| Literature DB >> 34220510 |
Weilin Zheng1, Jie Wang1, Jiayi Wu1, Tao Wang1, Yangxue Huang1, Xuefang Liang1,2, Lixing Cao1,2.
Abstract
Endometriosis is a common gynecological disease and causes severe chronic pelvic pain and infertility. Growing evidence showed that traditional Chinese medicine (TCM) plays an active role in the treatment of endometriosis. ELeng Capsule (ELC) is a Chinese medicine formula used for the treatment of endometriosis for several years. However, the mechanisms of ELC have not been fully characterized. In this study, network pharmacology and mRNA transcriptome analysis were used to study various therapeutic targets in ELC. As a result, 40 compounds are identified, and 75 targets overlapped with endometriosis-related proteins. The mechanism of ELC for the treatment of endometriosis is based on the function modules of inducing apoptosis, inhibiting angiogenesis, and regulating immunity mainly through signaling molecules and interaction (neuroactive ligand-receptor interaction), immune system-associated pathways (toll-like receptor signaling pathway), vascular endothelial growth factor (VEGF) signaling, and MAPK signaling pathway based on network pharmacology. In addition, based on RNA-sequence analysis, we found that the mechanism of ELC was predominantly associated with the regulation of the function modules of actin and cytoskeleton, epithelial-mesenchymal transition (EMT), focal adhesion, and immunity-associated pathways. In conclusion, ELC exerted beneficial effects on endometriosis, and the potential mechanism could be realized through functional modules, such as inducing apoptosis and regulating angiogenesis, cytoskeleton, and EMT. This work not only provides insights into the therapeutic mechanism of TCM for treating endometriosis but also offers an efficient way for drug discovery and development from herbal medicine.Entities:
Keywords: ELeng Capsule; endometriosis; mRNA transcriptome analysis; network pharmacology; traditional Chinese medicine
Year: 2021 PMID: 34220510 PMCID: PMC8249582 DOI: 10.3389/fphar.2021.674874
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.810
FIGURE 1Workflow of network pharmacology combined with the RNA-sequence approach. (A) Endometriosis model rats were established and used to verify the core targets. (B) The compounds of ELCs were identified by ultra-performance liquid chromatography/quadrupole time-of-flight mass spectrometry (UPLC-Q-TOF/MS). (C) Network pharmacology was used to analyze the compounds-targets network of ELC. (D) RNA-sequencing was used to identify differentially expressed genes (DEGs). Biological functions and pathways were determined through gene ontology and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses. Gene set enrichment analysis (GSEA) and STEM analysis were used to further analyze the genetic network and modular genetics.
The major herbs of ELeng Capsule.
| Herb | Component | Effect |
|---|---|---|
|
| Ginger plant, Wen Yujin Curcuma Wenyujin Y.H. Chen et C. Ling, rhizome | Treatment of mass in the abdomen, amenorrhea due to blood stasis, distension, and pain due to stagnation of undigested food |
|
| Black-triangular plant, | To break blood, move qi, relieve pain, and disperse accumulation |
|
|
| To quicken blood and dispel stasis, regulate menstruation and relieve pain, nourish blood and calm spirit, cool blood and disperse swelling abscess |
|
| Mink animal otter, | To clear heat and resolve toxin, disperse swelling and relieve pain |
|
| Cyprinidae, | Nourish the Yin and suppress Yang, dispel stasis and dissipate knots, soften hardness |
|
| Ranunculaceae, peony, | Treatment of maculation in epidemic diseases, spitting of blood, epistaxis, inflammation of the eye, pain in the chest and lateral thorax, amenorrhea, dysmenorrhea, mass formation in the abdomen, traumatic injuries |
|
|
| Clear heat and activate blood, promoting circulation of qi and blood |
|
|
| To nourish blood and regulate menstruation, quicken blood, relieve pain, moisten intestines, and relieve constipation |
Primer sequences used for real-time PCRs.
| No. | Gene symbol | Forward primer | Reverse primer |
|---|---|---|---|
| 1 | Myog | CGACCTGATGGAGCTGTA | GGTGGACAGGAAGGTAGT |
| 2 | Smyd1 | ACCGTCTATTTAACAAGGAAGC | GCACCGTGGCATTTACTA |
| 3 | Six1 | ATTAGTGAGGGAAACAAGTGC | GTTTGTTGCGTTACTAACATCG |
| 4 | Cacna1s | CACCTGGTTCACCAACTTTAT | CTGATTCCTCATGGAGTCG |
| 5 | Eef1a2 | CCAGCAAATACCCTCAACC | GTCTTCTCCTTGCCCATTC |
| 6 | Ryr1 | AGCCGTATGTACCTGAGT | GTGGCGTCTTCCTGTAATC |
| 7 | Actn2 | CCAGCGCCATGAATCAGATA | CTCCTCCTGGATCATGTACTC |
| 8 | Myod1 | GACAGCAGGTGTGCATTC | TAGTAGCTCCATGTCCCAGT |
| 9 | Mapk12 | CAGTGGACATTTGGTCTGTTG | TGGTCCAGGTGGTCATTG |
| 10 | Myh4 | CAAGGTGAAGAACGCCTA | TCCAGCTCGTGGATATGC |
| 11 | ACTB | GCGAGTACAACCTTCTTGC | TATCGTCATCCATGGCGAAC |
Mechanism of the compounds with potential therapeutic properties.
| Herb name | Compound name | Molecular formula | Potential targets based on network pharmacology | Major mechanism | References |
|---|---|---|---|---|---|
|
| Salvianolic acid A | C26H22O10 | AKT1,BCL2,CDKN3,EIF3L,F10,PRSS1,CASP3,COL7A1,F7,PTPN6,CCND1 | Anti-thrombosis; anti-fibrosis |
|
| Tanshinone IIA | C19H18O3 | ACHE,ADRA1A,ADRB1,ADRB2,CASP3,CHRM1,F2,OPRM1,CHRM2,DPP4,RXRA,PTGS2,CHRM5,CHRNA7,OPRD1,CHRM3,CHRM4,DRD1,NFKB3,CYP1A1,EDN1,BCL2,FOS,TP53,CYP1A2,CYP3A4,ITGB3,JUN,MMP9 | Reduce the expression of AGT, REN, ACE, ANGII, and AT2 in DRG neurons; reduce the VEGF/VEGFR2 pathway and CD146 | Qi | |
| Cryptotanshinone | C19H20O3 | ADRA1A,ADRA1B,ADRA1D,ADRB1,ADRB2,APP,BCL2L1,BIRC5,CHRM1,CHRM3,CHRM4,CHRNA7,PTGS1,DRD1,CHRM5,PTGS2,CA2,OPRD1,CHRM2,TOP2A,OPRM1,NCOA2,PGR,GABRA1,NFKB3,STAT1,CCND1,TNF,EDN1 | Anti-tumor, anti-inflammatory, neuroprotective, cardioprotective, visceral protective, anti-metabolic disorders; anti-tumor effects; STAT3-related pathways |
| |
| Rosmarinic acid | C18H16O8 | F2,ESR1,AR,PPARG,PTGS2,DPP4,PRSS1,NFKB3,IKBKB,CDKN3,EIF3L,MAPK1,CASP3,STAT1,CCL13,MGAM,IL2,NFATC3,CCND3,IL4R,IL5,CCL3,CD80,CD86,CCL11,CCR6,IDO1,SNCA,IGHG1,C3,C5 | Anti-cancer properties; inhibit the proliferation of primary HESCs and T-HESCs |
| |
| Salvianic acid A | C9H10O5 | ACHE,ACTB,ADRA1D,ADRA2A,ADRA2B,ADRA2C,ADRB1,ADRB2,COL1A1,COL3A1,F2,TGFB1,HMOX1,PLAU | |||
| Tanshinone I | C18H12O3 | F2,AR,PTGS2,RXRA,DPP4,HSP90AB1,PIK3CG,PRSS1,VEGFA,ICAM1,VCAM1 | |||
| Linolenic acid | C18H30O2 | PTGS1,PTGS2,NCOA2,O3FAR1,FADS2,FADS1,PPARA,PPARG,CD36,PLA2G6,PLA2G2A,PLA2G1B,PNPLA8 | |||
|
| Paeoniflorin | C23H28O11 | TNF,IL6,CD14,LBP,TLR4,HSF1,IL8 | Relieve pain; anti-inflammatory through inhibiting TLR4/MMP-9/2/IL-1β signaling pathway |
|
| Paeoniflorigenone | C17H18O6 | GABRA1 | Induce apoptosis; suppress proliferation |
| |
| γ-Elemene | C15H24 | CHRM2,PTGS1,PTGS2,RXRA,ADRA1A,RXRA,GABRA2,GABRA1,GABRA6,PTGS1,CHRM3 | Analgesic effects; anti-tumor |
| |
|
| Neoeriocitrin | C27H32O15 | TOP2A | Induce apoptosis; regulation of the MAPK and Akt signal transduction pathways |
|
| Narirutin | C27H32O14 | TOP2A | Cell signal transduction pathways in cancer |
| |
| Naringin | C27H32O14 | TOP2A,CDKN3,TNF,RASGRF1,RAF1,PPARA,DPP4,PPARG,AKT1,NQO1,MMP9,BMP2,CCK,GHSR,IL8 | Anti-tumor through cell signal transduction pathways in cancer (JAK–STAT pathway, PI3-kinase/Akt/mTOR signaling pathway, Notch pathway, NF-κB and cox-2 pathway, Wnt pathway, MAPK-ERK pathway, TGF-β signaling pathway); regulate angiogenesis |
| |
| Hesperetin | C16H14O6 | PTGS1,ADRB1,PTGS2,HSP90AB1,PIK3CG,PRKACA,NCOA2,CAMTA3,CYP71B35,TAG1,AT4G35090,CAT1,AT1G20620,RHC1A,CYP86A8,CYP86A2,CYP86A7 | Promote cisplatin-induced apoptosis in gastric cancer |
| |
| Limonin | C26H30O8 | CYP3A4 | Induce apoptosis |
| |
|
| Gallic acid | C7H6O5 | PTGS1,PTGS2,MAOB,PGR,PTPN6,TOP2A,HSP90AB1,PIK3CG,CASP9,CASP3,TP53,FASN,FASLG,MGST1,CYP3A43 | Analgesic effects | |
| Sparstolonin B | C15H8O5 | TLR2,TLR4 | A potential therapeutic agent for toll-like receptor–mediated inflammatory disorders |
| |
| Sanleng acid | C18H34O5 | Anti-tumor activity | |||
| β-Elemene | C15H24 | PTGS2,GABRA2,RXRANET,CHRM2,GABRA1,GABRA6,PTGS1,CHRM3,CHRM1,ADRA1A,CHRNA7,NCOA2,GABRA5,BCL2,CDKN3,EIF3L,RB1,TP53,TEP1,RUNX1T1,CRK2,CCNB1,RHOA | Analgesic effects; anti-tumor activity; induce apoptosis |
| |
|
| Curdione | C15H24O2 | CYP3A4 | Anti-tumor activity |
|
| Isoborneol | C10H18O | GABRA6,PGR,CYP2C8,GABRA2,CHRM2,GABRA1,CHRM3,CHRM1,PTGS2,GABRA5,NET,ADRA1A | Anti-inflammatory and analgesic effects |
| |
| Germacra | C15H24 | PTGS2,RXRA,NET,GABRA1,MAOB | Analgesic effects | ||
| Borneol | C10H18O | CYP2C8,GABRA2,GABRA5,CHRM2,GABRA1,IGHG1,GABRA6,PTGS1,PTGS2,NET | Anti-inflammatory and analgesic effects |
| |
| Zederone | C15H18O3 | NOS2,CHRM3,F2,CHRM1,ADRB2,GABRA1,CHRNA7 | Analgesic effects |
|
FIGURE 2Network pharmacology analysis of ELeng Capsule. (A) The major GO terms of BP of potential targets of ELC. (B) The 20 major KEGG pathways of potential targets of ELC. (C) “Herb–compound–target-signaling pathway” network of ELC. The light blue nodes represent targets (genes); the purple nodes represent compounds; the dark blue nodes represent herbs.
FIGURE 3Pathological microstructure and ultrastructure. (A) Graphs of ectopic endometrium lesions in endometriosis rat models. (B) Microstructure of the ectopic endometrium by HE staining (200× and 400×). (C) Ultrastructure of ectopic endometriotic lesions. The blue arrow indicates autophagosome. The orange arrow shows the structure of apoptosis bodies. (D) Detection of apoptosis was using the TUNEL assay (100x). Apoptosis in ectopic endometria of different groups was observed by the TUNEL assay. DAPI-stained nuclei appeared in blue. Green-stained tissue appeared in green due to the presence of apoptotic cells. The apoptotic index (%) of ectopic endometrial tissues was significantly higher in middle doze group (n = 4).
FIGURE 4MVD and expression of VEGF in ectopic endometrial tissues. (A) Compared with that in the control group eutopic endometrium, the MVD in the ectopic endometrium in the model group increased (n = 6, *p = 0.001 < 0.05). Compared with that in the model group, the MVD in the ectopic endometrium in the ELC middle-dose group decreased (**p = 0.018 < 0.05). (B) The results suggested that the expression of VEGFA was statistically significant (p = 0.014). *p = 0.031 < 0.05; **p = 0.004 < 0.05; ***p = 0.005 < 0.05. There was no significant difference in VEGFB expression among different groups (p > 0.05). Compared with that in the model group, the expression of VEGFC was reduced in ELC groups. *p = 0.005; **p = 0.002; ***p = 0.000. (C) The expression levels of VEGFA in serum were statistically significant (F = 2.742, p = 0.044 < 0.05). *p = 0.008; **p = 0.020; ***p = 0.012. There was no significant difference in the expression levels of VEGFB in serum among different groups (F = 0.674, p = 0.614 > 0.05). Values are represented as mean ± SD, n = 4. p < 0.05 as determined by one-way ANOVA.
FIGURE 5Result of fibrosis in ectopic lesions in endometriosis model rats. Values are represented as mean ± SD, n = 4. p < 0.05 as determined by one-way ANOVA. The Masson staining showed local fibrosis after modeling (×200). The percentage of fibrosis was positive by Masson staining of ectopic lesions in tissue sections. Compared with the model group, the ELC group has a lower degree of ELC fibrosis. Values are represented as mean ± SD (n = 4) (*p < 0.05). ELC could reduce the degree of fibrosis of the lesion. Model group: 45.86 ± 6.42%, ELC High_Ecto: 20.56 ± 11.41%, ELC Middle_Ecto: 13.06 ± 5.68%, and ELC Low_Ecto: 20.87 ± 9.93%. *p = 0.0068; **p = 0.0009; ***p = 0.0074 (p < 0.05). Compared with that in the control eutopic endometrium, the fibrosis area (Area%) of the model group and ELC group increased significantly (p = 0.0457 < 0.05). Compared with that in the model group, the fibrosis area ratio was reduced in the ELC middle-dose group and low-dose group. *p = 0.040; **p = 0.0346 (p < 0.05).
FIGURE 6RNA-sequencing reveals the characteristic of endometriosis rat models induced by autotransplantation. Transcriptome characteristics of endometriosis model rats were found through comparing the ectopic endometrium in model rats and the eutopic endometrium in control group rats. (A) Results of GO enrichment analysis for upregulated DEGs and downregulated DEGs reversed by ELC ectopic endometrium groups and model ectopic endometrium groups. (B) KEGG analysis of upregulated and downregulated genes. KEGG pathway analysis of upregulated and downregulated genes in the ectopic endometrium in rat models vs. control eutopic endometrium. The gene ratio refers to the ratio of the number of target genes associated with a KEGG pathway to the total number of genes in the pathway. (C) GSEA in endometriosis rat models showed enrichment of GO analysis and KEGG pathway. The normalized enrichment score (NES), p-value, and false discovery rate (FDR) are indicated for each gene set. GSEA revealed a significant enrichment of gene signatures associated with endometriosis (p < 0.05).
FIGURE 7RNA-sequencing reveals the transcriptome profile of gene expression changes in the treatment with ELC. The related genes and pathways regulated by ELC were found through comparing the DEGs between the Model_Ecto group and the ELC_Ecto group. (A) Results of gene ontology enrichment analysis for upregulated DEGs and downregulated DEGs reversed by ELC ectopic endometrium groups and model ectopic endometrium groups. (B) Results of KEGG enrichment analysis between ELC_Ecto groups and Model_Ecto groups. (C) The results of GSEA revealed a significant enrichment of gene signatures associated with ELC treatment (p < 0.05). (D) MCODE network of cluster analysis of the potential targets network in ELC treatment.
FIGURE 8STEM analysis of ELC treatment in endometriosis rats. (A) Trend chart of overall STEM analysis. (B) Four statistically significant trends. The results of gene cluster analysis were statistically significant in profiles 14, 11, 10, and 4 (p < 0.05). The profile_11 panel (Bii) and profile_4 panel (Biv) could be the regulatory genes of endometriosis model development (p < 0.05). The series test of the profile_14 panel (Bi) and profile_10 panel (Biii) showed that the significant clusters were considered potential profiles that could be affected by ELC treatment (p < 0.05). (i) p = 2.1E-135, (ii) P = 1E-31, (iii) p = 2.50E-21, and (iv) p = 0.000011.
FIGURE 9DEG effect of ELeng Capsules in the endometriosis model rats. (A) Network of major KEGG pathways and targets of Model_Ecto vs. ELC_Ecto downregulated DEGs. (B) Expression of genes in ectopic endometrium tissues in endometriosis rat models detected by qRT-PCR and shown by the expression fold changes. ACTB was used as the internal control. Data are shown as mean ± SD, *p < 0.05.
FIGURE 10Potential multiple target mechanisms of ELeng Capsule.