| Literature DB >> 34211396 |
Houfu Ling1,2, Qinghe Zeng1,2, Qinwen Ge1,2, Jiali Chen2, Wenhua Yuan2, Rui Xu1,2, Zhenyu Shi1,2, Hanting Xia1,2, Songfeng Hu3, Hongting Jin2, Pinger Wang2,4, Peijian Tong2,5.
Abstract
Osteoarthritis (OA) is a common disease characterized by cartilage degeneration. In recent years much attention has been paid to Traditional Chinese Medicine (TCM) since its treatments have shown efficacy for ameliorating cartilage degradation with mild side effects. Osteoking is a TCM prescription that has long been used in OA treatment. However, the exact mechanism of Osteoking are not fully elucidated. In the current study, destabilization of the medial meniscus (DMM)-induced OA mice was introduced as a wild type animal model. After 8 weeks of administration of Osteoking, histomorphometry, OARSI scoring, gait analysis, micro-CT, and immunohistochemical staining for Col2, MMP-13, TGFβRII and pSmad-2 were conducted to evaluate the chondroprotective effects of Osteoking in vivo. Further in vitro experiments were then performed to detect the effect of Osteoking on chondrocytes. TGFβRIICol2ER transgenic mice were constructed and introduced in the current study to validate whether Osteoking exerts its anti-OA effects via the TGF-β signaling pathway. Results demonstrated that in wild type DMM mice, Osteoking ameliorated OA-phenotype including cartilage degradation, subchondral bone sclerosis, and gait abnormality. Col2, TGFβRII, and pSmad-2 expressions were also found to be up-regulated after Osteoking treatment, while MMP-13 was down-regulated. In vitro, the mRNA expression of MMP-13 and ADAMTS5 decreased and the mRNA expression of Aggrecan, COL2, and TGFβRII were up-regulated after the treatment of Osteoking in IL-1β treated chondrocytes. The additional treatment of SB505124 counteracted the positive impact of Osteoking on primary chondrocytes. In TGFβRIICol2ER mice, spontaneous OA-liked phenotype was observed and treatment of Osteoking failed to reverse the OA spontaneous progression. In conclusion, Osteoking ameliorates OA progression by decelerating cartilage degradation and alleviating subchondral bone sclerosis partly via the TGF-β signaling pathway.Entities:
Keywords: TGF-β/Smad pathway; cartilage protection; conditonal knockout; osteoarthritis; osteoking
Year: 2021 PMID: 34211396 PMCID: PMC8239307 DOI: 10.3389/fphar.2021.678810
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.810
The composition of Osteoking.
| Chinese herb | Full taxonomy name | Latin name | Wight(g) | Parts used |
|---|---|---|---|---|
| Chen pi | Citrus reticulata blanco | Pericarpium citri reticulatae | 30 | Peel |
| Hong hua | Carthamus tinctorius L | Flos carthami | 30 | Flower |
| San qi | Panax notoginseng (burkill) F.H.Chen | Radix notoginseng | 30 | Root |
| Du zhong | Eucommia ulmoides oliv | Cortex eucommiae | 30 | Bark |
| Ren shen | Panax ginseng C.A.Mey | Radix ginseng | 20 | Root |
| Huang qi |
| Radix astragali | 40 | Root |
| Yang jin hua | Datura metel L | Flos daturae | 15 | Flower |
| Zuan di feng | Schizophragma integrifolium (Franch.)Oliv | Schizophragma integrifolium | 25 | Root; Stem |
| Bie jia | Carapax trionycis | Trionyx sinensis carapace | 10 | Carapace |
FIGURE 1The UPLC analysis result of Osteoking solution. All chromatographic peak signaling was recorded at 260 nm and the peak area was integrated under the instrument’s protocol. Peak 1–5 respectively indicated Astragaloside, Aucubin, Ginsenoside, Notoginsenoside, and Hesperidin.
Primer sequences for quantitative RT-PCR.
| Gens | Primer sequences | |
|---|---|---|
| β-actin | Forward | CACTATCGGCAATGCGGTTCC |
| Reverse | CAGCACTGTGTTGGCATAGAGGTC | |
| TGFβRII | Forward | CACCTCCATCTGTGAGAAGCC |
| Reverse | GGCAAACGGTCTCCAGAGTAA | |
| MMP-13 | Forward | AACCAAGATGTGGAGTGCCTGATG |
| Reverse | CACATCAGACCAGACCTTGAAGGC | |
| ADAMTS5 | Forward | TCCTCTTGGTGGCTGACTCTTCC |
| Reverse | TGGTTCTCGATGCTTGCATGACTG | |
| Aggrecan | Forward | GATCTCAGTGGGCAACCTTC |
| Reverse | TCCACAAACGTAATGCCAGA | |
| COL2 | Forward | CTCAAGTCGCTGAACAACCA |
| Reverse | GTCTCCGCTCTTCCACTCTG |
FIGURE 2Osteoking decelerated OA progression in a DMM-induced osteoarthritic model. (A) Alcian blue hematoxylin/orange G staining and Toluidine blue staining of the right knee joint in WT mice (surgical one). Red arrows indicated the area of cartilage erosion. Scale bar = 100 μm. Morphological quantitative analysis of (B) area of tibial cartilage (mm2) and (C) thickness of tibial cartilage (μm). (D) OARSI scoring of the sections analyzed by histomorphometry. Micro-CT was performed to analyze the changes in bone structure. (E) Representative 3D reconstruction of the right knee joint and subchondral bone. Quantitative analysis of the subchondral bone (F) BV/TV (%), (G) Tb.Th (mm) and (H) BMD (g/cm3). Data were presented as means ± SD (n = 10). The exact p value is presented in the corresponding graph.
FIGURE 3Osteoking up-regulated the expression of TGFβRII and pSmad2 in DMM-induced WT osteoarthritic mice. (A) immunohistochemical staining of Col2, MMP-13, and pSmad2 and TGFβRII in cartilage. Scale bar = 100 μm. (B–E) Quantification of the positive repression area of Col2 (mm2), Percentage of positive expression of pSmad2, TGFβRII, and MMP-13 (%). Gait analysis was performed by DigiGait imaging system. (F) Swing (s), (G) Stride length (cm), (H) Stance (s), (I) Paw area (cm2) of the right hind limb were chosen as the observation index. The Data are presented as means ± SD (n = 10). The exact p value is presented in the corresponding graph.
FIGURE 4The effect of Osteoking on IL-1β-induced primary rat chondrocytes in vitro. (A–B) Cell viability of primary rat chondrocytes cultured with various concentrations of Osteoking for 24 and 48 h (C–G) The gene expression of IL-1β-induced primary rat chondrocytes was treated with 15% Osteoking and TGF-β inhibitor (SB505124) for 24 h. The Data are presented as means ± SD (n = 3 in each group). The exact p value is presented in the corresponding graph.
FIGURE 5The cartilage protection effect of Osteoking was lost in TGFβRIICol2ER mice. (A) Alcian blue hematoxylin/orange G staining and Toluidine blue staining of the tight knee joint in TGFβRIICol2ER mice. Red arrows indicate the area of cartilage erosion. Scale bar = 100 μm. Morphological quantitative analysis of (B) area of tibial cartilage (mm2) and (C) thickness of tibial cartilage (μm). (D) OARSI scoring of the sections analyzed by histomorphometry. (E) Representative 3D reconstruction of the right knee joint and subchondral bone. Quantitative analysis of the subchondral bone of right knee joints (F) BV/TV (%), (G) Tb.Th (mm) and (H) BMD (g/cm3) were chosen as the observation indexes. Data are presented as means ± SD (n = 10). The exact p value is presented in the corresponding graph.
FIGURE 6The expression of MMP-13 was not down-regulated after the treatment of Osteoking in TGFβRIICol2ER mice. (A) Immunohistochemistry staining for Col2, pSmad2, TGFβRII, and MMP-13 in cartilage. Scale bar = 100 μm. (B–E) Quantification of the positive repression of these markers. Data are presented as means ± SD (n = 10). The exact p value is presented in the corresponding graph.