Genetic depletion studies inform receptor usage by virulent hantaviruses in human endothelial cells.

Hantaviruses are RNA viruses with known epidemic threat and potential for emergence. Several rodent-borne hantaviruses cause zoonoses accompanied by severe illness and death. However, assessments of zoonotic risk and the development of countermeasures are challenged by our limited knowledge of the molecular mechanisms of hantavirus infection, including the identities of cell entry receptors and their roles in influencing viral host range and virulence. Despite the long-standing presumption that β3/β1-containing integrins are the major hantavirus entry receptors, rigorous genetic loss-of-function evidence supporting their requirement, and that of decay-accelerating factor (DAF), is lacking. Here, we used CRISPR/Cas9 engineering to knockout candidate hantavirus receptors, singly and in combination, in a human endothelial cell line that recapitulates the properties of primary microvascular endothelial cells, the major targets of viral infection in humans. The loss of β3 integrin, β1 integrin, and/or DAF had little or no effect on entry by a large panel of hantaviruses. By contrast, loss of protocadherin-1, a recently identified entry receptor for some hantaviruses, substantially reduced hantavirus entry and infection. We conclude that major host molecules necessary for endothelial cell entry by PCDH1-independent hantaviruses remain to be discovered.

Introduction

Hantaviruses are a large family of enveloped viruses with segmented negative-strand RNA genomes whose members infect a wide range of mammalian hosts (Elliott et al., 1991; Mittler et al., 2019; Vaheri et al., 2013). The zoonotic transmission of some rodent-borne hantaviruses is associated with two major diseases in humans, hemorrhagic fever with renal syndrome (HFRS), and hantavirus cardiopulmonary syndrome (HCPS), in endemic regions of Europe/Asia and North/South America, respectively (Peters et al., 1999). Zoonotic infections by some other hantaviruses (e.g., Seoul virus, SEOV) have a global distribution mirroring that of their rodent hosts. Most HFRS cases are associated with the ‘Old-World hantaviruses’ Hantaan virus (HTNV), SEOV, Dobrava-Belgrade virus (DOBV), and Puumala virus (PUUV) infections, whereas HCPS is primarily caused by the ‘New-World hantaviruses’ Andes virus (ANDV) and Sin Nombre virus (SNV) (Jiang et al., 2016; Macneil et al., 2011). Although humans are typically dead-end hosts for rodent-borne hantaviruses, several incidents of ANDV person-to-person transmission, including a recent superspreader event, have been documented, underscoring the epidemic threat posed by these agents (Martínez et al., 2020; Padula et al., 1998). Despite this strong potential for transmission from known and unknown host reservoirs and the significant burden of severe disease, no FDA-approved vaccines or specific therapeutics are available for hantaviruses (Mittler et al., 2019). Both assessments of viral zoonotic risk and the development of antiviral treatments are challenged by our limited understanding of the molecular mechanisms of hantavirus infection, including the identities, viral and host species specificities, and functional roles of cellular entry receptors.

Integrins (αVβ3, α5β1, αMβ2, and αXβ2) and components of the complement system (e.g., decay-accelerating factor [DAF]) have been previously proposed as candidate hantavirus receptors and/or entry factors, based largely on cDNA complementation experiments to rescue infection in nonpermissive cell lines, receptor-blocking studies in non-polarized and polarized endothelial cells and/or binding assays (Buranda et al., 2010; Gavrilovskaya et al., 1999; Gavrilovskaya et al., 1998; Krautkrämer and Zeier, 2008; Popugaeva et al., 2012; Raftery et al., 2014). β3- and β1-containing integrins have been presumed to be the major entry receptors for virulent and avirulent hantaviruses, respectively, for over two decades (Gavrilovskaya et al., 1999; Gavrilovskaya et al., 2002; Gavrilovskaya et al., 1998; Raymond et al., 2005). More recently, we identified protocadherin-1 (PCDH1) as a critical determinant of attachment, entry, and infection by New-World hantaviruses, but not their Old-World counterparts, in primary human microvascular endothelial cells (Jangra et al., 2018), which are major targets of hantavirus infection in vivo (Mackow and Gavrilovskaya, 2009). However, evidentiary support for each of the above putative receptors differs substantially. PCDH1 was identified in a comprehensive genetic screen for ANDV entry factors, and its genetic depletion in endothelial cells inhibited viral entry and infection. Further, genetic loss of PCDH1 reduced viral multiplication in Syrian hamsters and protected them from lethal HCPS-like disease (Jangra et al., 2018). By contrast, none of the other candidate receptors were observed as hits in two independently conducted, unbiased genetic screens for hantavirus host factors (Jangra et al., 2018; Kleinfelter et al., 2015; Petersen et al., 2014). Moreover, to our knowledge, they have not been rigorously evaluated for their genetic requirement in physiologically relevant in vitro and in vivo models. To date, therefore, the critical host determinants of hantavirus entry remain incompletely defined.

Here, we used a genetic depletion/complementation strategy to investigate the requirements for four hantavirus receptor candidates/entry host factors described in the literature – β3 integrin, β1 integrin, DAF, and PCDH1 – during glycoprotein-mediated entry and infection of human endothelial cells by divergent hantaviruses.

Results and discussion

We first selected a previously well-characterized human microvascular endothelial cell line, TIME, as a biologically faithful and genetically manipulable model for primary endothelial cells (Venetsanakos et al., 2002). We confirmed through cell staining and flow cytometry that this cell line resembled primary human umbilical vein endothelial cells (HUVEC) in expressing key endothelial markers – the platelet endothelial cell adhesion molecule-1 (PECAM-1/CD31) and the von Willebrand factor (vWF) – as well as the four candidate hantavirus receptors under investigation (Figure 1a). Furthermore, TIME cells were susceptible to hantavirus entry mediated by divergent Gn/Gc proteins (Figure 2). We concluded, therefore, that TIME cells were also suitable to study the virus–host interactions that drive hantavirus entry in endothelial cells.

Figure 1.

Suitability of TIME cells as a model to study hantavirus entry and the generation of knockout cells.

(a) Upper panels, total flow cytometry plots of HUVEC and TIME cells stained for endothelial cell markers PECAM and von Willebrand factor (vWF). Medium and lower panels, surface flow cytometry plots of HUVEC and TIME cells stained for PCDH1, β3 integrin, DAF, β1 integrin. (b) Surface flow cytometry of wild-type (WT) and knockout (KO) TIME cells stained as above. Histograms of WT cells are shown in gray; single- and double-KO cells are shown in color. (c) Western blot analysis of WT TIME cells and KO cells ± cDNA. β-Actin was used as a loading control.

Sequences of interests were amplified by PCR and then TA-cloned into the pGEM-T vector. For each knockout cell population, 15–20 clones were subjected to Sanger sequencing. All sequenced clones showed an indel at the targeted site, resulting in a frameshift that brought one or more stop codons into frame.

Figure 2.

Hantavirus receptor requirement in endothelial cells.

(a) Representative images of eGFP-positive rVSV-infected wild-type (WT) and PCDH1, ITGB3, and DAF knockout (KO) TIME cells. Nuclei were stained with Hoechst (blue). (b) WT and KO cells were exposed to the indicated rVSV-Gn/Gc. n=11 for each cell line from three independent experiments. WT versus KO cells, two-way ANOVA with Dunnett’s test; ***p<0.0001. Other comparisons were not statistically significant (p>0.05). (c) WT and KO cells lacking (–cDNA) or expressing the corresponding cDNA (+cDNA) were exposed to rVSVs bearing the indicated hantavirus glycoproteins. Viral infectivities are shown in the heatmap. Averages are from three independent experiments (d) WT and double-KO cells were exposed to rVSV-Gn/Gc. PCDH1/ITGB3 KO, n = 12; PCDH1/DAF KO, n = 12; and ITGB3/DAF KO, n=9 from three independent experiments. WT versus KO cells, two-way ANOVA with Dunnett’s test; ****p<0.0001. Other comparisons were not statistically significant. (e) Cells were exposed to authentic hantaviruses and infected cells were manually enumerated by immunofluorescence microscopy for ANDV, HTNV, and PUUV (each point represents infectivity of the average of positive cells per field relative to WT). Data are from two independent experiments. PHV- and SNV-infected cells were detected and enumerated by automated imaging following immunofluorescence staining. For PHV: WT and PCDH1 KO n=18, ITGB3 KO n = 16 from four independent experiments; DAF KO, n=10, ITGB1 KO n=8, from three independent experiments. For SNV: WT, ITGB3 KO, DAF KO n=6; PCDH1 KO n = 5 from three independent experiments. Averages ± SD are shown. WT versus KO cells, two-way ANOVA with Tukey’s test; ***p<0.0001. Other comparisons were not statistically significant (p>0.05).

(a) Representative images of eGFP-positive rVSV-infected wild-type (WT) and ITGB1 knockout (KO) TIME cells. Nuclei were stained with Hoechst (blue). (b) WT and KO cells were exposed to the rVSV bearing the ANDV, SNV, PHV, HTNV, and EBOV glycoproteins. n=12 for each cell line from three independent experiments. WT versus KO cells, two-way ANOVA. Comparisons were not statistically significant (p>0.05).

We used CRISPR/Cas9 genome engineering to knockout (KO) PCDH1, DAF, and the genes encoding β3 and β1 integrins (ITGB3 and ITGB1, respectively), in TIME cells. Subpopulations of CRISPR/Cas9-engineered, receptor-deficient cells were isolated by FACS following staining of live cells with protein-specific antibodies. Gene KO was verified by Sanger sequencing of PCR amplicons bearing the targeted genomic loci (Figure 1—figure supplement 1 ). Loss of protein expression at the cell surface and in cell extracts was verified by flow cytometry and western blotting, respectively (Figure 1b,c).

Figure 1—figure supplement 1.

Sanger sequences retrieved from the targeted genomic loci for each knockout cell population.

Sequences of interests were amplified by PCR and then TA-cloned into the pGEM-T vector. For each knockout cell population, 15–20 clones were subjected to Sanger sequencing. All sequenced clones showed an indel at the targeted site, resulting in a frameshift that brought one or more stop codons into frame.

We next exposed WT and KO TIME cells to recombinant vesicular stomatitis viruses carrying the Gn/Gc glycoproteins of ANDV, SNV, and HTNV (rVSV-Gn/Gc) (Figure 2a,b). A similar surrogate virus bearing the Ebola virus glycoprotein (rVSV-EBOV GP) was used as a negative control. PCDH1 KO substantially diminished ANDV and SNV Gn/Gc-mediated infection, whereas it had no discernible effect on that by HTNV Gn/Gc. Unexpectedly, ITGB3 and DAF KOs did not inhibit endothelial cell entry mediated by these glycoproteins (Figure 2a,b). To examine the effect of candidate receptor loss on a larger panel of genetically divergent hantaviruses with varied levels of known virulence in humans, we extended these studies to rVSVs bearing Gn/Gc proteins from the New-World hantaviruses Choclo virus (CHOV), Maporal virus (MPRLV), Prospect Hill virus (PHV), and the Old-World hantaviruses PUUV, SEOV, and DOBV (Figure 2c). Loss of PCDH1 substantially reduced endothelial cell entry and infection mediated by the glycoproteins from the New-World viruses but not the Old-World viruses, in a manner that could be restored by complementation with PCDH1 cDNA. By contrast, and as observed above for ANDV, SNV, and HTNV, none of these viruses displayed a requirement for ITGB3 or DAF (Figures 1c–2c). These findings confirm and extend the critical role played by PCDH1 in cell entry by New-World hantaviruses. They are also inconsistent with the hypotheses that β3 integrin and DAF are necessary for hantavirus cell entry in endothelial cells.

To account for potential receptor redundancy and cross-talk, we next generated and evaluated double-KO populations of TIME cells through CRISPR/Cas9 engineering (Figure 1b). PCDH1/ITGB3 and PCDH1/DAF1 KO cells resembled PCDH1 KO cells in susceptibility to rVSV-Gn/Gc infection (Figure 2d), indicating that the loss of PCDH1 did not unmask viral requirements for β3 integrin or DAF, or vice versa. Furthermore, ITGB3/DAF KO cells remained fully susceptible to viral entry (ANDV, SNV) or exhibited only a modest (~25%) reduction (HTNV) (Figure 2d), suggesting that the lack of viral entry phenotypes in the ITGB3 and DAF single-KO cells cannot be explained by the functional redundancy of these two proteins.

Finally, we evaluated the single-KO TIME cells in infections with authentic hantaviruses (Figure 2e). These experiments independently corroborated our results with rVSVs. Specifically, we observed a critical role for PCDH1 in endothelial cell infection by the New-World hantaviruses ANDV, SNV, and PHV, and no apparent roles for β3 integrin and DAF in entry by virulent New-World and Old-World hantaviruses. Concordantly, quantitative real-time PCR revealed a substantial reduction in the generation of SNV progeny genomes at 24 hr post-infection in cells deficient for PCDH1 (5 ± 2%) but not β3 integrin (108 ± 15%) or DAF (82 ± 13%; mean ± SEM, n=6 from two independent experiments for each cell line). Contrary to earlier hypotheses suggesting β1 integrin as receptors for avirulent hantaviruses (Gavrilovskaya et al., 1998), we also found no apparent role for β1 integrin in entry by both the rVSV and the authentic version of New-World hantavirus PHV (Figure 2e, Figure 2—figure supplement 1).

Figure 2—figure supplement 1.

Dispensability of β1 integrin in TIME cells.

(a) Representative images of eGFP-positive rVSV-infected wild-type (WT) and ITGB1 knockout (KO) TIME cells. Nuclei were stained with Hoechst (blue). (b) WT and KO cells were exposed to the rVSV bearing the ANDV, SNV, PHV, HTNV, and EBOV glycoproteins. n=12 for each cell line from three independent experiments. WT versus KO cells, two-way ANOVA. Comparisons were not statistically significant (p>0.05).

Endothelial cells are primary targets of the viral infection and subversion that is central to hantavirus disease in humans. Of the major receptor/entry host factor candidates proposed to date for hantaviruses (β3 integrin, β1 integrin, DAF, PCDH1), only the genetic loss of PCDH1 was associated with the reduction of viral infection in endothelial cells in this study, underscoring PCDH1’s critical role as an entry receptor for New-World hantaviruses, but not their Old-World counterparts in these cells. We conclude that the other previously described candidate receptors (β3 integrin, β1 integrin, DAF) are dispensable for viral entry in endothelial cells. We note that our results do not rule out that one or more of these proteins is involved in (1) hantavirus entry into other cell types not examined herein; (2) hantavirus entry into polarized cells, as proposed for DAF (Krautkrämer and Zeier, 2008); or (3) endothelial cell subversion post-viral entry, as shown previously (Gavrilovskaya et al., 1999; Gavrilovskaya et al., 1998; Krautkrämer and Zeier, 2008). The sum of the evidence does indicate, however, that the major host molecules necessary for entry and infection in endothelial cells by the PCDH1-independent, HFRS-causing Old-World hantaviruses remain to be discovered.

Materials and methods

Cells

HUVEC (C2517A-Lonza) and TIME cells (ATCC CRL4025) were cultured as described previously (Venetsanakos et al., 2002). HUVEC and TIME cells were cultured in EBM-2 Basal Medium (CC-3156 Lonza) and EGM-2 SingleQuotsTM Supplements (CC-4176-Lonza) supplemented with 5% heat-inactivated fetal bovine serum (FBS, Atlanta Biologicals), 1% penicillin/streptomycin (P/S, GIBCO), and 1% Gluta-MAX (GIBCO). Cells were passaged every 3–4 days using 0.05% Trypsin/EDTA solution (GIBCO). African vervet monkey kidney Vero cells were maintained in Dulbecco’s modified Eagle medium (DMEM) (high glucose) supplemented with 2% heat-inactivated FBS, 1% P/S, and 1% Gluta-MAX. 293T cells were cultured in DMEM (high glucose, GIBCO) supplemented with 10% heat-inactivated FBS (Atlanta Biologicals), 1% penicillin/streptomycin (P/S, GIBCO), and 1% Gluta-MAX (GIBCO). All cell lines used here were negative for mycoplasma. STR profiling was performed for TIME cell line ATCC CRL-4025 authentication (Genomics Core, Albert Einstein College of Medicine).

Surface and total flow cytometry

For surface staining, cells were kept at 4°C. Foxp3/Transcription Factor Staining Buffer Kit was used for intracellular staining following the manufacturer’s instructions (TNB-0607, KIT). Antibodies used were as follows: AF480-Rabbit-α–vWF (ab195028, Abcam), PeCy7-Mouse-α–PECAM (563651, BD), APC-Mouse-α–β1-Integrin (559883, BD), AF 647-Mouse-α–β3-Integrin (336407, Biolegends), PE-Mouse-α–DAF (555694, BD), and α–PCDH1 mAb 3305 (2)/AF488-α–Human (A-11013, Invitrogen). Zombie NIR Fixable Viability Kit (BioLegend) was used to assess live/dead status of the cells.

Western blotting

Performed as described (Jangra et al., 2018). Briefly, cells were lysed in radioimmunoprecipitation assay lysis buffer (RIPA) containing protease inhibitors (Sigma). Cell extracts were normalized by Bradford assay, and 40 µg of protein was added per lane. The extracted proteins were separated by 10% SDS–PAGE and transferred onto 0.22 µm nitrocellulose membranes (GE Healthcare Life Sciences). Blots were cut approximately in half for subsequent incubation with primary antibodies and aligned back together for imaging. Antibodies used were as follows: Mouse α–PCDH1 (sc-81816, Santa Cruz) 1:200; Rabbit-α–β3 Integrin (#4702, Cell Signaling) 1:300; Mouse-α–DAF (NaM16-4D3, Santa Cruz) 1:200; Mouse α–β-Actin (sc-4778, Santa Cruz) 1:300. IRDye 680LT Goat α-Rabbit IgG or IRDye 680LT Goat α-Mouse secondaries Abs (LI-COR) were used at a dilution of 1:10,000, and the final blot was then imaged using a LI-COR Fc fluorescent imager.

Generation of KO cell populations

A CRISPR sgRNA was designed to target, PCDH1 5′-GTTTGAGCGGCCCTCCTATG-3′ (Jangra et al., 2018); ITGB3 5′--3′; DAF 5′--3′; and ITGB1 5′-AATGTAACCAACCGTAGCAA-3′ (protospacer acceptor motif [PAM] is underlined). sgRNAs were cloned into lentiCRISPR v2 (Addgene plasmid # 52961), and CRISPR-Cas9 engineering was performed as described (Jangra et al., 2018). Receptor-negative subpopulations of TIME cells were isolated by FACS sorting. Double-KO cell populations were generated using a single-KO cell population and then CRISPR-Cas9 engineering with a different sgRNA as described before. Double-receptor-negative subpopulations of TIME cells were isolated by FACS sorting. The targeted genomic loci in genomic DNA isolated from these subpopulations were amplified by PCR, and the amplicons were TA-cloned into the pGEM-T vector. Fifteen to 20 clones for each KO cell population were subjected to Sanger sequencing. For each KO cell population, all sequenced clones showed an indel at the targeted site, resulting in a frameshift that brought one or more stop codons into frame.

Stable cell populations expressing PCDH1/ITGB3/DAF in KO cells

TIME KO cell populations ectopically expressing gene variants were generated by retroviral transduction. PCDH1 canonical isoform Q08174-1 (Uniprot), DAF canonical isoform P08174-1 (Uniprot), and ITGB3 canonical isoform P05106-1 (Uniprot) were codon optimized (humanized) and then cloned into pBABE-puro vector (Addgene plasmid # 1764). Retroviruses packaging the transgenes were produced by transfection in 293T cells (Kleinfelter et al., 2015), and target cells were exposed to sterile-filtered retrovirus supernatants in the presence of polybrene (8 μg/ml) at 36 hr and 60 hr post-transfection. Media was replaced 6 hr after each transduction with EBM-2 Basal Medium. Transgene expression was confirmed by FACS and western blot. Receptor-positive subpopulations of TIME cells were isolated by FACS sorting.

rVSVs and infections

rVSVs expressing eGFP and bearing Gn/Gc from ANDV, SNV, HTNV, SEOV, DOBV, MPRLV, EBOV, PHV, or mNeon green phosphoprotein P fusion protein (mNG-P) bearing Gn/Gc PUUV were described previously (Jangra et al., 2018; Kerkman et al., 2019; Kleinfelter et al., 2015; Slough et al., 2019; Wong et al., 2010). rVSV expressing mNeon Green fused to the VSV phosphoprotein and bearing Gn/Gc from CHOV (GenBank accession number KT983772.1) was generated by using a plasmid-based rescue system in 293T human embryonic kidney fibroblast cells as described before (Kleinfelter et al., 2015). Rescued virus was amplified on Vero cells and its identity was verified by sequencing of the Gn/Gc-encoding gene. Viral infectivity was measured at 14 hr post-infection by automated enumeration of eGFP- or mNeongreen-positive cells using a Cytation5 automated fluorescence microscope (BioTek) and analyzed using the Gen5 data analysis software (BioTek). 100% relative infectivity corresponds to 18–35% infected cells for ANDV, SNV, HTNV, EBOV, CHOV, MPRLV and 8–15% for SEOV, DOBV, PHV, PUUV.

Hantavirus and infections

ANDV isolate Chile-9717869, HTNV isolate 76–118, PUUV isolate Sotkamo, PHV, and SNV isolate SN77734 were used. TIME cells were seeded in 24-well plates (on glass coverslips) or 96-well plates and infected with a multiplicity of infection of 1. After 48 hr (24 hr for SNV), immunofluorescence was done as described before (Stoltz et al., 2007). Briefly, human polyclonal antibodies from convalescent patient serum plus anti-hantavirus nucleocapsid protein B5D9 monoclonal antibody (Progen) were used for HTNV, PUUV, ANDV. Rabbit polyclonal sera specific for HTNV nucleoprotein NR-12152 (BEI Resources) was used for PHV and SNV and incubated for an hour. For HTNV-, PUUV-, ANDV-infected cells, AF594-α–Human and α-Mouse IgG antibodies (Invitrogen) were used as secondaries. For SNV and PHV, AF488-α–Rabbit IgG was used (Invitrogen). Counterstaining of nuclei was done with DAPI (Thermo Fisher Scientific). Cells were imaged by fluorescence microscopy (Nikon, Eclipse TE300) with a 60× objective or by automated enumeration of eGFP-positive cells using a Cytation5 automated fluorescence microscope (BioTek) and analyzed using the Gen5 data analysis software (BioTek).

SNV RNA levels

WT and KO TIME cells were harvested before infection (negative control) or at 24 hr after infection. Degenerate primers and probe were adopted from Kramski et al., 2007 based on the S-segment of the SNV genome. Human β-actin primers with a VIC/TAMRA-dye probe (Applied Biosystems, Cat. # 4310881E) was used as an endogenous control. The qPCR were carried out by using TaqMan Fast Advanced Master Mix (Applied Biosystems, Thermo Fisher Scientific) according to the manufacturer's instructions. Relative gene fold change was calculated by normalizing SNV to β-actin in cells using ΔΔCt values. Averages ± SEM from two independent experiments are shown.

Statistics and reproducibility

The number of independent experiments and the measures of central tendency and dispersion used in each case are indicated in the figure legends. The testing level (alpha) was 0.05 for all statistical tests. Statistical comparisons were carried out by two-way ANOVA with a post hoc correction for family-wise error rate. All analyses were carried out in GraphPad Prism.

Our editorial process produces two outputs: i) public reviews designed to be posted alongside the preprint for the benefit of readers; ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.

Thank you for submitting your article "Genetic depletion studies inform receptor usage by virulent hantaviruses in human endothelial cells" for consideration by eLife. Your article has been reviewed by 2 peer reviewers, and the evaluation has been overseen by a Reviewing/Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Robert Orchard (Reviewer #2).

The reviewers have discussed their reviews with one another, and I have drafted this to help you prepare a revised submission.

Essential revisions:

1) Both reviewers asked you to comment on whether these molecules may have a role in infection of polarized cells, which was the original observation in the literature. While you make a passing mention of this, it is an important point and would be consistent with other viruses (e.g., CVB).

2) Please update the methods to include information on how complementation was performed.

Additional experiments are suggested by the reviewers but will not be required in the revised submission.

Reviewer #1 (Recommendations for the authors):

This is an important study that provides insights into the differential effects of host factors on hantavirus infection of endothelial cells. The experiments are rigorously performed and the data directly support the author's conclusions. Appropriate controls are included and the authors are thoughtful in their conclusions.

My only suggestion to the authors would be to consider performing binding assays in the panel of cell lines to determine whether there are alterations at this stage of the viral life cycle by loss of candidate receptors/binding factors. As the authors correctly point out, some viruses utilize attachment factors (including DAF) in a cell-type specific manner and evidence of differential binding might resolve some of the seemingly discrepant data with previous studies.

Reviewer #2 (Recommendations for the authors):

Three suggestions for the authors:

1. The authors provide compelling genetic evidence that Integrins and DAF are not required for hantavirus infection of human endothelial cells. Testing if blocking antibodies to B3/B1 integrins and/or DAF alter infection dynamics, may also help clarify any potential role of these molecules to viral infection. This orthogonal assay would bolster the very high quality genetic evidence presented.

2. The authors cite, but do not explain, how Integrins and DAF came be presumed to be involved in hantavirus entry. Given that the assays utilized previously are likely to be quite different than the genetic approach taken by the authors, a brief mention is warranted. This may help put into context any role DAF/Integrin may have on hantavirus infections.

3. I was unable to find information on the complementation of the CRISPR knockout cell lines. Were these complemented using a lentivirus? Was the cDNA altered to prevent sgRNA recognition?

Essential revisions:

1) Both reviewers asked you to comment on whether these molecules may have a role in infection of polarized cells, which was the original observation in the literature. While you make a passing mention of this, it is an important point and would be consistent with other viruses (e.g., CVB).

We have added language to the “Results and Discussion” indicating as an additional caveat that some of the previously proposed receptors could play roles in polarized cell layers, as indeed has been proposed for DAF (Krautkramer and Zeier, 2008).

2) Please update the methods to include information on how complementation was performed.

We thank the reviewer for spotting this omission. The revised manuscript now includes this information in “Materials and methods.”

Additional experiments are suggested by the reviewers but will not be required in the revised submission.

We have also added additional text to “Introduction” to provide context on the experimental approaches used to identify previously proposed receptors, as requested by Reviewer #2.

Reviewer #1 (Recommendations for the authors):

This is an important study that provides insights into the differential effects of host factors on hantavirus infection of endothelial cells. The experiments are rigorously performed and the data directly support the author's conclusions. Appropriate controls are included and the authors are thoughtful in their conclusions.

My only suggestion to the authors would be to consider performing binding assays in the panel of cell lines to determine whether there are alterations at this stage of the viral life cycle by loss of candidate receptors/binding factors. As the authors correctly point out, some viruses utilize attachment factors (including DAF) in a cell-type specific manner and evidence of differential binding might resolve some of the seemingly discrepant data with previous studies.

We agree that these binding experiments could be informative but chose to focus on the loss-of-function genetic approach for this short report. We are planning to perform such studies to address potential roles for other receptors in specialized settings (such as polarized cells) but note that a failure to demonstrate a direct protein-protein interaction would not preclude the involvement of a candidate molecule as an entry factor.

Reviewer #2 (Recommendations for the authors):

Three suggestions for the authors:

1. The authors provide compelling genetic evidence that Integrins and DAF are not required for hantavirus infection of human endothelial cells. Testing if blocking antibodies to B3/B1 integrins and/or DAF alter infection dynamics, may also help clarify any potential role of these molecules to viral infection. This orthogonal assay would bolster the very high quality genetic evidence presented.

We chose not to perform such experiments herein so as to focus on a genetic approach that has not been previously explored for these receptor candidates. We agree that blocking experiments would be complementary and help cover more complex scenarios, but these are beyond the scope of this brief report.

2. The authors cite, but do not explain, how Integrins and DAF came be presumed to be involved in hantavirus entry. Given that the assays utilized previously are likely to be quite different than the genetic approach taken by the authors, a brief mention is warranted. This may help put into context any role DAF/Integrin may have on hantavirus infections.

We have also added additional text to “Introduction” to provide context on the experimental approaches used to identify previously proposed receptors.

3. I was unable to find information on the complementation of the CRISPR knockout cell lines. Were these complemented using a lentivirus? Was the cDNA altered to prevent sgRNA recognition?

We thank the reviewer for spotting this omission. The revised manuscript now includes this information in “Materials and methods.” We used codon-optimized versions of the cDNAs for retrovirus-based complementation, which resulted in changes in the sgRNA target sequences (see Author response table 1). Moreover, we were able to demonstrate biochemical complementation of KO under these conditions (see Figure 1C, “+cDNA” lanes).

Author response table 1.

	gRNA target site location	Modified sequence in pBabe- PCDH1/ ITGB3/ DAF
PCDH1	GTTTGAGCGGCCCTCCTATGAGG	aTTcGAGaGaCCtagtTATGAGG
ITGB3	CCACGCGAGGTGTGAGCTCCTGC	CtACtaGAGGcGTatcaagCTGt
DAF	CCCCCAGATGTACCTAATGCCCA	CCgCCtGAcGTcCCaAAcGCgCA

Appendix 1—key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Gene (Homo sapiens)	PCDH1	GenBank	Gene ID: 5097
Gene (Homo sapiens)	ITGB3	GenBank	Gene ID: 3690
Gene (Homo sapiens)	DAF	GenBank	Gene ID: 1604
Gene (Homo sapiens)	ITGB1	GenBank	Gene ID: 3688
Strain, strain background (virus)	rVSV eGFP ANDV Gn/Gc	Kleinfelter et al., 2015
Strain, strain background (virus)	rVSV eGFP SNV Gn/Gc	Kleinfelter et al., 2015
Strain, strain background (virus)	rVSV eGFP HTNV Gn/Gc	Kleinfelter et al., 2015
Strain, strain background (virus)	rVSV eGFP SEOV Gn/Gc	Jangra et al., 2018
Strain, strain background (virus)	rVSV eGFP DOBV Gn/Gc	Slough et al., 2019
Strain, strain background (virus)	rVSV eGFP MPRLV Gn/Gc	Jangra et al., 2018
Strain, strain background (virus)	rVSV eGFP PHV Gn/Gc	Jangra et al., 2018
Strain, strain background (virus)	rVSV mNeongreen-P PUUV-Gn/Gc	Kerkman et al., 2019, This study		Laboratory of K. Chandran
Strain, strain background (virus)	rVSV mNeongreen-P CHOV Gn/Gc	This study	GenBank # KT983772.1	Laboratory of K. Chandran/VSV antigenome plasmid (Whelan et al., 1995), plasmids expressing T7 polymerase and VSV N, P, M, G, and L (Witko et al., 2006)
Strain, strain background (virus)	rVSV-EBOV/Mayinga GP (EBOV/H.sap-tc/COD/76/ Yambuku-Mayinga)	Wong et al., 2010
Strain, strain background (Hantavirus)	ANDV isolate Chile-9717869	N/A
Strain, strain background (Hantavirus)	HTNV isolate 76–118	N/A
Strain, strain background (Hantavirus)	PUUV isolate Sotkamo	N/A
Strain, strain background (Hantavirus)	SNV isolate SN77734	Botten et al., 2000
Strain, strain background (Hantavirus)	PHV	N/A		Laboratory of K. Chandran
Cell line (H. sapiens)	293T	ATCC	Cat. # CRL-3216
Cell line (H. sapiens)	HUVEC	Lonza	Cat. # C2517A	Primary cell
Cell line (H. sapiens)	TIME (endothelial cell line)	ATCC	Cat. # CRL-4025
Cell line (C. aethiops)	Vero	CCL-81	Cat. # CCL-81
Genetic reagent (H. sapiens)	TIME PCDH1 KO (endothelial cell line)	This study		Laboratory of K. Chandran/Lentiviral transduction/lentiCRISPR v2-sgRNA PCDH1
Genetic reagent (H. sapiens)	TIME ITGB3 KO (endothelial cell line)	This study		Laboratory of K. Chandran/Lentiviral transduction/lentiCRISPR v2-sgRNA ITGB3
Genetic reagent (H. sapiens)	TIME ITGB1 KO (endothelial cell line)	This study		Laboratory of K. Chandran/Lentiviral transduction/lentiCRISPR v2-sgRNA ITGB3
Genetic reagent (H. sapiens)	TIME DAF KO (endothelial cell line)	This study		Laboratory of K. Chandran/Lentiviral transduction/lentiCRISPR v2-sgRNA DAF
Genetic reagent (H. sapiens)	TIME PCDH1/ITGB3 KO (endothelial cell line)	This study		Laboratory of K. Chandran/TIME PCDH1 KO + Lentiviral transduction/lentiCRISPR v2-sgRNA ITGB3
Genetic reagent (H. sapiens)	TIME PCDH1/DAF KO (endothelial cell line)	This study		Laboratory of K. Chandran / TIME PCDH1 KO + Lentiviral transduction/ lentiCRISPR v2-sgRNA DAF
Genetic reagent (H. sapiens)	TIME ITGB3/DAF KO (endothelial cell line)	This study		Laboratory of K. Chandran / TIME ITGB3 KO + Lentiviral transduction/ lentiCRISPR v2-sgRNA DAF
Genetic reagent (H. sapiens)	TIME PCDH1 KO + PCDH1 (endothelial cell line)	This study	Canonical isoform Q08174-1 (Uniprot)	Laboratory of K. Chandran / Retroviral transduction/ pBabe-PCDH1
Genetic reagent (H. sapiens)	TIME ITGB3 KO + ITGB3 (endothelial cell line)	This study	Canonical isoform P05106-1 (Uniprot)	Laboratory of K. Chandran / Retroviral transduction/ pBabe-ITGB3
Genetic reagent (H. sapiens)	TIME DAF KO + DAF (endothelial cell line)	This study	Canonical isoform P08174-1 (Uniprot)	Laboratory of K. Chandran / Retroviral transduction/ pBabe-DAF
Antibody	AF480-α-Human-vWF (Rabbit monoclonal)	Abcam	Cat. # ab195028	Flow 1:250
Antibody	PeCy7-α-Human-PECAM (Mouse monoclonal)	BD	Cat. # 563651	Flow 1:1000
Antibody	AF 647-α-Human- β3-Integrin (Mouse monoclonal)	Biolegends	Cat. # 336407	Flow 1:200
Antibody	PE-α-Human-DAF (Mouse monoclonal)	BD	Cat. # 555694	Flow 1:1600
Antibody	APC-α-Human-β1-Integrin (Mouse monoclonal)	BD	Cat. # 59883	Flow 1:20
Antibody	α–Human-PCDH1 mAb 3305 (human monoclonal)	Jangra et al., 2018		Flow 1:200
Antibody	Convalescent serum (human polyclonal)	Stoltz et al., 2007		IF: 1:40
Antibody	AF488-α–-Human IgG (Goat polyclonal)	Invitrogen	Cat. # A-11013	Flow 1:200
Antibody	AF594-α–Human IgG (Goat polyclonal)	Invitrogen	Cat. # A-11014	IF 1:500
Antibody	AF594-α-Mouse IgG (Goat polyclonal)	Invitrogen	Cat. # A32742	IF 1:500
Antibody	AF488-α-Rabbit IgG (Goat polyclonal)	Invitrogen	Cat. # A-11008	IF 1:500
Antibody	α–Human PCDH1 (Mouse monoclonal)	Santa Cruz	Cat. # sc-81816	WB 1:200
Antibody	α–Human β3 Integrin (Rabbit polyclonal)	Cell Signaling	Cat. # 4702	WB 1:300
Antibody	α–Human-DAF (Mouse monoclonal)	Santa Cruz	Cat. # NaM16-4D3	WB 1:200
Antibody	α–Human β Actin (Mouse monoclonal)	Santa Cruz	Cat. # sc-47778	WB 1:300
Antibody	IRDye 680LT α-Mouse (Goat polyclonal)	LI-COR	Cat. # 926–68020	WB 1:10,000
Antibody	IRDye 680LT Goat α-Rabbit IgG 680 (Goat polyclonal)	LI-COR	Cat. # 926–68021	WB 1:10,000
Antibody	α-hantavirus nucleocapsid B5D9 (Mouse monoclonal)	Progen	Cat. # B5D9-C	IF 1:50
Antibody	α-HTNV nucleoprotein NR-12152 (Rabbit polyclonal)	BEI resources	Cat. # NR-12152	IF 1:500
Recombinant DNA reagent	pBabe-puro (plasmid)	Morgenstern and Land, 1990	Addgene plasmid # 1764
Recombinant DNA reagent	pBabe-PCDH1 (plasmid)	Jangra et al., 2018
Recombinant DNA reagent	pBabe-ITGB3 (plasmid)	This study		Laboratory of K. Chandran
Recombinant DNA reagent	pBabe-DAF (plasmid)	This study		Laboratory of K. Chandran
Recombinant DNA reagent	lentiCRISPR v2 (plasmid)	Sanjana et al., 2014; Shalem et al., 2014
Recombinant DNA reagent	lentiCRISPR v2-sgRNA PCDH1 (plasmid)	Jangra et al., 2018		Laboratory of K. Chandran/5′-GTTTGAGCGGCCCTCCTATGAGG-3′ /PAM sequence is underlined but not included in oligos
Recombinant DNA reagent	lentiCRISPR v2-sgRNA DAF (plasmid)	This study		Laboratory of K. Chandran / 5′-CCCCCAGATGTACCTAATGCCCA-3′ / PAM sequence is underlined but not included in oligos
Recombinant DNA reagent	lentiCRISPR v2-sgRNA ITGB3 (plasmid)	This study		Laboratory of K. Chandran / 5′-CCACGCGAGGTGTGAGCTCCTGC-3′ /PAM sequence is underlined but not included in oligos
Recombinant DNA reagent	lentiCRISPR v2-sgRNA ITGB1 (plasmid)	This study		Laboratory of K. Chandran/5′-AATGTAACCAACCGTAGCAAAGG-3′ /PAM sequence is underlined but not included in oligos
Sequence-based reagent	SNV degenerate primers	This study		Laboratory of S. Bradfute/SNV F: CAgCTgTgTCTgCATTggAgAC SNV R: TARAgYCCgATggATTTCCAATCA
Sequence-based reagent	SNV probe	This study		Laboratory of S. Bradfute/ TMGB1: F-TCAAAACCTgTTgATCCA NFQ MGB
Commercial assay or kit	pGEM-T Vector	Promega	Cat. # A3600
Commercial assay or kit	VIC/TAMRA-dye probe	Applied Biosystems	Cat. # 4310881E
Commercial assay or kit	TaqMan Fast Advanced Master Mix	Applied Biosystems	Cat. # 4444556
Commercial assay or kit	Foxp3/Transcription Factor Staining	Tonbo	Cat. # TNB-0607-KIT
Commercial assay or kit	Zombie NIR Fixable Viability Kit	BioLegend	Cat. # 423105	Flow 1:4000
Software, algorithm	Cytation 5 Cell Imaging Multi-Mode Reader	Biotek