Gastrodin Exerts Cardioprotective Action via Inhibition of Insulin-Like Growth Factor Type 2/Insulin-Like Growth Factor Type 2 Receptor Expression in Cardiac Hypertrophy.

Pathological cardiac hypertrophy is commonly associated with an upregulation of fetal genes, fibrosis, cardiac dysfunction, and heart failure. Previous studies have demonstrated that gastrodin (GAS) exerts cardioprotective action in the treatment of cardiac hypertrophy. However, the mechanism by which GAS protects against cardiac hypertrophy is yet to be elucidated. A mouse model of myocardial hypertrophy was established using an angiotensin II (Ang II) induction. GAS (5 or 50 mg/kg/d) was orally administered every day starting 7 days prior to the Ang II infusion combined with sham-operated controls. Heart samples from each group were collected for RNA sequencing. Using bioinformatics analysis, the key differentially expressed genes (DEGs) that are involved in reversing cardiac function were identified. Through bioinformatics analysis, the key DEGs that are involved in GAS's inhibition of Ang II-induced abnormal gene expression within the heart were identified. This was further validated using quantitative real-time PCR and Western blotting in neonatal rat cardiomyocytes (NRCMs). Oral administration of GAS significantly suppressed the Ang II-induced increase in heart size and heart weight to body weight. Furthermore, pretreatment of the NRCMs with GAS led to a dose-dependent inhibition of Ang II-induced increases in Nppb mRNA expression. We identified 620 upregulated and 87 downregulated Ang II-induced DEGs II, among which the expression patterns of 58 and 146 genes were inverted by low-dose and high-dose GAS, respectively. These inverted DEGs were found to be mainly enriched in the biological processes of regulation of Ras protein signal transduction, heart contraction, covalent chromatin modification, glucose metabolism, and positive regulation of cell cycle. Among them, the insulin-like growth factor type 2 (Igf2) gene, which was found to be highly reversed and downregulated by GAS, served as a core gene linking energy metabolism, immune regulation, and systemic development. Subsequent functional verification demonstrated that IGF2, and its receptor IGF2R, is one of the targets of GAS that helps protect against cardiac hypertrophy. Taken together, we have identified, for the first time, IGF2/IGF2R as a potential target influenced by GAS in the prevention of cardiac hypertrophy.

Introduction

Cardiac hypertrophy initially develops as an adaptive response of the heart to various physiologic and pathologic stimuli, which leads to increased workload of the heart. Unfortunately, pathological hypertrophy has been shown to be associated with cardiac dysfunction and congestive heart failure, which are some of the major causes of morbidity and mortality worldwide.[1] Because of lack of effective drugs, the current clinical treatment of hypertrophy is challenging.

In recent years, many natural compounds extracted from herbs have been utilized as a treatment of hypertrophy.[2][3][4] Gastrodin (GAS), an active component of Gastrodia elata Bl., has been widely used in the treatment of neurological diseases, including dizziness, paralysis, epilepsy, and migraine. GAS has also been proven to exert cardioprotective pharmacological effects. Combined with antihypertensive drugs, GAS has been shown to be efficacious at lowering blood pressure among older patients with refractory hypertension.[5] Despite the fact that several studies have investigated the effect of GAS on the expression of individual genes in relation to hypertrophy,[6][7][8] little has been done to prove the effect of GAS on global gene expression changes in hypertrophy. Therefore, additional studies are needed to determine the unknown targets of GAS.

Gene expression profiling has been introduced as a method of identifying differentially expressed genes (DEGs) during disease progression. Herein, we used RNA-sequencing (RNA-seq) techniques to identify DEGs in sham operation and angiotensin II (Ang II) treatment group with or without GAS pretreatment. Enrichment analysis was conducted to reveal the potential functions and pathways of these DEGs. A protein–protein interaction (PPI) network demonstrated that the insulin-like growth factor type 2 (Igf2) as a core gene is likely to play a central role in Ang II-induced cardiac hypertrophy with or without GAS pretreatment. IGF2 is a member of the IGF family of peptide growth factors. IGF2 is able to bind and activate insulin-like growth factor type 2 receptor (IGF2R), which leads to the development of pathologic cardiac hypertrophy.[9] To date, several studies highlight the importance of IGF2R in the regulation of cardiac development, growth, and survival.[10,11] IGF2R has been shown to play a role in the pathogenesis of cardiac hypertrophy.[12][13][14][15] In addition to its cardiovascular roles, IGF2R also plays a role as a tumor suppressor gene that is involved in apoptosis and tumorigenesis.[16] In our studies, quantitative real-time PCR (qRT-PCR) results have demonstrated that Igf2 was upregulated in Ang II-induced hypertrophic neonatal rat cardiomyocytes (NRCMs) and was downregulated via GAS treatment, which is consistent with the results from the bioinformatics analysis. Meanwhile IGF2R was also found to be significantly increased, and this increase was substantially inhibited by GAS treatment via the analysis of gene and protein expression. We postulate that GAS exerts a cardioprotective action by inhibiting IGF2/IGF2R expression in cardiac hypertrophy, and it may be useful in designing novel therapeutic strategies.

Results

GAS Protected Against Ang II-Induced Cardiac Hypertrophy In Vivo

In order to investigate the effect of GAS on Ang II-induced cardiac hypertrophy, we assessed the effects of oral gavage of GAS on cardiac hypertrophy induced by Ang II infusion in mice. Interestingly, subcutaneous Ang II infusion could increase heart size and ratio of heart weight to body weight (HW/BW) compared with the sham group (Figure A,B). However, oral gavage of GAS (5 and 50 mg/kg/d) significantly attenuates Ang II-induced increases in heart size and HW/BW (Figure A,B). Additionally, GAS markedly reduces the mRNA expression of the hypertrophic marker Nppa and Nppb induced by Ang II (Figure D). The heart rate recorded in the mice is presented in Figure C. Neither Ang II subcutaneous infusion nor GAS administration altered heart rate compared to the sham group (Figure C).

Figure 1

GAS inhibited Ang II-induced cardiac hypertrophy in vivo. The mice were infused with Ang II at a dose of 1.5 mg/kg/d for 2 weeks. The GAS (5 or 50 mg/kg/d) oral gavage was initiated 7 days before surgery. Hypertrophy was assessed by measuring heart size (A) representative from six pairs of mice. (B) Ratio of HW/total BW (n = 5–6). (C) Data summary of heart rate recorded in the mice (n = 5). (D) Data summary of relative mRNA expression of Nppa and Nppb, normalized to Gapdh (n = 5). The data are expressed as mean ± SEM. *p < 0.05 and **p < 0.01 compared to the Ang II Veh group and #p < 0.05and ##p < 0.01 compared with Sham_Veh group.

Ang II-Induced DEGs Are Involved in the Formation of Cardiac Hypertrophy

In order to validate the mechanism of GAS against myocardial hypertrophy, we initially analyzed how changes in cardiac gene expression caused by Ang II participate in the development of cardiac hypertrophy. By comparing RNA-seq data from the Ang II treatment and sham group, we identified 707 DEGs (absolute log 2 fold change (FC) > 1 and FDR corrected p value < 0.05) induced by Ang II, which includes 620 upregulated and 87 downregulated genes (Figure A). Interestingly, there were far more upregulated DEGs compared to downregulated DEGs, which indicates that Ang II has a transcriptional activation effect. Among the most upregulated genes, some were found to be involved in actin assembly and movement, such as Apoa1, Apoa2, Notch2, and Syne2. However, some play roles in muscle development and differentiation, including Igf2, Scgb3a1, and Luc7l. According to the information of the Gene Ontology (GO) database, all of these genes play a direct role in functional changes of the cardiac muscle. Additional genes, such as Igf2 and Unc13, are known to be involved in glucose metabolism and homeostasis. Next, Ahsg, F2, and Dlx1 are involved in regulating the cell cycle and growth and have regulatory roles in the process of energy metabolism and cell renewal of the heart muscle. Among the most downregulated genes, Fstl4 and Baiap2l1 regulate cell size; Tlr4 and Dusp26 regulate the MAPK cascade; Pik3ca, Ankrd, and Rad1 regulate DNA damage and metabolism; and Myot and Pcdhgc3 play a role in cell adhesion (Figure C,D). This result indicates that Ang II-induced cardiac hypertrophy is a coordinated process that encompasses multiple genes through multiple signaling pathways.

Figure 2

Identification of Ang II-induced DEGs and GAS inverted DEGs. The mice were treated with vehicle solution, Ang II, GAS (5 or 50 mg/kg). (A) Volcano plots demonstrate the identification process of Ang II-induced DEGs, GAS-induced DEGs, and GAS-inverted DEGs. For Ang II-induced DEGs, among all genes that are expressed in the Ang II treatment group, genes with FDR < 0.05 and the absolute value of log 2 FC greater than 1 relative to the sham operation group were chosen. For GAS-induced DEGs, among all genes that are expressed in the GAS-treated sham-operated group, genes with FDR < 0.05 and the absolute value of log 2 FC greater than 1 relative to the sham operation group were chosen. For GAS-inverted DEGs, Ang II-induced DEGs were identified as those whose differential expression patterns were significantly inverted (interaction FDR < 0.05 and the absolute value of inverted log 2 FC > 1) by different doses (5 or 50 mg/kg/d) of GAS. The cyan dots indicate that the identified DEGs, as well as gray dots, indicate other genes that are not significantly affected by Ang II or GAS. The red dots indicate 15 key GAS-inverted DEGs with high connectivity identified in the functional analysis. (B) Venn diagram demonstrates the relationships among Ang II-induced DEG (blue circle, n = 707), inverted DEGs by low-dose (5 mg/kg/d) of GAS (red circle, n = 58), and inverted DEGs by high-dose (50 mg/kg/d) of GAS (green circle, n = 146). Heat maps display the gene expression profiles of noninverted DEGs by GAS (C) and inverted DEGs by GAS (D) among all samples. The samples are divided into Ang II modeling and sham operation groups, which were arranged in each group according to their drug concentrations. The red and blue gradient squares map the normalized gene expression values. The brown bars in the D plot indicate whether genes are inverted by low-dose or high-dose GAS. The genes with the top significant differential expression are marked on the right side of C and D plots.

GAS-Inverted DEGs Play an Anticardiac Hypertrophic Effect

Subsequently, we compared the effect of different doses (low, 5 mg/kg/d; high, 50 mg/kg/d) of GAS on the expression of DEGs induced by Ang II. After screening by the interaction FDR < 0.05 and the absolute value of inverted log 2 FC > 1, we determined that the expressions of 58 and 146 DEGs were inverted by low-dose and high-dose GAS, respectively (Figure A,B). Most DEGs that are highly inverted by low-dose GAS have immunoregulatory functions, such as Serpinblc, Igf2, Ltf, Notch2, Bpifb1, and Cdo1, which negatively regulate interleukin-1 production or participate in the toll-like receptor signaling pathway. Among the DEGs that are highly inverted by high-dose GAS, Apoa1, Apoa2, Igf2, Unc13b, Ahsg, Noch2, Pcdhgc3, and Gpr27 are known to be involved in the metabolism of glucose, lipids, and steroids and are more closely related to the metabolic regulation of cardiomyocytes (Figure A). It is worth noting that Apoa1, Apoa2, Igf2, and Noch2 were inverted via both low-dose and high-dose GAS. These are widely involved in immunity, metabolism, and additional cellular activities and may be important therapeutic targets (Figure D). Furthermore, we determined that the low-dose and high-dose GAS groups only had 11 and 14 DEGs compared to the sham operation group, which was less than 0.1% of the total expressed genes (Figure A). Among these, Fen1, Creb1, and Igf2 genes are involved in memory, while Epn2 and Aak1 genes are involved in the notch signaling pathway. The correlation between these DEGs is very weak, indicating that GAS does not affect normal heart tissue.

GAS-Improved Cardiac Hypertrophy by Regulating Ras Protein Signal Transduction

Next, we carried out GO enrichment analysis on both Ang II-induced DEGs and GAS-inverted DEGs, which includes biological process (BP), cell component (CC), and molecular function (MF), to explore how GAS affects Ang II-induced cardiac hypertrophy at the gene function level. The enrichment results of BP identified inverted DEGs in cell-substrate adhesion, positive regulation of steroid metabolic process, exocrine system development, glucose homeostasis, response to insulin, negative regulation of immune response, and notch signaling pathway, indicating that GAS exerts an effect at the metabolic level, immunity, and development (Figure A). For CC enrichment, inverted DEGs exhibit characteristics that are mainly distributed in the fibrillar collagen trimer, receptor complex, chylomicron, protein–lipid complex, actomyosin, and cell–cell contact zone, which reflects that GAS has an effect on signal transduction, cell movement, and visceral fat metabolism (Figure B). Results from MF enrichment were consistent with those from BP and CC; that is, GAS exerts therapeutic effects by affecting cardiac functions, including extracellular matrix structural constituent, actinin binding, cell adhesion molecule binding, chemorepellent activity, high-density lipoprotein particle binding, and integrin binding (Figure C).

Figure 3

Gene function analysis for Ang II-induced DEGs inverted by GAS. Bubble plots show the enrichment results of GO, including BPs (A), cellular component (B), and MF (C) of Ang II-induced DEG and inverted DEG by low dose (5 mg/kg/d) or high dose (50 mg/kg/d) of GAS. The Y axis shows the key GO terms of enrichment, while the X axis shows the number of enriched DEGs within each group. The size of the bubble maps, the gene ratio of the GO item, and color maps enrich the p value. A p value ≤ 0.05 is considered to be significantly enriched. The treemaps show the clustering results of all enriched BP (D) and MF (E) terms after summarization by REVIGO. Each square represents a GO term. The GO terms framed by thick black lines indicate that they belong to a higher level root term, which is shown in bold font with a white background. Different colors indicate whether the GO item is enriched with inverted DEGs by 5, 50, or 5 and 50 mg GAS, or other Ang II-induced DEGs.

After summarizing the enriched GO terms, we determined that the regulation of Ras protein signal transduction is key to GAS’s anticardiac hypertrophic effect. In inverted DEG-enriched BP terms, this signaling pathway largely includes the negative regulation of immune response, response to insulin, notch signaling pathway, and glucose homeostasis. It also involves regulating immunity, energy metabolism, and cell growth and development, including Apoa1, Apoa2, Igf2, Igf1r, Ahsg, Baiap2l1, Notch2, Hp, Unc13b, and other important regulatory genes (Figure D). In addition, protein serine/threonine kinase activity is a key gene function that was found to be enriched in inverted DEGs, involving ATPase, UDP-galactosyltransferase, phosphorus-oxygen lyase, and deoxyribonuclease. This indicates that GAS uses a variety of enzyme-linked reactions to exert its effect (Figure E).

Igf2 Is the Key Target Gene for GAS to Regulate Cardiac Hypertrophy

Functional analysis demonstrates that most Ang II-mediated signaling pathways are inverted through the use of high-dose instead of low-dose GAS (Figure D,E). The functional enrichment of DEGs inverted by low-dose GAS is largely related to immune regulation, including negative regulation of interleukin-1β production, regulation of toll-like receptor 4 signaling pathway, and innate immune response in mucosa. In addition to the negative regulation of the immune response, DEGs that were inverted by high-dose GAS are enriched in lipid metabolism, carbohydrate metabolism, growth, and peptide hormone response (Figure S1). High-dose GAS had an improved effect at protecting cardiac hypertrophy at the level of gene regulation. Thus, we used DEGs inverted by high-dose GAS to construct functional networks. The core functional network of BP enrichment displayed that the central genes, including Igf2, Igf2r, Apoa1, Apoa2, and Muc4, are involved in regulating Ras protein signal transduction and play a central role in insulin response, cell adhesion, immune regulation, and systemic development (Figure A). The core functional network is constructed on the results of MF enrichment and demonstrate the core functions of Vwf, Col6a1, Jam3, Igf2, Ptprb, and Pik3ca genes as phosphatase, insulin binding, integrin binding, and cell adhesion molecule binding molecules (Figure B). By constructing a PPI network using the STRING database and filtering gene nodes with low connectivity, we extracted the core PPI network that contains 23 genes, including key genes such as Ahsg, Vwf, Igf2, and Igf1r (Figure C). According to these gene function networks, we discovered that 15 key genes of Ahsg, Apoa1, Vwf, Apoa2, Hp, Itga1, Csrp3, Igf1r, Igf2, Notch2, Col16a1, Egr2, Jag1, Unc13b, and Muc4 are involved in suppressing Ang II-induced cardiac hypertrophy by GAS. The expression patterns of these genes show that Igf2 has a very strong Ang II induction effect and GAS reversal effect and is a potential therapeutic target (Figure D). Interestingly, Igf2 was found to be upregulated by GAS in the sham operation group but to be downregulated by GAS in the Ang-II group. However, according to the results of functional analysis, the upregulation of the Igf2 gene in heart tissue induced by GAS is involved in learning and memory.

Figure 4

Gene function networks reveal key genes of GAS against cardiac hypertrophy. The network graphs demonstrate the relationships among GAS-inverted DEGs and their enriched key GO terms of BP (A) and MF (B). The gray circles represent enriched GO terms and are labeled with brown text nearby. The size maps represent the number of enriched genes. The triangle and square represent inverted DEGs and are labeled with black gene names. (C) PPI network displays the core interactions among GAS-inverted DEGs. The genes displayed were chosen from the top hub genes with the most significant inverted log 2 FC and the highest functional network connectivity. (D) Line graphs demonstrate the expression patterns of the average expression values of 15 key GAS-inverted DEGs in the Ang II modeling group (vermillion) and the sham operation group (cyan) at different doses of GAS (5 and 50 mg/kg/d).

Detection of Gene Expression by qRT-PCR and Western Blotting

In order to verify the sequencing results, seven genes (Apoa1, Apoa2, Notch2, Syne2, Igf2, Scgb3a1, and Luc7l) were chosen for qPCR analysis (Figure S3). Only Igf2 mRNA expression was found to be significantly upregulated in Ang II-induced hypertrophic NRCMs and downregulated by GAS treatment, which is consistent with the results from the bioinformatics analysis (Figure B). Therefore, we examined the effect of GAS on recombinant IGF2-induced cardiac hypertrophy. NRCMs were pretreated with GAS for 12 h prior to stimulation with recombinant IGF2 (100 ng/mL). The hypertrophic response was determined after 48 h. Interestingly, recombinant IGF2 induced a marked increase in Nppb mRNA and ANP expression, which was partially inhibited by GAS (Figure S4). As IGF2 induces hypertrophy of cardiomyocytes through an IGF2R-dependent pathway,[17] we further determined the Igf2r mRNA expression and IGF2R expression and found that they were significantly increased (Figure C,D). However, these increases were substantially inhibited via GAS treatment (Figure C,D). Intriguingly, Ang II-induced IGF2R increase was abolished in the IGF2R-deficient NRCMs using siRNA-mediated knockdown (Figure F). The results indicate that GAS may exert a cardioprotective action by inhibiting IGF2/IGF2R expression in the treatment of cardiac hypertrophy.

Figure 5

Validation of gene expression via qRT-PCR and Western blotting. (A–D) NRCMs were treated with 100 nM Ang II for 48 h to induce hypertrophy. GAS (100 μM) was applied 12 h prior to Ang II. (A–C) Summary data of mRNA expression of Nppb, Igf2, and Igf2r. (D) Representative immunoblots of IGF2R protein levels together with quantification. (E) NRCMs were transfected with scrambled-siRNA, Igf2r-siRNA1, or Igf2r-siRNA2 for 48 h. The representative images demonstrate immunoblots of IGF2R protein together with quantification. (F) NRCMs were transfected with scrambled-siRNA or Igf2r-siRNA1 for 48 h. The representative images demonstrate immunoblots of IGF2R protein levels with or without Ang II treatment together with quantification. The data are expressed as mean ± SEM (n = 5). ∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001 compared to AngII_Veh group or Scrambled siRNA group or AngII_Scrambled siRNA group; #p < 0.05, ##p < 0.01, and ###p < 0.001 compared to the Control_Veh group.

Discussion

Pathological cardiac hypertrophy is a complex remodeling process that involves multiple signaling pathways and targets.[18] Cardiac hypertrophy is associated with an increase in heart mass as well as an increase in the rate of protein synthesis that involve several signaling pathways, including phosphoinositide 3-kinase (PI3K) and Ras/Raf/MEK/Erk pathways.[19] Some studies have identified that the transfection or microinjection of cardiomyocytes with activated Ras mutants (V12Ras) can induce the activation of MAP kinase (MAPK) and increase the expression of genes that are related to cardiac hypertrophy, including c-Fos and atrial natriuretic factor.[20] In recent years, many natural compounds, such as GAS, have been utilized for the treatment of hypertrophy because of their antihypertrophic effects and low toxicities.[21][22][23][24][25] GAS, the major bioactive component extracted from the Chinese herb Gastrodia elata Bl., has been widely used in the treatment of neurological diseases. Furthermore, it has been suggested that GAS possesses comprehensive pharmacological functions, including anticonvulsant, analgesic, anti-inflammatory, and hypoxia tolerance.[22][23][24] The pharmacological effects of GAS have also been reflected in many other aspects, particularly in cardiovascular disease. Consistent with our previous study, GAS pretreatment can attenuate Ang II-induced cardiac hypertrophy in a dose-dependent manner.[6] Additionally, GAS can lower blood pressure in patients with hypertension.[5] Other studies show that GAS can significantly inhibit the expression of notch signaling pathway members, including Notch-1, NICD, RBP-JK, and Hes-1.[26] GAS can also regulate glucose and lipid metabolism, as it activates AMP-activated protein kinase, inhibits liver steatosis, and reduces serum triglycerides (TG)/glucose.[27] GAS treatment can strongly inhibit the activation of nuclear factor-κB (NF-κB) and MAPK family as well as induce the upregulation of nitric oxide synthase and cyclooxygenase-2, thereby inhibiting an inflammatory response in septic cardiac dysfunction.[19] Moreover, some studies have demonstrated that GAS protects against cardiac hypertrophy and fibrosis by abrogating the ERK1/2 signaling pathway and activation of GATA-4.[7] Our previous study suggests that GAS attenuates cardiac hypertrophy through the Stim1–Orai1 pathway of store-operated Ca2+ entry.[6] However, GAS may be an effective intervention in preventing hypertrophy when focusing directly on a single gene, such as Orai1. However, it is also important to consider that GAS treatment can simultaneously affect other genes and may have both counterproductive and/or synergistic effects. Since targets by which GAS regulates in preventing cardiac hypertrophy are a relatively new field of study, understanding the DEGs that are regulated by GAS during progression of cardiac hypertrophy, as offered by this study, provides clues for the mechanism of GAS action.

As high-throughput RNA-seq technology has been rapidly developed, it has been increasingly used to study genetic and molecular mechanisms that underlie complex diseases, such as cardiac hypertrophy.[28] Lee et al. analyzed mouse cardiac transcriptome complexity during heart failure using the RNA-seq technique.[29] By identifying unique transcriptomic signatures of physiological hypertrophy and pathological hypertrophy of the heart, Song et al. employed RNA-seq and found not only DEGs but also different alternative splicing patterns during the progression of hypertrophy.[30] In addition, Hu et al. studied mRNA and microRNA transcriptome changes that occur during pressure overloading hypertrophy in mice hearts.[31] In order to identify GAS therapeutic targets, we conducted RNA-seq experiments to categorize the genes that are differentially expressed in Ang II-induced cardiac hypertrophy in the mouse animal model in response to GAS treatment. Herein, a total of 707 DEGs (620 upregulated and 87 downregulated) were obtained, among which 58 and 146 Ang II-mediated DEGs were reversed by different doses of GAS (5 or 50 mg/kg) and identified in the first step (Figure A,B).

Next, we noticed that low-dose GAS mainly exerts anti-inflammatory effects by inhibiting IL-1 and TLR4 signaling pathways to inhibit Ang II-induced cardiac hypertrophy. However, high-dose GAS exerts an inhibitory effect through the dual regulation of immunity and metabolism. Studies have demonstrated that cardiac hypertrophy is related to the activation of TLR4/MyD88/NF-κB signaling pathway. That is, increased systemic inflammatory cytokines (TNF-α, IFN-γ, and IL-1β) and TLR4 activity can trigger cardiac hypertrophy, while the inhibition of this pathway is beneficial for alleviating cardiac dysfunction.[32,33] The most significant change in metabolism of the hypertrophic heart is an increased dependence on glucose, a reduction in oxidative metabolism, and an improvement in oxidative efficiency, which are all important goals for the treatment of cardiac hypertrophy.[34] Additionally, excessive accumulation of lipids in cardiomyocytes and reduced lipid oxidation can also cause reduced heart function and cardiomyopathy.[35] These results suggest that we should choose different doses of GAS for treatment, according to the pathological and metabolic characteristics of a hypertrophic heart. Subsequently, these Ang II-mediated DEGs reversed by GAS were separated by GO terms into three different groups, including BP, CC, and MF (Figure A–C). Gene function analysis demonstrated that GAS has an anti-Ang II-induced cardiac hypertrophic effect by influencing a variety of signaling pathways, such as glucose homeostasis, response to insulin, negative regulation of immune response, notch signaling pathway, and regulation of lipase activity (Figure D), which is consistent with prior evidence. This indicates that GAS resists Ang II-induced cardiac hypertrophy through the Ras protein signaling pathway and that the key target is in DEGs related to this pathway. In addition, we noticed that Ang II induces a large number of upregulated genes, which were enriched in multiple pathways, including the regulation of Ras protein signal transduction, heart contraction and glucose metabolism, cell growth, apoptosis, cell cycle, metabolism, and cell movement (Figure A–C). The two main cellular pathways in which Ras proteins act include the MAPK and PI3K pathways. In normal cells, these control multiple functions, such as cell growth and survival.[36] These results indicate that cardiac hypertrophy is accompanied by the activation of the Ras protein signaling pathway. The treatment of cardiomyocytes with a variety of hypertrophic agents can lead to an increased ratio of Ras in the form of active GTP ligands, such as endothelin-1, phenylephrine, and phorbol ester.[37] Ang II has a similar effect, as it mainly activates the Ras/MAPK pathway by activating the cytochrome P450 metabolites, which leads to hypertension, vascular damage, and cardiac hypertrophy.[38] Our transcriptomic analysis results are consistent with these studies, in which Ang II plays a role in promoting cardiac hypertrophy by affecting the Ras signaling pathway. In the third step, a DEG PPI network complex was developed, in which a total of 15 DEGs of the 23 commonly altered DEGs were filtered into this DEG complex (Figure A). We discovered that Igf2 exhibited significant alteration and high connectivity in Ang II-induced hypertrophy prior to and after GAS treatment.

In order to verify the expression of Igf2, an Ang II-induced hypertrophic model in NRCMs was successfully established (Figure A). Consistent with results from the bioinformatics analysis, the mRNA expression of Igf2 was significantly upregulated in Ang II-induced hypertrophic NRCMs and downregulated by GAS treatment, which suggests that Igf2 likely plays a central role in Ang II-induced cardiac hypertrophy before and after GAS treatment (Figure B). It has also been reported that IGF2 has a hypertrophic effect and activates a hypertrophic pathway in the neonatal ventricular myocytes.[17] Previous studies have determined that after binding with IGF2, IGF2R triggers an intracellular signaling cascade that contributes to the progression of pathologic cardiac hypertrophy.[12] Therefore, we further examined the expression of IGF2R and determined that Ang II-induced IGF2R increase was inhibited by GAS treatment (Figure D). IGF2R was originally discovered as a significantly upregulated protein in pathological hypertrophic cardiomyocytes[39] as well as in the myocardial infarction scars that had undergone myocardial remodeling fibrosis.[11] The overexpression and activation of IGF2R resulted in cardiac hypertrophy and apoptosis in H9C2 and NRCMs.[12,40,41] The findings from our present study indicate that the expression of IGF2/IGF2R was altered during cardiac hypertrophy with or without GAS pretreatment but does not elucidate the underlying mechanism. Further studies are required to explore the underlying mechanism of GAS treatment in cardiac hypertrophy.

Conclusions

In summary, we utilized the next-generation sequencing technology to examine the effect of GAS on transcripts in an Ang II-induced hypertrophic model. Our bioinformatics analysis reveals that Ang II-mediated DEGs reversed by GAS were associated with regulating Ras protein signal transduction, covalent chromatin modification, heart contraction, glucose metabolism, and quaternary ammonium group transport. Among these DEGs, Igf2 expression was dramatically reduced by post-GAS treatment in the prevention of cardiac hypertrophy, which emphasizes its clinical relevance. Furthermore, IGF2R was further upregulated by Ang II, and this increase was substantially inhibited by GAS treatment. To the best of our knowledge, this is the first report to demonstrate that GAS attenuates cardiac hypertrophy by inhibiting IGF2/IGF2R expression to protect against cardiac hypertrophy.

Methods

Animal Experiments

Sprague-Dawley (S/D) rats (1–2 days) and male C57BL/6 mice (8 weeks) were provided by the Laboratory Animal Center of Kunming Medical University. The animals were fed ad libitum with free access to water and were housed in a stable environment with 12/12 h light/dark cycle, 23–25 °C room temperature, and 50–60% humidity. The mice were divided into six experimental groups: first group which received sham surgery and the same volume of vehicle solution, a second group with GAS (oral gavage, 5 mg/kg/d, 7 days before surgery), a third group with GAS (oral gavage, 50 mg/kg/d, 7 days before surgery), a fourth group with Ang II infusion, a fifth group with Ang II and GAS (oral gavage, 5 mg/kg/d, 7 days before surgery), and a sixth group with Ang II and GAS (oral gavage, 50 mg/kg/d, 7 days before surgery). For Ang II infusion, osmotic minipumps (Alza Corp., Alzet model 1002, Cupertino, CA) were implanted subcutaneously into mice. Ang II was delivered using pumps at a rate of 1.5 mg/kg/d for 14 days. GAS was dissolved in 0.9% saline solution for animal experiments. The heart rate was measured using tail-cuff plethysmography every other day during the treatment. At the end of the experiment, the mice were euthanized, and the hearts were removed and weighed to determine the HW/BW. All experiments were granted approval by the Institutional Animal Care and Use Committee at the Kunming Medical University.

Hypertrophic Model of Cultured Cardiomyocytes

The isolation and culture of NRCMs were previously described.[42] Briefly, ventricles from 1- to 2-day-old neonatal S/D rats were sliced into 1 mm3 pieces and digested in a series of 4–5 steps using collagenase II (Worthington, LS004176) and trypsin (Gibco, 15400-054) at 37 °C. The dissociated cardiomyocytes were then suspended in Dulbecco’s modified Eagle’s medium [Nutrient Mixture F-12 (DMEM/F12)] with GlutaMAX (GIBCO, 10565-018) with 10% horse serum (GIBCO, 16050-122), 5% FBS (Hyclone, SH30406.05), and 50 μg/mL gentamicin (Biological Industries, 03-035-1B). The cardiomyocytes were then separated from fibroblasts using a matrigel (Corning, 354234) gradient centrifugation step to allow the selective adhesion of cardiac fibroblasts to the cell culture dishes. Nonadhesive cardiomyocytes in the suspension were transferred to another dish, cultured for 24 h in DMEM, and then cultured with NRCMs in Opti-MEM-reduced serum medium (Thermo, 51985034) for 24 h. The NRCMs were treated with GAS (100 μmol/L) for 12 h and then exposed to Ang II (100 nmol/L) for 48 h to induce hypertrophy.

RNA Extraction and Library Preparation

Total RNA of the heart samples was isolated using the RNeasy Plus Mini Kit (Qiagen, Germany). The purity, concentration, and integrity of the total RNA were determined utilizing a NanoDrop2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA), an agarose gel electrophoresis (1.0%), and an Agilent 2100 Bioanalyzer (Agilent Technologies, Inc., Santa Clara, CA). Satisfactory RNA with an RNA integrity number greater than 7.0 was utilized for library construction and sequencing. The RNA samples were pooled and used to generate sequencing libraries through the use of Illumina TruSeq RNA Library Preparation Kit (Illumina, San Diego, CA). All libraries were constructed and sequenced using PE 250 through the Illumina Novaseq6000 platform, according to standard procedures. All data were deposited in the Gene Expression Omnibus database under the accession number GSE164187.

Mapping and Assembly of RNA-Seq Data

Clean data were acquired from the raw data by removing adapter sequences and trimming reads using poly-N and low quality reads, which is when the percentage of low-quality bases is over 50% in a read. The subsequent workflows of alignment, assembly, and mapping for these RNA-seq data were all completed in https://usegalaxy.org.[43] In brief, clean reads from all libraries were aligned according to the Mus musculus reference genome (Mus_musculus. GRCm38.p6) from Ensembl database using HISAT2 v 2.2.1.[44] The mapped reads of each library were assembled through the use of StringTie v2.1.3.[45] Gtf files were generated by Stringtie and converted to gene count matrix using Ballgown v2.22.[46]

DEG Identification

DESeq2 v1.30[47] helped identify DEGs between the Ang II modeling group and the sham operation group using the Benjamini–Hochberg method adjusted p value (FDR) ≤ 0.05 as well as the absolute value of log 2 FC > 1. Then, we compared gene expression changes of Ang II modeling and sham operation groups using different doses (5 or 50 mg/kg/d) of GAS treatment and calculated the interaction effect between GAS and Ang II using ImpulseDE v1.16.[48] We defined GAS-inverted DEGs as the genes of interaction with FDR ≤ 0.05 and the absolute value of inverted log 2 FC > 1 in Ang II-induced DEGs.

Functional Analysis for DEGs

All DEGs were examined using clusterProfiler v3.18 for GO enrichment.[49] A p value < 0.05 and q value < 0.2 were considered to be significantly enriched GO terminology. Next, the enriched GO terms were analyzed by REVIGO for semantic similarity,[50] with dispersion <0.4 being considered as a key term. The summarized GO terms were used by the treemap package in R to demonstrate the relationship between GO terms. Furthermore, the enrichplot package in R helped construct the gene function networks. All GAS-inverted DEGs were constructed to a PPI network using STRING V11.9.[51] According to the network analysis, we selected 23 highly inverted genes with top connectivity to reconstruct a core PPI network.

Analysis of mRNA Expression by qRT-PCR

In order to determine the mRNA expressions of Nppa, Nppb, Igf2, and Igf2r, we performed qRT-PCR analyses. We isolated total RNA using the TRIZOL reagent from the myocardium tissues. The cDNA was synthesized from 1 μg of total RNA using the PrimeScript RT reagent Kit with gDNA Eraser (Takara, RR047A). Gapdh was utilized as a housekeeping control. The primer sequences were as follows: Gapdh forward CCATCAACGACCCCTTCATT, reverse CACGACATACTCAGCACCAGC; Nppa forward ACCTGCTAGACCACCTGGAGGAG, reverse CCTTGGCTGTTATCT TCGGTACCG; Nppb forward GCTGCTTTGGGCACAAGATAG, reverse GGTCTTCCTACAACAACTTCA; Igf2r forward AACTGCCAGGTGAAAGACCC, reverse TCTGATTAAGGAGCCCTGCC. Igf2 forward CTAGAGCATCCCGAGAATCCAG, reverse CCAACATCGACTTCCCCACTG; Apoa1 forward TCTTCCTGACAGGTTGCCAAG, reverse TGGCGAAATCCTTCACCCTG; Apoa2 forward CCATCTGTAGCCTAGAAGGAGC, reverse GCTGGGCCTTCTCCATCAAA; Notch2 forward ATGTGTCAACGGCTGGAGTG, reverse GCAAGAGAAGGAGGCCACAC; Syne2 forward ATCGAGGCAGTGAGGCGAG, reverse GGGGCTATCGGCCATTCTTC; Scgb3a1 forward CATTCCACCATGAAGCTCACC, reverse CGAAGAAAGCAACGCCAGAGT; Luc7l forward TCCTAAATCCATGCGCGTCC, reverse CCTGCATTGACACCTGTGAA. The qRT-PCR was conducted using Applied Biosystems 7500 real-time PCR system (Applied Biosystems, NY) and TB Green Premix Ex Taq II (Takara, RR820B). Relative quantification was calculated according to the ΔΔCT method.

Western Blotting

Myocardium tissues or cell lysates were prepared in the RIPA (Beyotime, P0013B) lysis buffer and resolved on a SDS/PAGE gel. Next, they were blotted onto a polyvinylidene difluoride (PVDF) membrane. Then, the PVDF membrane was blocked using 2% BSA in TBST for 1 h at room temperature, which was followed by incubation with primary antibodies, including anti-IGF2R (Cell Signaling Technology, 14364S), anti-α-Tubulin (Cell Signaling Technology, 2144S), and anti-ANP (proteintech, 27426-1-AP) at 4 °C overnight. After incubating with the appropriate horseradish peroxidase-conjugated secondary antibodies, we visualized the protein bands using enhanced chemiluminescence detection system. The intensity of immunoblot bands was quantified using the ImageJ software.

siRNA Transfection

NRCMs were seeded at a density of 1.2 × 106/well in a 6-well dish and were cultured in a humidified incubator (95% air with 5% CO2) for 24 h. The Igf2r-siRNA and INVI DNA–RNA Transfection Reagent (Invigentech, IV1216150) were suspended in Opti-MEM medium (GIBCO, 31985062), which was followed by adding cultured cells to a final concentration of 120 nM. After culturing for 6 h, the medium was replaced with normal medium, which was followed by a 24 h incubation period. The small interfering RNAs (Igf2r-siRNA and scrambled-siRNA) were purchased from Gene Pharma.

Drugs

GAS (Aladdin, S31318) (100 μmol/L, dissolved in PBS) was added 12 h prior to treating NRCMs with Ang II (Aladdin, A107852) (100 nmol/L, dissolved in sterilized water) or recombinant IGF2 (Cloud-Clone Corp, RRA051Ra01) (100 ng/mL, dissolved in 20 mM Tris, and 150 mM NaCl) for 48 h. Next, the culture media containing the different drugs were renewed every 24 h.

Statistical Analysis

All values were expressed as mean ± SEM (n), where n corresponds to the number of independent experiments. The significant differences were evaluated using paired or unpaired Student’s t-test to compare two groups using GraphPad Prism software (GraphPad Software, Inc., San Diego, CA). The differences were considered to be statistically significant at p < 0.05.