F Y Daramola1, R Malgas2, A P Malan2. 1. Department of Agricultural Sciences, Cape Peninsula University of Technology, Wellington, Private bag X8, Wellington 7654, South Africa. 2. Department of Conservation Ecology and Entomology, Faculty of AgriSciences, Stellenbosch University, Private Bag X1, Matieland 7602, Stellenbosch, South Africa.
Abstract
Root-knot nematodes in the genus Meloidogyne are an important group of plant-parasitic nematodes causing severe damage on agricultural crops worldwide. A study was conducted to identify the species of root-knot nematodes causing damage on honeybush monocultures and to assess the seasonal variations in the nematode population. Soil samples were collected from six experimental sites in Genadendal, Western Cape province of South Africa from 2016 to 2017. DNA was extracted from single-second stage juveniles and species identifi cation was done using species-specifi c sequence-characterised amplifi ed regions (SCAR) primers. Meloidogyne hapla and M. javanica were identifi ed from the sites. Mean population density of the nematodes varied significantly (p < 0.05) in the six sites, with the peak population being recorded in summer of 2017. The study suggests that seasonal variation in temperature and moisture could contribute to changes in the population density of root-knot nematodes in the soil.
Root-knot nematodes in the genus Meloidogyne are an important group of plant-parasitic nematodes causing severe damage on agricultural crops worldwide. A study was conducted to identify the species of root-knot nematodes causing damage on honeybush monocultures and to assess the seasonal variations in the nematode population. Soil samples were collected from six experimental sites in Genadendal, Western Cape province of South Africa from 2016 to 2017. DNA was extracted from single-second stage juveniles and species identifi cation was done using species-specifi c sequence-characterised amplifi ed regions (SCAR) primers. Meloidogyne hapla and M. javanica were identifi ed from the sites. Mean population density of the nematodes varied significantly (p < 0.05) in the six sites, with the peak population being recorded in summer of 2017. The study suggests that seasonal variation in temperature and moisture could contribute to changes in the population density of root-knot nematodes in the soil.
Honeybush (Cyclopia spp.) is an indigenous Cape fynbos legume plant with yellow fl owers and a rich honey aroma, from which the common name is derived (Van Wyk & Gorelik, 2017). Generally, spring fl owering occurs between September and October, followed by seed set in November (Motsa et al., 2017). Honeybush, which is a rich source of antioxidants, possesses antimutagenic properties (Marnewick et al., 2000; Kokotkiewicz & Luczkiewicz, 2009; Marnewick, 2009). The plant is popularly known for its use as a tea substitute among rural communities in the Cape Floristic Region (CFR). Traditionally, the plants, which were harvested from the wild, were processed for household use (Du Toit et al., 1998; Van Wyk & Gorelik, 2017). Today, honeybush is exported internationally as a health-enhancing product. To meet the growing demand for biomass, local species of honeybush are cultivated in certain areas, like the Agulhas Plain (Cyclopia genistoides (L.) Vent) and the Langkloof (Cyclopia intermedia Mey. and Cyclopia subternata Vogel). The sector is a source of livelihood for harvesters, smallscale farmers and commercial farmers in the Western and Eastern Cape provinces (McGregor, 2017). Commercial production of honeybush tea has risen in recent times due to increase local and international export market demands (SAHTA 2011; McGregor, 2017). However, reduction in yield and damage caused by plant-parasitic nematodes is one of the main problems confronting the local tea industry.Root-knot nematodes (RKN) are important pests of agricultural crops worldwide. They are widespread on leguminous and fl owering plants, consisting of about 98 species (Jones et al., 2013), of which about 22 species have been described from Africa (Onkendi et al., 2014). Meloidogyne arenaria Chitwood, Meloidogyne incognita (Kofoid & White) Chitwood and Meloidogyne javanica (Treub) Chitwood are usually found in the warm, tropical and subtropical regions of the world, while Meloidogyne chitwoodi Golden, O’Bannon, Santo & Finley, Meloidogyne fallax Karssen and Meloidogyne hapla Whitehead are more common in the temperate regions (Moens et al., 2009). In South Africa, M. incognita and M. javanica have been declared as economic pests of most crops, with about 4000 host plants, including field crops, ornamentals, medicinal and aromatic plants as well as weeds (Fourie et al., 1998; 2012; ARC 2014). The four major species, which include M. incognita, M. javanica, M. arenaria and M. hapla and the newly emerging Meloidogyne enterolobii Yang & Eisenback, 1983 have all been reported throughout South Africa, irrespective of the climatically different regions of the country concerned. Meloidogyne javanica has been reported from grapevine in the Western Cape province (Coetzee, 1968; Loubser, 1988), with there being indications that M. javanica is the most common species, followed by M. incognita, M. arenaria and M. hapla.Seasonal fluctuations in the population of RKN on important agricultural crops worldwide have been documented (Chormule et al., 2017; El-Ghonaimy et al., 2015; Fayzia et al., 2018; Shokoohi et al., 2019). Variation in soil temperature and moisture, due to seasonal changes are key factors that contribute mainly to the spatial and temporal distribution of nematodes in the soil (McSorley, 1998; Dinardo-Miranda & Fracasso, 2010). An understanding of the seasonal fluctuations of RKN on honeybush plants will, therefore, help in designing appropriate intervention plans for nematode control.Accurate identification of nematode pests is also key to the effective management and the quarantine strategies employed to prevent their spread. The traditional morphological identification, which is based on the morphological features, the morphometrics of second-stage juveniles (J2) and the perineal patterns of the adult female, is usually difficult, with it often showing wide intraspecific variation, with unreliable values (Subbotin et al., 2015). The use of species-specific primers, however, offers a relatively easy and rapid diagnostic tool for identifying the Meloidogyne species, and can be done using J2, which tends to be readily available in the soil. Therefore, the aim of this present investigation was to study the association of RKN with honeybush tea plants and to assess the seasonal changes in the nematode population on honeybush monocultures in the Western Cape province of South Africa.
Materials and Methods
Site description
Genadendal is located about 120 km east of Cape Town at -34.051565, 19.517402, and at an altitude of 231 m above sea level. The sites of honeybush cultivation included in the study were: a planting trial located about 5 km west of Genadendal Site A, which is composed of three plots (A1, A2 and A3), and other three plots (Sites B, C and D), which are situated in the main town in the area.Site A was an abandoned honeybush field, where three species of honeybush had been planted in 2007 (Fig. 1). The species involved were C. maculata, C. genistoides, and C. subternata. Three other honeybush plots, planted as part of a different experimental trial in 2015, with the same three species of honeybush, were located in Genadendal. The sites concerned (B, C and D) were also sampled for RKN. Mild winter rainfall between May and August is typical of the Mediterranean-type climate in the region, as are hot, dry summers, in which temperatures reach up to 42°C. The annual rainfall in the region reaches about 520 mm per annum. The plants involved were cultivated under dry land conditions. The climatic conditions for the weather stations that was closest to the geographical area was obtained from the Agro meteorology (ARC-ISCW) weather station at Elsenburg, Stellenbosch.
Fig. 1
Google Earth image showing the location of the sampling sites in the Western Cape province of South Africa.
Google Earth image showing the location of the sampling sites in the Western Cape province of South Africa.
Sampling, nematode isolation and identification
Sampling was done on three plots on the abandoned honeybush farmland and other three experimental plots in Genadendal between September 2016 and July 2017. Soil samples were collected from the rhizosphere of the honeybush plants, up to a depth of about 50 cm. Five plants were sampled per plot, with the soil samples from each plot being bulked and mixed, after which a composite sample was taken for analysis. Galled root samples were also collected from infected plants, while dead plants were uprooted and transported to the laboratory to assess the extent of root damage. Nematodes were extracted from the soil samples, using a modified Baermann extraction funnel method (Cobb, 1918). This involved pouring the samples over a two-ply paper towel that was supported on a coarse-meshed plastic screen and placed over a metal dish. The process was repeated for all the samples. Second-stage juveniles (J2) were collected from the extraction tray after 24 h and were examined under a stereo microscope at 10X. Root samples were washed and cut up into small pieces, with 50 g of the root samples being macerated in a blender for 60 s and poured onto a piece of filter paper placed on an extraction tray (Whitehead and Hemming 1965). The nematode suspension containing the J2 of RKN were collected from the tray into 250ml beakers after 24 h, and concentrated into 20ml from which an aliquot of 1ml was taken for nematode count. Mean population density (MPD) of nematodes per 250ml of each sample were recorded throughout the sampling period. Analysis of variance (ANOVA) was performed on the MPD of the RKN and the total number of plant-parasitic nematodes using SPSS version 26 (Statistical Package for the Social Sciences). Identification and counting of nematodes was done using a Leica DM2000 compound microscope at 40X.
DNA extraction and polymerase chain reaction
DNA was extracted from single J2 root-knot larvae obtained from the honeybush samples as described by Daramola et al. (2020). The specimen for DNA extraction were placed in a Petri-dish and washed twice with ddH2O. Single J2 specimens were each cut into 2 – 3 parts and placed in 10 μl lysis buffer (500 mM MgCl2,10 mM DTT, 4.5 % Tween20®, 0.1 % gelatine and 3 μl proteinase K at 600 μg ml-1), which was placed on the side of an Eppendorf tube. The tubes were kept at -80°C for about 15 min, and then incubated in a thermocycler at 65oC for 1 h, and at 95°C for 15 min, to lyse the cells and digest the proteins completely. The extraction yielded DNA products from individual J2, which were further used for polymerase chain reaction.PCR for the amplification of the DNA samples was done using KAPA2G™ 40 Robust HotStart ReadyMix (KAPA Biosystems), with specific primers in a 25 μL reaction consisting of 5 μL DNA and 2.5 μL each of the primer combination. A positive sample of M. javanica DNA sample from potato was included as control. The PCR reactions were centrifuged at 15,071 RCF at 10°C for 2 min, which were then placed in the thermocycler (GeneAmp 2720). The cycling condition for each primer set is as described by Adam et al. (2007). PCR products were separated on 1.5 % agarose gel in a Tris borate (TBE) buffer and visualised under UV light, using a trans-illuminator imaging system, after staining with ethidium bromide.
Ethical Approval and/or Informed Consent
This article does not contain any studies with humanparticipants or animals by any of the authors.
Results
Temperature and rainfall pattern at the sampling sites are indicated in Table 1. The location of the honeybush farms and the experimental plots that were sampled in the current study is shown in Fig. 1. Slight changes in the average temperature were observed during the sampling period. The summer of 2016 was recorded as having the highest temperature, with an average of 31.05°C and a low precipitation of 0.19 mm. Low rainfall was recorded during the sampling period, due to the drought that was experienced in the Western Cape at the time. Maximum precipitation of 1.65 mm was recorded during the winter of 2017. The annual amount of rainfall recorded for 2017, which was about 251.7 mm, was very low when compared with that which was recorded for the preceding years (Table 1).
Table 1
Temperature and rainfall distribution around Genadendal, Western Cape province (2016 – 2017).
2016
2017
Month
Temperature °C (max)
Temperature °C (min)
Rainfall (mm)
Temperature °C (max)
Temperature 0C (min)
Rainfall (mm)
January
32.37
19.34
0.26
29.89
16.29
1.4
February
30.59
16.82
0.34
30.73
17.48
0.14
March
26.95
16.06
1.11
30.09
15.07
0.09
April
26.08
13.63
0.89
28.79
14.34
0.92
May
24.31
11.22
0.34
25.11
11.79
0.33
June
20.03
8.48
2.05
20.44
7.51
0.82
July
18.68
8.2
2.72
18.96
7.09
0.4
August
21.55
8.83
1.47
17.28
7.55
1.65
September
21.06
9.34
0.77
20.56
8.66
0.58
October
25.74
11.23
0.25
22.1
9.37
0.79
November
28.04
13.99
0.18
24.27
12.5
1.27
December
31.05
16.07
0.19
26.92
14.98
0.27
Source: Agricultural Research Council, Stellenbosch, Western Cape South Africa.
Temperature and rainfall distribution around Genadendal, Western Cape province (2016 – 2017).Source: Agricultural Research Council, Stellenbosch, Western Cape South Africa.Primer codes used for identification of Meloidogyne species, sequences and sources.Adam et al., 2007Seasonal changes in population density of RKN associated with honeybushThe population density of plant-parasitic nematodes found in association with the honeybush during the sampling period is shown in Figure 2. The peak nematode population for all plant-parasitic nematodes was recorded in the summer of 2017 with a mean population density of 7,780 nematodes per 250ml of soil. There was a consistent increase in the population of the RKN from winter of 2016, until the end of sampling period in July 2017. The peak nematode population for RKN was recorded in the winter of 2017 at 5,280 RKN per 250ml soil.
Fig. 2
Mean population density of root-knot nematode (RKN) and other plant-parasitic nematode (PPN) associated with honeybush cultivation on six sites at Genadendal, Western Cape province of South Africa (2016-2017). Error bars represent standard errors (±SE).
Mean population density of root-knot nematode (RKN) and other plant-parasitic nematode (PPN) associated with honeybush cultivation on six sites at Genadendal, Western Cape province of South Africa (2016-2017). Error bars represent standard errors (±SE).The population density of the RKN found in association with the honeybush between 2016 and 2017 is shown in Figure 3. The effects of the seasonal variation on the mean nematode density (MPD) of RKN nematodes from the six sampling sites are shown in Figure 4. An increase was found in the MPD of the RKN from September 2016 to July 2017. However, no signifi cant difference (p < 0.05) was found in the effect of the sampling period on the population of the RKN recorded as being present on the honeybush plots. The mean population density of the RKN present on the varied honeybush plots was compared. A signifi cant difference (p < 0.05) was found in the number of RKN recorded at the different sampling sites. The mean nematode population, which varied significantly (p < 0.005) in the infectedhoneybush fields, followed a consistent pattern throughout the sampling period (Fig. 3). Significantly (p < 0.05) higher numbers of nematodes were recorded in the soil samples taken from site D throughout the sampling period. Low numbers of RKN were recorded from sampling site C, although the numbers were not significantly different (p = 0.828) from those that were recorded as being present at sites A1 and A3, which were lower than those that were obtained from sampling sites A2 and B. The effect of interaction between the sampling period and the honeybush sites regarding the RKN population are compared in Figure 3. The sampling period had no signifi cant effect (p > 0.05) on the population of RKN recorded from the sampling sites. Although peak nematode population was recorded from site D during the summer (February) of 2017 however, this was not signifi cantly different from the population that was recorded in the following winter. Also, no RKN was recorded as being present on sampling site C at the onset of the sampling period in September 2016, however, low numbers of the nematode were recorded at the conclusion of the period concerned, which indicates that the nematodes must have spread into the fi eld.
Fig. 3
Mean population density of root-knot nematode (RKN) associated with honeybush cultivation at six sampling sites in Genadendal, Western Cape province of South Africa (2016-2017). Error bars represent standard errors (±SE).
Fig. 4
Seasonal fluctuation and changes in the nematode population during the sampling period of 2016-2017 at the six experimental sites in Genadendal, Western Cape province of South Africa.
Mean population density of root-knot nematode (RKN) associated with honeybush cultivation at six sampling sites in Genadendal, Western Cape province of South Africa (2016-2017). Error bars represent standard errors (±SE).Seasonal fluctuation and changes in the nematode population during the sampling period of 2016-2017 at the six experimental sites in Genadendal, Western Cape province of South Africa.
Symptoms and damage caused by root-knot nematodes on honeybush
The damaging effects of RKN on honeybush plants are shown in Figure 5, with the symptoms of such damage varying with the age of the plants. In the case of the older plants, heavily galled roots were observed, and the plants showed above-ground symptoms of nutrient deficiency and chlorosis. Wilting was more common among the younger infected plants, with the plants losing their foliage, and the root system becoming completely damaged and non-functional. In some cases, the loss of plant stands was recorded. Figure 6 shows the persistence of healthy flowering honeybush plants and the loss of plant stands found on the abandoned honeybush farm.
Fig. 5
Symptoms of RKN damage on honeybush roots.
Fig. 6
A-B: Healthy flowering honeybush plants. C-D: Nematode damage on honeybush field, showing loss of plant.
Symptoms of RKN damage on honeybush roots.A-B: Healthy flowering honeybush plants. C-D: Nematode damage on honeybush field, showing loss of plant.
Molecular identification
Meloidogyne hapla and M. javanica were identified from the honeybush plots, with DNA amplification using species-specific SCAR primers (Table 2). The results of the SCAR-based molecular iden
Table 2
Primer codes used for identification of Meloidogyne species, sequences and sources.
Species
Primer
Sequence 5'-3'
Source
M. arenaria
Far
TCGGCGATAGAGGTAAATGAC
M. arenaria-specific SCAR
Rar
TCGGCGATAGACACTACAAACT
Zijlstra et al. (2000)
M. javanica
Fjav
GGTGCGCGATTGAACTGAGC
M. javanica-specific SCAR
Rjav
CAGGCCCTTCAGTGGAACTATAC
Zijlstra et al. (2000)
M. incognita
MI-F
GTGAGGATTCAGCTCCCCAG
M. incognita-specific SCAR
MI-R
ACGAGGAACATACTTCTCCGTCC
Meng et al. (2004)
M. hapla
JMV1
GGATGGCGTGCTTTCAAC
M. hapla-, M. chitwoodi-and
JMV2
TTTCCCCTTATGATGTTTACCC
M. fallax-specific IGS-SCAR
JMVhapla
AAAAATCCCCTCGAAAAATCCACC
Wishart et al. (2002)
Adam et al., 2007
tification of the J2 of RKN isolated from the six honeybush plots indicated that M. javanica and M. hapla were evident in the sampled fields. The presence of M. javanica was recorded on only one of the experimental plots (Site A3) out of the six samples that were amplified, whereas M. hapla was more prevalent on the abandoned honeybush farm. The SCAR primers, Fjav/Rjav (M. javanica) and JMV1/JMV2/ JMV (M. hapla), provided consistent results, with the PCR products being readily amplified from using a single J2 (Fig. 7), therefore providing a rapid and simple approach for detecting Meloidogyne species.
Fig. 7
Gel pictures obtained from the amplification of DNA products of single J2s of RKN from honeybush plots. a. Meloidogyne javanica (amplified with FJav/Rjav primers) and b. M. hapla (with JMV1/JMV2 & JMV primers).
Gel pictures obtained from the amplification of DNA products of single J2s of RKN from honeybush plots. a. Meloidogyne javanica (amplified with FJav/Rjav primers) and b. M. hapla (with JMV1/JMV2 & JMV primers).
Discussion
The results of the current study showed that there is a strong association between the RKN species (M. hapla and M. javanica) and honeybush plants with the nematodes possessing the ability to cause serious damage and economic losses to the plants concerned. Economic losses and severe damage to many field and horticultural crops, due to RKN, have received global attention (Moens et al., 2009; He et al., 2015). Meloidogyne species have been described as one of the top ten plant-parasitic nematodes worldwide (Jones et al., 2013), associated with a staggering estimated annual losses of $157 billion (USD), globally (Abad et al., 2008). In Africa, RKN have been described as posing a major threat to food security, with serious implications for the gross national income and for the foreign exchange earnings involved. Coyne et al. (2018) describe RKN as probably posing the greatest biotic threat to agriculture in sub-Saharan Africa. The results of the current study confirm the damaging potential of the nematodes for the monoculture of honeybush, thus indicating a potential threat to the tea industry. In the current investigation, the extensive root damage caused by RKN could have contributed to the complete crop failure that was recorded on the abandoned honeybush tea plantation.The above-ground symptoms of the infection of the young honeybush plants observed in the current study are synonymous with the symptoms that have frequently been associated with Meloidogyneinfection elsewhere (Mitkowski & Abawi, 2003). Such symptoms include stunting, the yellowing of leaves and wilting, which can, eventually, result in a reduction in the quality and quantity of yield, especially in terms of honeybush production, where the aerial parts and foliage of the plants are harvested for tea production. The fact that high numbers of the nematodes were found in the soil (2340/250 ml-1 soil) indicates the serious threat and damage caused to the plants concerned, with the economic losses associated with Meloidogyne species having the potential to be extensive in areas suffering from high infestation (Onkendi & Moleleki, 2013).The four important species of RKN, namely M. incognita, M. arenaria, M. javanica and M. hapla, have been reported in association with a wide range of agricultural crops and weeds in South Africa (Kleynhans et al., 1996; Ntidi et al., 2015; Marais, 2015; Agenbag, 2016). The distribution of the nematode species has been linked to their adaptability to the prevailing climatic conditions and to the availability of suitable host plants. From earlier reports in the Western Cape province of South Africa, M. javanica can be seen to be more frequently encountered, and pathogenic, in the region. Daramola et al. (2020) reported M. javanica and M. hapla from honeybush fields in Western Cape. According to Loubser and Meyer (1987), the presence of the two most important species in South Africa vineyards is determined by the vastly different climatic regions concerned. The results of the study showed that M. hapla was more prevalent in the sampled honeybush plantations in the Western Cape. Whereas M. javanica was only found to be present in one field, the presence of M. incognita and M. arenaria was not recorded on the honeybush plots. An earlier report indicates that the farmers were experiencing severe constraints to honeybush cultivation, due to the lack of water and to the incidence of RKN in the soil (Hart et al., 2005). As a result, the drought experienced during the sampling period could have predisposed the plants to more extensive damage.Edaphic factors as soil type, temperature and rainfall are key factors that help to determine the distribution of the Meloidogyne species. Soil temperature and moisture are considered the most important abiotic factors affecting nematode population dynamics (McSorley, 1998). In the current investigation, the population density of the nematodes varied significantly in the different sites and high population of RKN were observed on infected sites throughout the sampling period, even at low temperatures during winter. Meloidogyne hapla seems to favour the temperate and colder regions, with it being able to survive in field temperatures below 0°C (Desaeger, 2019). Unlike the thermophilic species, of warm climatic areas, they can withstand colder temperatures and can, occasionally, be found in the cooler upland tropics (Brodie et al., 1993). In the current study, the presence of M. hapla was recorded in Genadendal, which is a town that is located in a relatively temperate region of South Africa, where temperatures can sometimes drop to below 5°C during the winter months. The fact that the peak population of the nematode was recorded during the winter of the sampling period suggests that M. hapla can survive at low temperatures, and that it is well adapted to the climatic conditions concerned. The annual rainfall of 273mm in the region, and the sandy clay soil type that is common in the Western Cape, seem to also provide ideal conditions in which the nematodes can thrive. At the outset of the sampling period in the current study, four honeybush plots were initially found to be infested, but the presence of RKN nematodes was recorded on all six plots at the end of the sampling period concerned. The above also indicates that RKN can easily spread to other fields, with it further emphasising the need to ensure compliance with good agronomic practices and to implement plant quarantine measures on the infested fields, so as to prevent the devastating effect of root-knot damage being caused to the plants.The DNA amplification of the J2s using SCAR primers identified M. hapla and M. javanica as being species associated with the inflicting of damage on honeybush plants. A similar result was earlier obtained by Adam et al. (2007), who proposed the molecular diagnostic key for the identification of seven Meloidogyne species using J2. The above agrees with the findings of Fourie et al. (2001), which identified and differentiated, by means of the SCAR-PCR technique, that M. fallax, M. chitwoodi, M. javanica, M. incognita, M. arenaria and M. hapla were species of RKN occurring in South Africa. The accurate identification of RKN species is important for the design of effective nematode management options, and for implementing phytosanitary regulations. According to Powers and Harris (1993), identification methods using the J2 are useful for making effective crop management decisions. The methods are also rapid and cost-effective to use, thereby making diagnosis affordable to smallholder farmers. Therefore, the molecular identification of the Meloidogyne species, based on amplification of the J2 with species-specific primers, is encouraged and SCAR primers should be developed to accommodate species delimitation of other important plant-parasitic nematodes of agricultural crops.
Authors: John T Jones; Annelies Haegeman; Etienne G J Danchin; Hari S Gaur; Johannes Helder; Michael G K Jones; Taisei Kikuchi; Rosa Manzanilla-López; Juan E Palomares-Rius; Wim M L Wesemael; Roland N Perry Journal: Mol Plant Pathol Date: 2013-07-01 Impact factor: 5.663
Authors: Pierre Abad; Jérôme Gouzy; Jean-Marc Aury; Philippe Castagnone-Sereno; Etienne G J Danchin; Emeline Deleury; Laetitia Perfus-Barbeoch; Véronique Anthouard; François Artiguenave; Vivian C Blok; Marie-Cécile Caillaud; Pedro M Coutinho; Corinne Dasilva; Francesca De Luca; Florence Deau; Magali Esquibet; Timothé Flutre; Jared V Goldstone; Noureddine Hamamouch; Tarek Hewezi; Olivier Jaillon; Claire Jubin; Paola Leonetti; Marc Magliano; Tom R Maier; Gabriel V Markov; Paul McVeigh; Graziano Pesole; Julie Poulain; Marc Robinson-Rechavi; Erika Sallet; Béatrice Ségurens; Delphine Steinbach; Tom Tytgat; Edgardo Ugarte; Cyril van Ghelder; Pasqua Veronico; Thomas J Baum; Mark Blaxter; Teresa Bleve-Zacheo; Eric L Davis; Jonathan J Ewbank; Bruno Favery; Eric Grenier; Bernard Henrissat; John T Jones; Vincent Laudet; Aaron G Maule; Hadi Quesneville; Marie-Noëlle Rosso; Thomas Schiex; Geert Smant; Jean Weissenbach; Patrick Wincker Journal: Nat Biotechnol Date: 2008-07-27 Impact factor: 54.908
Authors: Danny L Coyne; Laura Cortada; Johnathan J Dalzell; Abiodun O Claudius-Cole; Solveig Haukeland; Nessie Luambano; Herbert Talwana Journal: Annu Rev Phytopathol Date: 2018-06-29 Impact factor: 13.078