). There was a significant increase in WG in 500 mg/kg SB group compared with that of the control (P < 0.05). Fish in 500 and 1,000 mg/kg SB groups showed a significantly higher SGR and a significantly lower FCR than that of control (P < 0.05). The SR was not influenced by the inclusion of SB in the diets (P > 0.05).

Table 3

Effects of different levels of sodium butyrate (SB) supplementation on growth performance and nutrition retention of juvenile yellow catfish.1

Item	Dietary SB supplementation
	0 mg/kg	250 mg/kg	500 mg/kg	1,000 mg/kg	2,000 mg/kg
WG2, g	11.61 ± 0.57a	12.56 ± 1.24ab	13.36 ± 0.22b	13.08 ± 0.56ab	12.46 ± 0.88ab
SGR3, %/day	4.16 ± 0.08a	4.28 ± 0.15ab	4.38 ± 0.03b	4.35 ± 0.06b	4.27 ± 0.11ab
FCR4	1.20 ± 0.04b	1.08 ± 0.09ab	1.03 ± 0.01a	0.99 ± 0.09a	1.13 ± 0.13ab
SR5, %	92.50 ± 4.33a	95.83 ± 1.44a	92.50 ± 5.00a	91.67 ± 8.04a	94.17 ± 2.89a
PRV6, %	25.48 ± 1.75a	29.99 ± 3.10b	30.44 ± 2.23b	31.98 ± 1.24b	27.66 ± 2.72ab
LRV7, %	56.44 ± 3.79a	69.55 ± 4.75b	66.75 ± 1.16b	65.28 ± 5.15b	68.21 ± 7.05b
CaRV8, %	47.71 ± 5.51a	55.48 ± 9.34ab	56.48 ± 2.82ab	64.61 ± 2.61b	49.48 ± 2.31a
PhRV9, %	52.12 ± 2.28a	62.51 ± 10.45abc	65.34 ± 4.94bc	70.59 ± 6.46c	56.29 ± 6.16ab

WG = weight gain; SGR = specific growth rate; FCR = feed conversion ratio; SR = survival rate; PRV = protein retention value; LRV = lipid retention value; CaRV = calcium retention value; PhRV = phosphorus retention value.

a,b, c Within a row, means with different superscripts represent significant difference by Tukey's test (P < 0.05). Data presented are means ± SD of 3 replicates.

Initial fish average weight = 1.26 ± 0.01 g; initial fish whole-body composition (% wet weight): protein, 15.13; lipid, 3.29; calcium, 1.43; phosphorus, 0.92.

WG (g) = Final weight (g) − Initial weight (g).

SGR (%/day) = 100 × [ln (final weight) (g) − ln (initial weight) (g)]/Number of days.

FCR = Dry diet fed (g)/Wet weight gain (g).

SR (%) = 100 × (Finial number of fish)/(Initial number of fish).

PRV (%) = 100 × [Final weight (g) × Final fish protein (%) − Initial weight (g) × Initial fish protein (%)]/[Feed intake (g) × Feed protein (%)].

LRV (%) = 100 × [Final weight (g) × Final fish lipid (%) − Initial weight (g) × Initial fish lipid (%)]/[Feed intake (g) × Feed lipid (%)].

CaRV (%) = 100 × [Final weight (g) × Final fish calcium (%) − Initial weight (g) × Initial fish calcium (%)]/[Feed intake (g) × Feed calcium (%)].

PhRV (%) = 100 × [Final weight (g) × Final fish phosphorus (%) − Initial weight (g) × Initial fish phosphorus (%)]/[Feed intake (g) × Feed phosphorus (%)].

Enzyme activities in stomach, hepatopancreas and intestine

Protease, trypsin, lipase, amylase, AKP, γ-GT (γ-glutamyl transpeptidase), CK (creatine kinase) and Na+/K+-ATPase activities are shown in Table 4, Table 5. Lipase activity of stomach in SB groups was significantly higher than that in the control group (P < 0.05). Trypsin activity in hepatopancreas of fish in 500 and 1,000 mg/kg SB groups was significantly higher as compared with that in control and 250 mg/kg SB groups (P < 0.05). Lipase activity in intestine of fish in 1,000 mg/kg SB group was significantly higher than that in control (P < 0.05). There was a significant increase of intestinal AKP activity in 500 and 1,000 mg/kg SB groups compared with that of control and 2,000 mg/kg SB groups (P < 0.05). The activity of γ-GT in intestine of fish in 1,000 and 2,000 mg/kg SB groups was higher as compared with that in control (P < 0.05). The activities of protease in stomach, trypsin, CK and Na+/K+-ATPase in intestine, lipase in hepatopancreas, amylase in stomach, hepatopancreas and intestine were not influenced by the inclusion of SB in the diets (P > 0.05).

Table 4

Effects of different levels of sodium butyrate (SB) supplementation on digestive enzymes activities in stomach, hepatopancreas and intestine of yellow catfish.

Item	Dietary SB supplementation
	0 mg/kg	250 mg/kg	500 mg/kg	1,000 mg/kg	2,000 mg/kg
Stomach
Protease, U/g protein	15.50 ± 1.19a	15.00 ± 3.06a	14.39 ± 1.70a	19.05 ± 0.46a	15.56 ± 3.96a
Lipase, U/g protein	33.19 ± 2.45a	39.74 ± 3.11b	42.39 ± 4.23b	44.63 ± 4.31b	42.03 ± 0.53b
Amylase, U/mg protein	0.64 ± 0.13a	0.80 ± 0.25a	0.62 ± 0.02a	0.65 ± 0.13a	0.67 ± 0.04a
Hepatopancreas
Trypsin, U/g protein	171.6 ± 14.31a	181.8 ± 15.12a	231.0 ± 30.40b	239.9 ± 16.21b	203.8 ± 24.78ab
Lipase, U/g protein	8.19 ± 0.31a	9.97 ± 1.20a	8.51 ± 0.31a	9.00 ± 0.90a	9.05 ± 1.72a
Amylase, U/mg protein	0.64 ± 0.10a	0.81 ± 0.16a	0.67 ± 0.06a	0.64 ± 0.12a	0.81 ± 0.24a
Intestine
Trypsin, U/g protein	389.9 ± 31.69a	421.1 ± 69.18a	423.8 ± 68.27a	429.4 ± 58.45a	419.9 ± 42.23a
Lipase, U/g protein	17.85 ± 1.25a	19.30 ± 1.93a	22.80 ± 3.13ab	24.63 ± 1.49b	21.07 ± 3.89ab
Amylase, U/mg protein	1.62 ± 0.07a	1.38 ± 0.26a	1.55 ± 0.06a	1.60 ± 0.27a	1.47 ± 0.05a

a, b Within a row, means with different superscripts represent significant difference by Tukey's test (P < 0.05). Data presented are means ± SD of 3 replicates.

Table 5

Effects of different levels of sodium butyrate (SB) supplementation on intestinal brush-border membrane enzymes activities of yellow catfish (U/mg protein).

Item	Dietary SB supplementation
	0 mg/kg	250 mg/kg	500 mg/kg	1,000 mg/kg	2,000 mg/kg
AKP	78.68 ± 10.92a	96.33 ± 10.50ab	119.05 ± 18.99b	105.72 ± 6.83b	81.35 ± 10.03a
γ-GT	16.13 ± 1.85a	19.13 ± 1.57ab	18.26 ± 2.14ab	21.12 ± 1.86bc	24.14 ± 3.40c
CK	0.40 ± 0.03a	0.38 ± 0.02a	0.42 ± 0.08a	0.41 ± 0.07a	0.36 ± 0.04a
Na+/K + -ATPase	3.64 ± 0.81a	3.49 ± 0.61a	4.02 ± 0.93a	4.39 ± 0.68a	3.91 ± 0.66a

AKP = alkaline phosphatase; γ-GT = γ-glutamyl transpeptidase; CK = creatine kinase; Na+/K+-ATPase = sodium–potassium adenosine triphosphatase.

a, b, c Within a row, means with different superscripts represent significant difference by Tukey's test (P < 0.05). Data presented are means ± SD of 3 replicates.

Hepatopancreas and intestine morphometric parameters

Hepatopancreas and intestine morphometric parameters are shown in Table 6. Intestine somatic index in 500, 1,000 and 2,000 mg/kg SB groups was significantly higher as compared with control and 250 mg/kg groups (P < 0.05). Intestine length index (ILI), intestinal protein content (IPC) and hepatopancreatic protein content (HPC) in 1,000 mg/kg SB group were significantly higher as compared with those in control (P < 0.05). There was a significant increase of fold height in proximal intestine (PI) in 500 and 1,000 mg/kg SB groups compared with that of control (P < 0.05). Muscular thickness in PI was significantly higher in 500 mg/kg SB group than that in control (P < 0.05). Significantly higher values of fold height and muscular thickness in distal intestine (DI) were observed in 250, 500 and 1,000 mg/kg SB groups (P < 0.05).

Table 6

Effects of different levels of sodium butyrate (SB) supplementation on morphology and nutrient content of intestine and hepatopancreas of yellow catfish.

Item	Dietary SB supplementation
	0 mg/kg	250 mg/kg	500 mg/kg	1,000 mg/kg	2,000 mg/kg
ILI1	0.81 ± 0.08a	0.83 ± 0.09ab	0.84 ± 0.08ab	0.88 ± 0.06b	0.83 ± 0.07ab
ISI2, %	1.88 ± 0.26a	1.90 ± 0.30a	2.18 ± 0.56b	2.34 ± 0.44b	2.18 ± 0.33b
IPC3, %	4.13 ± 0.34a	4.47 ± 0.41a	4.72 ± 0.37ab	5.43 ± 0.72b	4.52 ± 0.47ab
HSI4, %	1.77 ± 0.26a	1.96 ± 0.32a	1.84 ± 0.25a	1.88 ± 0.36a	1.89 ± 0.37a
HPC5, %	7.87 ± 0.27a	7.98 ± 0.55ab	8.26 ± 0.65ab	8.79 ± 0.36b	8.38 ± 0.30ab
Fold height, μm
PI	438.49 ± 26.64a	535.53 ± 57.52ab	580.30 ± 47.15b	600.67 ± 33.26b	512.99 ± 81.82ab
MI	280.34 ± 38.49a	346.78 ± 45.66a	351.76 ± 38.47a	313.57 ± 30.67a	314.46 ± 26.37a
DI	251.72 ± 30.27a	303.91 ± 19.29b	321.35 ± 30.46b	327.42 ± 27.99b	281.77 ± 21.63ab
Muscular thickness, μm
PI	91.32 ± 18.97a	102.31 ± 6.87ab	124.19 ± 11.40b	106.53 ± 7.49ab	107.356 ± 9.38ab
MI	52.06 ± 9.52a	63.52 ± 10.53a	58.82 ± 9.73a	64.51 ± 7.71a	54.38 ± 13.43a
DI	54.75 ± 6.20a	75.77 ± 12.03b	70.36 ± 7.528b	72.81 ± 6.95b	62.94 ± 6.68ab

ILI = intestine length index; ISI = intestine somatic index; IPC = intestinal protein content; HSI = hepatosomatic index; HPC = hepatopancreatic protein content; PI = proximal intestine; MI = mid intestine; DI = distal intestine.

a, b Within a row, means with different superscripts represent significant difference by Tukey's test (P < 0.05). Data presented are means ± SD of 3 replicates.

ILI = Intestine length (cm)/Total body length (cm).

ISI (%) = 100 × Intestine weight (g)/Body weight (g).

IPC (%) = 100 × Intestine protein (g)/Intestine weight (g).

HSI (%) = 100 × Hepatopancreas weight (g)/Body weight (g).

HPC (%) = 100 × Hepatopancreas protein (g)/Hepatopancreas weight (g).

Whole body composition and nutrition retention value

Dry matter, crude protein, crude lipid, ash, calcium and phosphorus contents are shown in Table 7. Significantly higher contents of crude protein and phosphorus were observed in the 1,000 mg/kg SB group compared to those in control and 2,000 mg/kg SB groups (P < 0.05). Crude lipid content in the control and 1,000 mg/kg SB groups were significantly lower than that in 2,000 mg/kg SB group (P < 0.05). Ash in 1,000 mg/kg SB group was higher as compared with control (P < 0.05). Calcium content in 1,000 mg/kg SB group was higher as compared with those in other groups (P < 0.05). Dry matter was not influenced by the inclusion of SB in the diets (P > 0.05).

Table 7

Effects of different levels of sodium butyrate (SB) supplementation on whole body composition of juvenile yellow catfish (% wet weight).

Item	Dietary SB supplementation
	0 mg/kg	250 mg/kg	500 mg/kg	1,000 mg/kg	2,000 mg/kg
Dry matter	25.22 ± 0.47a	25.01 ± 0.14a	24.98 ± 0.34a	25.38 ± 0.65a	25.24 ± 0.19a
Crude protein	14.16 ± 0.26a	14.38 ± 0.22ab	14.41 ± 0.27ab	14.91 ± 0.22b	14.16 ± 0.20a
Crude lipid	6.29 ± 0.11a	6.71 ± 0.32ab	6.39 ± 0.24ab	6.16 ± 0.35a	6.98 ± 0.18b
Ash	2.81 ± 0.21a	2.88 ± 0.20ab	2.99 ± 0.19ab	3.21 ± 0.12b	2.92 ± 0.18ab
Calcium	0.79 ± 0.05a	0.78 ± 0.03a	0.79 ± 0.05a	0.87 ± 0.02b	0.76 ± 0.04a
Phosphorus	0.53 ± 0.02a	0.45 ± 0.03ab	0.55 ± 0.03ab	0.59 ± 0.04b	0.52 ± 0.03a

a, b Within a row, means with different superscripts represent significant difference by Tukey's test (P < 0.05). Data presented are means ± SD of 3 replicates.

Dietary SB levels had a significant effect on protein, lipid, calcium and phosphorus retention in the whole body of juvenile yellow catfish (P < 0.05) (Table 1). A significantly higher value of protein retention was observed in 250, 500 and 1,000 mg/kg SB groups (P < 0.05). Lipid retention in 250, 500, 1,000 and 2,000 mg/kg SB groups was significantly higher as compared with control (P < 0.05). Calcium retention in 1,000 mg/kg SB group was significantly higher as compared with those in control and 2,000 mg/kg SB groups (P < 0.05). Phosphorus retention in 500 and 1,000 mg/kg SB groups was significantly higher than that in control (P < 0.05).

Relative expression of TOR and LPL in intestine and hepatopancreas

Relative expression of TOR and LPL mRNA in intestine and hepatopancreas are shown in Fig. 1. Relative mRNA levels of intestinal TOR in 500, 1,000 and 2,000 mg/kg SB groups were significantly up-regulated (P < 0.05). Relative mRNA levels of intestinal LPL and hepatopancreas TOR were significantly up-regulated and the values were higher in 500 mg/kg SB group as compared with those in other groups (P < 0.05). The relative mRNA level of hepatopancreas LPL was significantly up-regulated and higher in the 2,000 mg/kg SB group as compared with that in control, 250 and 1,000 mg/kg groups (P < 0.05).

Fig. 1

Effects of different levels of sodium butyrate (SB) supplementation on relative expressions of (A) TOR and (B) LPL genes in intestinal tissue of juvenile yellow catfish. TOR = target of rapamycin; LPL = lipoprotein lipase. a, b, c, d Bars with different superscripts represent significant difference by Tukey's test (P < 0.05). Data presented are means ± SD of 3 replicates.

Discussion

Sodium butyrate was shown to have beneficial effects on growth and feeding efficiencies of yellow catfish. Fish weight gain (WG) and specific growth rate (SGR) increased with SB supplementation, which suggested that growth performance can be improved using SB in the diets. Growth benefit observed in this study was attributed to an improvement in feed utilization, which significantly increased with SB supplementation. Maximum growth performance and feed efficiency were observed at dietary SB levels of 500 and 1,000 mg/kg. The value of SGR was higher than those reported in some previous studies on yellow catfish (Luo et al., 2016; Zhao et al., 2017), but was lower than those observed in more recent studies on yellow catfish (Zhao et al., 2019). This is probably due to differences in the initial weight of the fish in these experiments. Based on the results of previous research, dietary supplementation of SB at 2,000 mg/kg improved the growth or feed utilization of juvenile grass carp (Liu et al., 2017), golden pompano (Zhou et al., 2019), and turbot (Liu et al., 2019). However, supplementation of 200 or 2,000 mg/kg SB did not improve the growth performance and feed utilization of African catfish and red hybrid tilapia (Owen et al., 2006; Ebrahimi et al., 2017). In Atlantic salmon (Bjerkeng et al., 1999) and rainbow trout (Gao et al., 2011), 0.5% to 2% dietary SB had no significant effect on growth performance. Studies containing different sustained-release times of microencapsulated SB did not demonstrate significantly improved growth in common carp (Liu et al., 2014). Protected forms of SB improved the biomass gain of Nile tilapia fingerlings during sexual reversion, but there was no significant difference between pure and protected forms of SB (Jesus et al., 2019a). This suggests that there is a dose–effect response in SB and growth performance. Therefore, the efficacy of SB to fish is mainly dependent on the dosage and protected form as well as species.

The activities of digestive enzymes are generally associated with digestive capacity and affect fish growth rate (Krogdahl and Marie Bakke-McKellep, 2005). In this study, SB improved lipase activity in stomach and intestine, as well as the trypsin activity in hepatopancreas of yellow catfish. Similar results were reported for golden pompano in which intestinal digestive enzyme activity was increased by 2,000 mg/kg SB in diets (Zhou et al., 2019). Silva et al. (2016) found that diets supplemented with 2% SB increased intestinal lipase of white prawns as compared with the non-supplemented group. However, Jesus et al. (2019b) supplemented Nile tilapia with different forms and concentrations of SB and found no change in intestinal digestive enzymes activities of fish. The variation among results may be due to the forms and concentrations of SB used, structural characteristics of digestive organs, variations in the types of enzymes and experimental conditions (Yao et al., 2019). Absorption of nutrients is affected by the brush-border membrane enzymes of the intestine, such as AKP, Na+/K+-ATPase and CK (Tibaldi et al., 2006). In golden pompano, diets supplemented with SB increased intestinal AKP, CK and Na+/K+-ATPase activities (Zhou et al., 2019). In the present study, an increase of intestinal AKP and γ-GT activities was observed in yellow catfish fed with SB diets. SB enhanced intestinal enzymes activities of yellow catfish possibly partly due to its slight acidifying properties (Castillo et al., 2014; Silva et al., 2016).

The improvement of intestinal enzyme activities of fish fed with SB diets might be attributed to the integrity and growth of digestive organs. In Jian carp (C. carpio var. Jian) and white shrimp (Penaeus setiferus), digestive enzymes activity was correlated with growth and development of the hepatopancreas (Chen et al., 2012; Lovett and Felder, 1990). The present study showed that the weight and protein content of hepatopancreas had a similar trend to digestive enzyme activity, indicating there was a beneficial effect of SB on the hepatopancreas. Similarly, HSI was increased as dietary SB levels increased in golden pompano (Zhou et al., 2019). The intestine is the main site for nutrient absorption in fish. An increase in intestine length, weight and protein content was observed in fish fed with SB diets, indicating that SB promoted intestinal growth of yellow catfish. In Nile tilapia, protected forms of SB increased length, perimeter and villus area of the proximal intestine (Jesus et al., 2019b). In this study, dietary SB increased fold height and muscular thickness of proximal and distal intestine in yellow catfish. The observed increase in fold height and muscular thickness would presumably be conducive to increased absorption in the intestine of yellow catfish as in Jian carp (Chen et al., 2012). This finding was consistent with the corresponding feed conversion rate, weight gain and nutrient retention in yellow catfish fed with SB diets. Therefore, well-developed intestine, as those observed in this study for yellow catfish fed SB diets, correlates well with an improved nutrient uptake which was illustrated by significantly improved feed efficiency and final weight.

Chemical composition of whole fish and nutrition retention value

In the present study, whole-body composition and nutrient retention of yellow catfish were affected by dietary SB levels. Significantly higher levels of crude protein, ash, calcium, phosphorus in whole body and the retention of protein, lipid, calcium and phosphorus were found in fish fed with 1,000 mg/kg SB diet. Dietary SB is an important energy source for intestinal epithelial cells (Piva et al., 2009). An increase of whole-body crude protein and lipid contents in fish fed with SB diets may be attributed to SB's energy-supplying effect for animal metabolism, and it is not necessary to use more protein as an energy source (Jesus et al., 2019b). Thus, SB can spare the protein to ensure its use for fish growth (Lee, 2015). The increase in retention of calcium and phosphorus may be related to nutrient digestibility. Lin and Cheng (2017) suggested that 1% dietary butyrate increased the calcium and phosphorus digestibility in groupers. The respective addition of 5% and 3% dietary citric acid improved the absorption of calcium and phosphorus in rainbow trout (Sugiura et al., 2001) and Indian major carp (Baruah et al., 2005). Dietary SB may solubilize bone minerals in fish meal and reduce the antagonistic interaction between calcium and phosphorus at the intestinal brush border (Sugiura et al., 1998; Baruah et al., 2007).

Protein synthesis is a key component of fish growth. The present study showed that protein content in hepatopancreas, intestine and whole body increased with dietary SB, indicating the improvement of protein synthesis and nitrogen deposition. The TOR signaling pathway is involved in the cell growth and proliferation by regulating protein synthesis (Hay and Sonenberg, 2004). The relationship between nutrition retention and TOR signaling pathway has been reported in fish (Liang et al., 2016; Wu et al., 2019). However, the effect of SB on TOR signaling pathway of fish has not been reported. Relative expression of TOR mRNA in intestine and hepatopancreas was significantly up-regulated by dietary SB in this study, which indicated a similar trend with whole-body protein content of yellow catfish. This suggested that dietary SB might activate TOR signaling pathway, which improved protein synthesis of yellow catfish. SB could promote the proliferation of enterocytes and increase the expressions of intestinal total binding proteins by enlarging the absorption surface of the intestine (Scholzahrens et al., 2007). Liu et al. (2017) reported that butyrate could increase protein absorption by upregulation of the mRNA expression of intestinal amino acid transporters in grass carp. Butyrate, providing an energy source for animals, is a signaling molecule regulating animal energy metabolism (Samuel et al., 2008; Yu et al., 2017). To date, reports concerning the effect of SB on lipid metabolism of fish are scarce. In piglets, butyrate has been shown to promote differentiation and metabolic adaptations of adipocytes by down-regulating fatty acid synthesis genes and up-regulating fatty acid oxidation genes (Li et al., 2014; Lu et al., 2012). Although lipid metabolism of pigs was regulated in vivo or in vitro by SB, the effects of SB in fish have not been reported. Lipoprotein lipase is an important lipid regulatory enzyme involving hydrolyzing triglyceride of plasma lipoproteins and supplying free fatty acids for storage in adipocytes or for oxidation in other tissues (Zheng et al., 2013). In this study, the expression of hepatopancreas LPL was significantly up-regulated in the 2,000 mg/kg SB group, which is in agreement with the increase of whole-body fat in yellow catfish. This indicates that dietary SB might have a role in increasing lipid synthesis and decreasing hydrolysis of lipoproteins and triglyceride, and this explains the positive effects of SB on whole body lipid deposition of the fish. Butyrate has a direct impact on the lipid storage regulation of porcine adipocytes through inhibiting lipolysis and enhancing fatty acid synthesis (Yan and Ajuwon, 2015). However, Lu et al. (2012) reported that SB might decrease fat deposition of loin muscle in vitro though up-regulating the expression of oxidative genes. The exact mechanism by which SB regulates lipid metabolism of fish is still unknown and needs further investigation.

Conclusions

In conclusion, dietary SB improved the growth performance, digestive enzymes, body composition and nutrient retention of yellow catfish. The fish fed 500 or 1,000 mg/kg SB diet significantly increased weigh gain, feed efficiency, digestive tract health, and crude protein, ash, calcium, and phosphorus content of the whole body. However, a high level of SB (2,000 mg/kg) increased the lipid content in the whole body and the lipoprotein lipase mRNA expression in the hepatopancreas of fish. The addition of SB in diets of P. fulvidraco in the range of 500 to 1,000 mg/kg is recommended. This study brought new insights into the role of SB in improving growth performance, intestinal health and nutrient retention. Moreover, it is confidently predicted that SB could be widely used for increasing growth performance, nutrient retention and improving the health status of the digestive tract in other animals and humans.

Conflict of interest

We declare that we have no financial and personal relationships with other people or organizations that might inappropriately influence our work, and there is no professional or other personal interest of any nature or kind in any product, service and/or company that could be construed as influencing the content of this paper.