Literature DB >> 34203761

Effects of a Novel Thiadiazole Derivative with High Anticancer Activity on Cancer Cell Immunogenic Markers: Mismatch Repair System, PD-L1 Expression, and Tumor Mutation Burden.

Sofia Sagredou1, Panagiotis Dalezis1, Eirini Papadopoulou2, Maria Voura3, Maria V Deligiorgi1, Michail Nikolaou1,4, Mihalis I Panayiotidis5,6, George Nasioulas2, Vasiliki Sarli3, Dimitrios T Trafalis1.   

Abstract

Microsatellite instability (MSI), tumor mutation burden (TMB), and programmed cell death ligand-1 (PD-L1) are particularly known as immunotherapy predictive biomarkers. MSI and TMB are closely related to DNA mismatch repair (MMR) pathway functionality, while the PD-L1 checkpoint mediates cancer cell evasion from immune surveillance via the PD-L1/PD-1 axis. Among all the novel triazolo[3,4-b]thiadiazole derivatives, the compound KA39 emerged as the most potent anticancer agent. In the present study, potential alterations in MSI, TMB, and/or PD-L1 expression upon cell treatment with KA39 are explored. We tested three MMR-deficient (DLD-1, LS174T, and DU-145) and two MMR-proficient (HT-29 and PC-3) human cancer cell lines. Our findings support KA39-induced PD-L1 overexpression in all cancer cell lines, although the most outstanding increase was observed in MMR-proficient HT-29 cells. MSI analysis showed that KA39 affects the MMR system, impairing its recognition or repair activity, particularly in MMR-deficient DLD-1 and DU-145 cells, enhancing oligonucleotide production. There were no remarkable alterations in the TMB between untreated and treated cells, indicating that KA39 does not belong to mutagenic agents. Taking together the significant in vitro anticancer activity with PD-L1 upregulation and MSI increase, KA39 should be investigated further for its implication in chemo-immunotherapy of cancer.

Entities:  

Keywords:  MMR impairment; PD-L1 upregulation; cancer immunogenic markers; thiadiazole derivative; tumor mutation burden

Year:  2021        PMID: 34203761      PMCID: PMC8232699          DOI: 10.3390/pharmaceutics13060885

Source DB:  PubMed          Journal:  Pharmaceutics        ISSN: 1999-4923            Impact factor:   6.321


1. Introduction

Triazoles and thiadiazoles are heterocyclic compounds known for possessing a wide range of pharmacological properties, including anti-microbial, anti-inflammatory, anti-convulsant, antioxidant, radio-protective, anti-leishmanial, anti-viral, anti-hypertensive, anticancer, and anti-depressant activities [1,2,3]. A series of new chemical entities has been obtained by either modifying their heterocyclic rings at different positions or fusing their core structures together. The 1,2,4-triazolo[3,4-b][1,3,4]thiadiazoles and their derivatives, generated by the cyclization of 1,2,4-triazole and 1,3,4-thiadiazole on each other to form the fused system 1,2,4-triazolo[3,4-b][1,3,4]thiadiazoles derivatives, hold a broad spectrum of biological potentialities. Nonetheless, of particular interest remains the important anticancer/antitumor efficacy displayed by this class of heterocycles. The cytotoxic potency of 1,2,4-triazolo[3,4-b][1,3,4]thiadiazoles against several cancer cell lines has driven the synthesis of alternate compounds such as 3,6-disubstituted 1,2,4-triazolo[3,4-b][1,3,4]thiadiazoles [4]. Three newly synthesized triazolo[3,4-b]thiadiazole derivatives (TATDADs) induced efficient cell growth inhibitory activity against three human colorectal cancer cell lines [5]. Further, in vitro studies conducted on three human ovarian, two colorectal, and two prostate cancer cell lines have also demonstrated significant antiproliferative activity induced by these compounds [6]. Our studies support that topoisomerase IIα (topIIα) is a potential target of the tested TATDADs, which act as topIIα inhibitors on the phosphorylation at Ser-1106 that is closely associated with the decatenation activity of the enzyme. TATDADs induced the formation of supercoiled DNA by blocking topIIα’s either ATPase- or DNA-binding activity [5]. Of great interest is the inhibitory impact of these TATDADs on the phosphorylation of both AKT isoforms (AKT1 and AKT2), suggesting that TATDADs act as multitarget anticancer agents [6]. Even if the need for novel cytotoxic anticancer agents is constant, there are more revolutionary ways introduced to treat certain types of malignancies, such as cancer immunotherapy. Targeting immune checkpoints, including PD-L1/PD-1, induce more prolonged therapeutic responses than conventional chemotherapy, indicating that immunotherapy is a valuable tool in cancer cure [7]. Discriminating cancer patients with sensitivity to immune checkpoint blockade (ICB) therapies is necessary so as to ensure an antitumor response. Three biomarkers with promising predictivity have been established: programmed death-ligand 1 (PD-L1), microsatellite instability (MSI), and tumor mutational burden (TMB) [8,9]. The present study intends to explore potential alterations in PD-L1, MSI, and TMB predictive biomarkers upon cell treatment with KA39 (Figure 1; Table 1), a TATDAD with high anticancer activity. High MSI (MSI-H) has been observed in several cancers, including colorectal and prostate, with higher occurrence in colorectal cancer. In our study, three human colorectal and two prostate cancer cell lines were selected, of which some were mismatch repair deficient (dMMR)/MSI-H, while others were mismatch repair proficient (pMMR)/microsatellite stable (MSS) (Table 2). MSI assay was conducted in order to detect either qualitative or quantitative alterations in DNA fragments induced by KA39. Changes in PD-L1 expression were also evaluated in tumor cells treated with KA39, as well as the TMB, in order to investigate whether KA39 triggers an increase in the overall number of somatic mutations.
Figure 1

Chemical structure of the tested triazolo[3,4-b]thiadiazole derivatives (TATDAD), 2-((6-(2,5-dinitrophenyl)-[1,2,4]triazolo[3,4-b][1,3,4]thiadiazol-3-yl)methyl)-4,5-dimethoxy-N,N-dimethylbenzene sulfonamide (KA39).

Table 1

GI50, TGI, and IC50 values of KA39, defined according to MTT assay, in human prostate and colorectal cancer cell lines.

Cancer Cell LinesGI50 (μΜ)TGI (μΜ)IC50 (μΜ)
DLD-13 ± 0.525 ± 0.769 ± 0.76
HT-2911.5 ± 0.815.9 ± 0.5519.5 ± 0.9
LS174T12 ± 1.5216.5 ± 1.2521.5 ± 1.5
PC-35 ± 0.158.4 ± 0.112 ± 0.1
DU-1455.8 ± 0.28 ± 0.410.3 ± 1.8
Table 2

Description of histotypes and MMR protein expression of the five human cancer cell lines included in our study.

Cancer TypeHuman Cell Line DesignationMSI StatusMMR DeficiencyPTENReferences
Colorectal adenocarcinoma, Dukes’ type CDLD-1MSI-HMSH6 deficiencyWild type[10,11,12]
Colorectal adenocarcinomaHT-29MSS-Wild type[10,11,13]
Colorectal adenocarcinoma, Dukes’ type BLS174TMSI-HMLH1 deficiencyWild type[10,11,14,15]
Prostate carcinomaDU-145MSI-HPMS2 and MLH1 deficiencyWild type[14,16,17,18,19]
Prostate adenocarcinoma,grade IVPC-3MSS-PTEN deficiency(homologous deletion)[16,20,21]

2. Materials and Methods

2.1. Cell Lines and Culture Conditions

Our study was conducted in five well-established human cancer cell lines: three colorectal adenocarcinoma (DLD-1, HT-29, and LS174T) and two prostate (PC-3 and DU-145) (Table 1). All cancer cell lines were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA) and cultivated in different culture media according to supplier instructions. All growth media were supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin. All cancer cell lines were cultured as monolayers and maintained at 37 °C in a humidified 5% CO2 atmosphere.

2.2. Cell Treatment

Among several newly synthesized triazolo[3,4-b]thiadiazole derivatives that have been tested for anticancer activity, KA39 has been shown as the most potent, inducing significantly higher cytostatic and cytotoxic activity against all tested cancer cell lines. In addition to KA39, two triazolo[3,4-b]thiadiazoles derivatives with significant structural similarity (>95%), XK71 and XK57, were also tested. All molecules were synthesized according to procedures that we previously reported (Figure 1; Figure S21) [4,5].

2.3. In Vitro Antiproliferative Activity

The in vitro anticancer activity of KA39 against all cancer cell lines was evaluated using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide quantitative colorimetric MTT assay, as previously reported [4,5]. Briefly, cells were seeded into a 96-well plate at a density of 8 × 103 cells per well and maintained for 72 h. After 24 h of cell growth, cells were treated with KA39 in concentrations of 1–100 μM. Following 48 h of drug exposure, 50 μL of MTT (5 mg/mL) was added to each well and cells were incubated for 3 h. The absorbance of the converted dye was recorded at a wavelength of 540 nm on an ELISA reader (Versamax, Orleans, LA, USA). MTT assay provides the required absorption values for determining three dose–response parameters, GI50, TGI, and IC50, using the linear progression method. All the experiments were carried out in triplicate. GI50 and TGI are drug concentrations that signify the cytostatic effect of a tested compound and induce 50% and 100% of cell growth inhibition, respectively; IC50 is the drug concentration that implies the cytotoxic effect of a tested compound and leads to a 50% decrease in cell viability [22,23]. The three parameters were determined using the mean of cell survival in all nine absorbance measurements, including control 24 h (Ct24), control 72 h (Ct72), and the seven drug concentrations (Tt72). The percentage of growth inhibition was calculated as [(Tt72x) − (Ct24)/(Ct72) − (Ct24)] × 100 for concentrations for which Tt72x > Ct24 and [(Tt72x) − (Ct24)/Ct24] × 100 for concentrations for which Tt72x < Ct24. GI50 was calculated as [(Tt72x) − (Ct24)/(Ct72) − (Ct24)] × 100 = 50; TGI as [(Tt72x) − (Ct24)/(Ct72) − (Ct24)] × 100 = 0; and IC50 as [(Tt72x) − (Ct24)/Ct24] × 100 = 50.

2.4. Flow Cytometric Analysis of Surface PD-L1 Expression

The impact of KA39 on PD-L1 expression was studied in four cancer cell lines, two colorectal (DLD-1 and HT-29) and two prostate (PC-3 and DU-145). Cells were seeded in a 6-well plate at a density of 5 × 105 cells/well and maintained for 24 h at 37 °C in a humidified 5% CO2 atmosphere. After 24 h of cell growth, the culture medium was replaced with fresh medium; each cell line was treated with KA39 according to the defined values of the TGI concentration and IC50 (μΜ), while untreated cells served as controls (Figure 1; Table 1). Cells treated at the TGI concentration (μΜ) were allowed to grow for 72 h in contrast to IC50 (μΜ), in which cells were exposed for 48 and 72 h. Following drug treatment, cells were collected after being washed with ice-cold PBS (pH 7.4) (Sigma-Aldrich, St. Louis, MO, USA) and detached enzymatically with standard trypsinization. All centrifugations, performed at 1500 rpm for 5 min, included medium discard and washing steps with 2 mL of cold cell-staining buffer (BioLegend, San Diego, CA, USA). Subsequently, 25 × 104 of cells were resuspended in 100 μL of cell-staining buffer and then stained with 5 μL of anti-PD-L1 antibody (PE/Cy7 anti-human CD274, Biolegend, San Diego, CA, USA). Cells were incubated at room temperature in the dark for 15 min and then resuspended with 800 μL οf cell-staining buffer. The expression of PD-L1 was analyzed on a flow cytometer (CyFlow®, SL, Partec, GmbH, Germany) using Partec Flomax software version 2.3 (Münster, Germany). For each sample, flow cytometric analysis was carried out in triplicate. The absolute values of the KA39-induced alterations in PD-L1 expression were reduced to a percentage, and controls (untreated cells) were defined as 100% of PD-L1 expression.

2.5. DNA Extraction

DNA extraction was carried out in frozen cell pellets using the QIAamp DNA Mini Kit (Qiagen, Hilden, Germany). According to manufacturer’s instructions, 200 μL of ATL buffer and 21 μL of proteinase K were added and then cell samples were incubated at 56 °C for 1 h. Following further incubation at 90 °C for 15 min, 200 μL of AL buffer as well as 200 μL of 100% ethanol were added. After brief vortex mixing, the DNA extract was transferred into a QIAamp Mini spin column (in a 2 mL collection tube) and centrifuged at 1200 rpm for 1 min. Subsequently, the QIAmp Mini spin column was placed into a new 2 mL collection tube and 500 μL of AW1 buffer was added. Once samples were centrifuged at 8000 rpm for 1 min, the QIAmp Mini spin column was placed into a new 2 mL collection tube and 500 μL of AW2 buffer was added. Like before, samples were centrifuged at 8000 rpm for 1 min. Afterward, the QIAamp Mini spin column was placed into a new 2 mL collection tube and centrifugation was carried out at full speed (14,000 rpm) for 3 min. The purified DNA was eluted by adding the appropriate volume of AE buffer (30–50 μL), and samples were finally centrifuged at 14,000 rpm for 1 min. The DNA concentration (ng/μL) of all samples was determined spectrophotometrically (NanoDrop2000, Thermo Fisher Scientific, Waltham, MA, USA).

2.6. MSI Fragment Analysis

Alterations in the MSI status were studied in three colorectal (DLD-1, HT-29, and LS174T) and two prostate (PC-3 and DU-145) human cancer cell lines upon treatment with KA39. Briefly, cells were seeded in a 6-well plate at a density of 3 × 105 cells/well and cultured for 24 h at 37 °C in a humidified 5% CO2 atmosphere. After 24 h of cell growth, the culture medium was replaced by fresh medium and cells were subsequently treated with KA39 at the TGI concentration and IC50 (μΜ) for 48 h (Figure 1; Table 1). Following 48 h of drug exposure, the culture medium was discarded and cells were collected after being washed twice with ice-cold PBS (pH 7.4) (Sigma-Aldrich, St. Louis, MO, USA) and detached enzymatically with standard trypsinization. Afterward, cells were centrifuged twice at 2000 rpm for 5 min, while one further centrifugation was carried out in a microcentrifuge at 3000 rpm for 15 min. DNA was extracted and then subjected to multiplex PCR with fluorescently labeled primers obtained from Thermo Fisher Scientific (Waltham, MA, USA) [24] (Table 3). PCR was carried out using the commercial QIAGEN Multiplex PCR Kit (Qiagen, Hilden, Germany). Furthermore, MSI analysis was performed according to the NCI panel (Bethesda panel), which consists of two mononucleotide (BAT25 and BAT26) and three dinucleotide (D5S346, D17S250, and D2S123) repeats [25]. Following the manufacturer’s recommendations, each 20 μL of the PCR multiplex reaction mix was composed of the following: 12.5 μL of 2× Qiagen multiplex PCR master mix (HotStarTaq DNA Polymerase (5 units/µL), 6 mM MgCl2, pH (8.7), and dNTP mix (dATP, dCTP, dGTP, dTTP)), 2.5 μL of 10× MSI primer mix, template DNA whose volume was variable depending on the concentration of DNA isolated (ng/μL), and RNase-free water, which was added to reach a total volume of 20 μL. In the negative control, DNA was replaced by water. The PCR amplification program started with an activation step of HotStarTaq DNA Polymerase at 95 °C for 15 min, followed by 40 cycles of 30 s at 95 °C (denaturation), 90 s at 51 °C (annealing), and 60 s at 72 °C (extension), and a final extension step of 30 min at 60 °C (Veriti™ 96-Well Thermal Cycler; Thermo Fisher Scientific, Waltham, MA, USA). To ascertain whether the amplification of the expected amplicons was successful, PCR products were analyzed by capillary electrophoresis. More specifically, the PCR products, stained with ethidium bromide, were loaded on 2% agarose gel in 1× TAE buffer, run at 97 V for 45 min (electrophoresis system; Bio-Rad Laboratories, Hercules, CA, USA) and finally visualized using the MiniBis Pro (DNR Bio-Imaging Systems Ltd., Jerusalem, Israel). For fragment analysis, the PCR products were denatured by adding 14.5 μL of a mixture composed of GeneScan™ 500 LIZ™ Size Standard (Thermo Fisher Scientific, Waltham, MA, USA) and Hi-Di™ Formamide (Thermo Fisher Scientific, Waltham, MA, USA) to 1 μL of each diluted PCR product. To achieve DNA denaturation, samples were incubated at 95 °C for 3 min (Veriti™ 96-Well Thermal Cycler; Thermo Fisher Scientific, Waltham, MA, USA) and subsequently cooled down in the freezer for 3 min. DNA fragments were analyzed on the GeneScan 500 LIZ Genetic Analyzer (Thermo Fisher Scientific, Waltham, MA, USA), and data analysis was conducted using GeneMapper 4.0 software version 4.0 (Applied Biosystems, Foster City, CA, USA). MSI analysis was conducted by quantifying all DNA fragments per nanogram of DNA input in PCR.
Table 3

Primers and characteristics of microsatellite loci.

Repeat TypeChromosomal LocationRepeat MotifPrimer Sequence (5′→3′)Size (bp)
Mononucleotide
BAT254q12TTTT.T.TTTT.(T)7.A(T)25TCGCCTCCAAGAATGTAAGT~90
TCTGCATTTTAACTATGGCTC
BAT262p(T)5…..(A)26TGACTACTTTTGACTTCAGCC~80–100
AACCATTCAACATTTTTAACCC
Dinucleotide (non-complex)
D5S346 (APC)5q21/22(CA)26ACTCACTCTAGTGATAAATCG96–122
AGCAGATAAGACAGTATTACTAGTT
Dinucleotide (complex)
D17S250 (Mfd15CA)17q11.2-q12(TA)7………………(CA)24GGAAGAATCAAATAGACAAT~150
GCTGGCCATATATATATTTAAACC
D2S123 (AFM093xh3)2p16(CA)13TA(CA)15(T/GA)7AAACAGGATGCCTGCCTTTA197–227
GGACTTTCCACCTATGGGAC

2.7. Tumor Mutation Burden Assay

The TMB was determined in three colorectal cancer cell lines (DLD-1, HT-29, and LS174T) treated with KA39 at IC50 (μΜ) for 48 h (Figure 1; Table 1). The TMB was assessed by the Oncomine™ Tumor Mutation Load Assay (Thermo Fisher Scientific, Waltham, MA, USA), a targeted next-generation sequencing (NGS) assay that covers 1.65 Mb of genomic space, of which 1.2 Mb is exonic region and 0.45 Mb intronic. It analyzes 409 genes, providing accurate quantitation of somatic mutations used for TMB calculation in FFPE tissues (Table 4). From all samples, 19.2 ng of the DNA extracted was used as input for NGS library preparation (according to the manufacturer’s instructions, a minimum of 20 ng is required). Briefly, target regions were amplified using the 5× Ion AmpliSeq™ HiFi Mix (Thermo Fisher Scientific, Waltham, MA, USA) and Oncomine™ Tumor Mutation Load Assay (2×) manual library preparation primer pools 1 and 2 (Thermo Fisher Scientific, Waltham, MA, USA). Once target amplification reactions were completed, amplicons were digested with FUPA reagent and subsequently barcoded with the IonCode™ Barcode Adapters 1–384 Kit (Thermo Fischer Scientific, Waltham, MA, USA). The NGS libraries obtained were purified using Agencourt™ AMPure™ XP Reagent (Beckman Coulter, Life Sciences, Indianapolis, IN, USA) and quantified by qPCR using the Ion Library TaqMan® Quantitation Kit (Thermo Fisher Scientific, Waltham, MA, USA). Libraries were diluted to 50 pM before loading. Afterward, the libraries were combined by loading pools of 6 libraries on one Ion 550™ chip and sequenced on the Ion Gene Studio S5 Prime System (Thermo Fisher Scientific, Waltham, MA, USA). NGS data analysis was performed using Ion Reporter™ 5.10.1.0 software directly from within Torrent Suite™ 5.10.1 software (Thermo Fisher Scientific, Waltham, MA, USA), followed by manual inspection, along with the commercial analysis software Sequence Pilot version 4.3.0 (JSI medical systems, Ettenheim, Germany). The Ion Reporter pipeline, according to which the TMB was calculated, uses custom variant calling and germline variant filtering to accurately determine the number of exonic somatic mutations per megabase (Oncomine Tumor Mutation Load—w2.0—DNA—Single Sample).
Table 4

List of all genes contained in the Oncomine Tumor Mutation Load assay.

ABL2CD79AEPHB1GRM8LIFRMYH9PMS1SOX2WASGNASATRXTSC2
ACVR2ACD79BEPHB4GUCY1A2LPHN3NCOA1POT1SSX1WHSC1HFN1ABAP1WT1
ADAMTS20CDC73EPHB6HCAR1LPPNCOA2POU5F1STK36WRNHRASCDK12
AFF1CDH1ERCC1HIF1ALRP1BNCOA4PPARGSUFUXPAIDH1CDKN2A
AFF3CDH11ERCC3HLFLTFNFKB1PPP2R1ASYKXPCIDH2CDKN2B
AKAP9CDH2ERCC4HOOK3LTKNFKB2PRDM1SYNE1XPO1JAK2CEBPA
APCCDH20ERCC5HSP90AA1MAFNINPRKAR1ATAF1XRCC2KORCHEK1
ARID2CDH5ERGHSP90AB1MAFBNKX2-1PRKDCTAF1LZNF384KITCHEK2
ARNTCDK8ETS1ICKMAGEA1NLRP1PSIP1TAL1ZNF521KRASCREBBP
ATF1CDKN2CETV1IGF1RMAGl1NOTCH4PTGS2TBX22ABL1MAP2K1DNMT3A
AURKACICETV4IGF2MALT1NSD1PTPRDTCF12AKT1MAP2K2FANCA
AURKBCKS1BEXT1IGF2RMAML2NUMA1PTPRTTCF3AKT2MAP2K4FANCD2
AURKCCMPK1EXT2IKBKBMAP3K7NUP214RALGDSTCF7L1AKT3MAPK1FBXW7
BAI3 COLCOL1A1FAM123BIKBKEMAPK8NUP98RARATCF7L2ALKMETMLH1
BCL10CRBNFANCCIKZF1MARK1PAK3RECQL4TCL1AARMPLMSH2
BCL11ACREB1FANCFIL2MARK4PARP1RELTET1AXLMTORMSH6
BCL11BCRKLFANCGIL21RMBD1PAX3RHOHTFE3BRAFMYCNBN
BCL2CRTC1FANCJIL6STMCL1PAX5RNASELTGFBR2CBLMYCNNF1
BCL2L1CSMD3FASIL7RMDM2PAX7RNF2TGM7CCND1NFE2L2NF2
BCL2L2CTNNA1FHING4MDM4PAX8RNF213THBS1CDK4NRASNOTCH1
BCL3CTNNB1FLCNIRF4MEN1PBRM1RPS6KA2TIMP3CDK6NTRK1NOTCH2
BCL6CYLDFLl1IRS2MITFPBX1RRM1TLR4CSF1RNTRK3NPM1
BCL9CYP2C19FLT1ITGA10MLLPDE4DIPRUNX1T1TLX1DDR2PDGFRAPALB2
BCRCYP2D6FLT4ITGA9MLL2PDGFBSAMD9TNFAIP3EGFRPDGFRBPIK3R1
BIRC2DAXXFN1ITGB2MLL3PER1SBDSTNFRSF14ERBB2PIK3CAPMS2
BIRC3DCCFOXL2ITGB3MLLT10PGAP3SDHATNK2ERBB3PIK3CBPTCH1
BIRC5DDB2FOXO1JAK1MMP2PHOX2BSDHBTOP1ERBB4PTPN11PTEN
BLMDDIT3FOXO3JAK3MN1PIK3C2BSDHCTPRERCC2RAF1RADSO
BLNKDEKFOXP1JUNMRE11APIK3CDSOHDTRIM24ESR1RETRB1
BMPR1ADICER1FOXP4KAT6AMTRPIK3CGSEPT9TRIM33EZH2ROS1RUNX1
BRD3DPYDFZR1KAT6BMTRRPIK3R2SGK1TRIP11FGFR1SF3B1SETD2
BTKDSTG6PDKDM5CMUC1PIM1SH2D1ATRRAPFGFR2SMOSMARCA4
BUB1BEML4GATA1KDM6AMUTYHPKHD1SMAD2TSHRFGFR3SRCSMARCB1
CARD11EP300GATA2KEAP1MYBPLAG1SMAD4UBR5FGFR4ARID1ASTK11
CASC5EP400GATA3KLF6MYCL1PLCG1SMUG1UGT1A1FLT3ASXL1TET2
CCND2EPHA3GDNFLAMP1MYD88PLEKHG5SOCS1USP9XGNA11ATMTP53
CCNE1EPHA7GPR124LCKMYH11PMLSOX11VHLGNAQATRTSC1

2.8. Statistical Analysis

Student’s t-test was used to compare the level of significance between the experimental groups. Differences with a p-value less than 0.05 were considered statistically significant. Microsoft Excel version 2010 (Microsoft Hellas, Athens, Greece) was used.

3. Results

MSI, PD-L1 Expression, and TMB Analysis in Human Colorectal and Prostate Cancer Cells upon Treatment with KA39

KA39 induced the most significant cytostatic and cytotoxic effects on the five tested human cancer cell lines (Table 1). However, XK71 and XK57 displayed low in vitro anticancer activity in the tested cancer cell lines, and no significant alterations in MSI and PD-L1 expression were impelled (p > 0.01) The alignment of cancer cell sensitivity to KA39 was DLD-1 > PC-3 > DU-145 > HT-29 > LS174T, with DLD-1 cells being more and LS174T less sensitive (p < 0.01). All results concerning the in vitro anticancer activity and changes in MSI and PD-L1 expression induced by XK71 and XK57 are provided as Supplementary Materials (Table S21–S23; Figures S22 and S23). On DLD-1 cells, PD-L1 expression levels significantly increased by 55.8% upon treatment with KA39 at a concentration of 9 μΜ (IC50) for 48 h (p < 0.05) (Figure 2A; Figures S1–S5; Tables S1–S5; Table 5). MSI analysis indicated that treatment with KA39, at both the TGI concentration (5 μΜ) and IC50 (9 μΜ) for 48 h, trigger a considerable increase in DNA fragments in the five major microsatellite markers, BAT-26, BAT-25, D5S346, D17S250, and D2S123 (p < 0.01) (Figure 3A). The increase in oligonucleotides was recorded as 3-fold higher in BAT-26, 4- to 5-fold higher in BAT-25, 2.5-fold higher in D5S346, and 3-fold higher in D17S250 and D2S123 microsatellites as compared to controls. Oligonucleotides also increased in the four additional regions by 4-fold in 0–50 bp (TGI and IC50; p < 0.01), from 3- to 5-fold in 50–75 bp (TGI and IC50; p < 0.05 and p < 0.01, respectively), 2-fold in 245–300 bp (IC50; p < 0.05), and 5-fold in 338–400 bp (TGI; p < 0.01) (Figure 4A). Regarding the TMB, no considerable alterations were demonstrated in the number of non-synonymous mutations when DLD-1 cells were treated with KA39 at IC50 (μM) for 48 h. However, a significant increase from 31.18 Muts/Mb in untreated to 80.93 Muts/Mb in treated cells was induced at the synonymous mutation number in DLD-1 cells (Table 6).
Figure 2

Percentage alterations in PD-L1 expression levels (mean ± SEM) induced by the KA39 triazolo[3,4-b]thiadiazole derivative. All four cancer cell lines were treated at IC50 (µM) for 48 and 72 h, as well as at the TGI concentration (μM) for 72 h. (A–D) illustrate the PD-L1 expression levels in DLD-1, HT-29, DU-145, and PC-3 cancer cells, respectively. The dotted line represents the control values defined as 100% of PD-L1 expression in each cancer cell line. Statistical significance level: * p < 0.05 and ** p < 0.01.

Table 5

The absolute values of PD-L1 expression as defined by flow cytometric analysis in untreated (control) and treated cells with the KA39 derivative at IC50 (μΜ) for 48 and 72 h, as well as at the TGI concentration (μΜ) for 72 h. The units of measurements are expressed as the mean of immunofluorescence intensities counted per cell.

Cancer Cell LinesPD-L1 Expression
Control 48 hKA39 IC50 48 hKA39 IC50 72 hControl 72 hKA39 TGI 72 h
DLD-112.92 ± 0.6420.14 ± 1.012.3 ± 0.6123.19 ± 1.3922.27 ± 1.11
HT-2919.56 ± 1.3620.13 ± 1.6180.82 ± 4.0419.4 ± 1.3578.56 ± 5.49
DU-14527.99 ± 1.6724.48 ± 2.233.55 ± 2.3423.46 ± 1.1723.02 ± 1.61
PC-325.91 ± 1.8127.66 ± 2.732.98 ± 3.223.93 ± 1.9128.21 ± 2.53
Figure 3

MSI alterations (mean ± SEM) induced by the KA39 triazolo[3,4-b]thiadiazole derivative (per ng DNA) in five human cancer cell lines. (A–E) demonstrate the MSI alterations in DLD-1, HT-29, DU-145, PC-3, and LS174T cancer cells, treated with KA39 at the TGI concentration and IC50 (μΜ) for 48 h, respectively. Quantitative MSI fragment analysis conducted in the Bethesda panel (BAT-26, BAT-25, D5S346, D17S250, and D2S123). Statistical significance level: * p < 0.05 and ** p < 0.01.

Figure 4

MSI alterations (mean ± SEM) induced by the KA39 triazolo[3,4-b]thiadiazole derivative (per ng DNA) in five human cancer cell lines. (A–E) represent the MSI alterations in DLD-1, HT-29, DU-145, PC-3, and LS174T cancer cells, treated with KA39 at the TGI concentration and IC50 (μΜ) for 48 h, respectively. Quantification of DNA fragments was carried out in eight additional regions (except the Bethesda panel), i.e., 0–50, 50–75, 75–100, 245–300, 300–338, 338–400, 400–450, 450–490 bp, which are considered by-products generated during GeneScan analysis. Statistical significance level: * p < 0.05 and ** p < 0.01.

Table 6

TMB values in untreated (control) and treated colorectal cancer cells with the KA39 derivative at IC50 (μΜ) for 48 h.

Cancer Cell LinesTumor Mutation Burden (TMB)
Control 48 hKA39 IC50 (μΜ) 48 h
Non-Synonymous MutationsSynonymous MutationsNon-Synonymous MutationsSynonymous Mutations
DLD-1204.17 Muts/Mb31.18 Muts/Mb198.28 Muts/Mb80.93 Muts/Mb
HT-2910.05 Muts/Mb1.67 Muts/Mb10.01 Muts/Mb1.67 Muts/Mb
LS174T67.48 Muts/Mb3.48 Muts/Mb68.06 Muts/Mb3.62 Muts/Mb
With respect to the HT-29 cancer cell line, treatment with KA39 increased PD-L1 expression by 313% and 304.9% when cells were treated at IC50 and the TGI concentration for 72 h, respectively (p < 0.01) (Figure 2B; Figures S6–S10; Tables S6–S10; Table 5). As MSI DNA fragment analysis suggests, a considerable increase in oligonucleotides was induced by KA39 in all five microsatellites (BAT-26, BAT-25, D5S346, D17S250, and D2S123). Cell treatment at the TGI concentration for 48 h led to augmentation of DNA fragments by 1.5-fold in BAT-26 (p < 0.05) and D2S123 (p < 0.05) and 2-fold in BAT-25 (p < 0.05). Exposure to both IC50 and the TGI concentration for 48 h increased oligonucleotides by 1.5- and 2-fold in D5S346 and D17S250 microsatellites, respectively (p < 0.05) (Figure 3B). Except the reference panel (Bethesda panel), DNA fragments were also elevated, upon treatment at the TGI concentration for 48 h, in the following seven regions: 0–50 bp (2.5-fold; p < 0.01), 50–75 bp (2-fold; p < 0.05), 300–338 bp (4-fold; p < 0.05), 338–400 bp (1.5-fold; p < 0.05), and 450–490 bp (2-fold; p < 0.05) (Figure 4B). Similar to DLD-1 cells, no alterations in the TMB was demonstrated after treatment of HT-29 cells with KA39 at IC50 for 48 h (Table 6). The KA39-induced increment in PD-L1 expression was demonstrated in the DU-145 cancer cell line as well. Cell exposure to KA39 at IC50 for 72 h elevated PD-L1 expression levels by 19.86% (p < 0.05), whereas no considerable changes were observed under the remaining treatment conditions (p > 0.05) (Figure 2C; Figures S11–S15; Tables S11–S15; Table 5). Regarding MSI, treatment at both concentrations (TGI = 8 μΜ and IC50 =10.3 μΜ) for 48 h significantly increased oligonucleotides in all five microsatellites of the Bethesda panel as follows: 2 to 5 times in BAT-26 (TGI and IC50; p < 0.01 and p < 0.05, respectively), 2 to 3 in BAT-25 (TGI and IC50; p < 0.01 and p < 0.05, respectively), 2.5 to 3 in D5S346 (TGI and IC50; p < 0.01), 2 to 5 in D17S250 (TGI and IC50; p < 0.01 and p < 0.05, respectively), and 4 in D2S123 (TGI; p < 0.01) (Figure 3C). In addition to the Bethesda panel, oligonucleotides increased 40-fold in 0–50 bp (TGI and IC50; p < 0.01), 20-fold in 50–75 bp (TGI and IC50; p < 0.01), 10-fold in 75–100 bp (TGI and IC50; p < 0.01), 6-fold in 246–300 bp (TGI; p < 0.01), 5-fold in 300–340 bp (TGI; p < 0.01), and 4-fold in 340–400 bp (TGI; p < 0.01) (Figure 4C). In the PC-3 cancer cell line, treatment with KA39 at IC50 for 72 h resulted in a significant increase in PD-L1 expression (27.28%; p < 0.05) (Figure 2D; Figures S16–S20; Tables S16–S20; Table 5). As demonstrated in Figure 3D and Figure 4D, a considerable increase in DNA fragments was impelled when PC-3 cells were treated with KA39 at the TGI concentration for 48 h, elevating oligonucleotides by 1.5-fold in BAT-25 (p < 0.05) and D17S250 (p < 0.05) microsatellites, as well as in the regions of 300–340 bp (p < 0.05) and 450–490 bp (p < 0.01) in which DNA fragments increased by 1.5- and 2-fold, respectively. MSI and TMB alterations induced by KA39 were also studied in the LS174T human cancer cell line. Treatment at the TGI concentration for 48 h increased DNA fragments by 1.5-fold in D5S346 (p < 0.05), 2-fold in D17S250 (p < 0.05), and 1.5-fold in D2S123 (p < 0.05) microsatellites (Figure 3E). Beyond the Bethesda panel, increased oligonucleotides, as compared with untreated cells, were detected in the regions of 0–50 bp (1.5-fold higher; p < 0.05), 50–75 bp (2.5-fold higher; p < 0.05), 245–300 bp (2-fold higher; p < 0.05), 300–338 bp (2-fold higher; p < 0.05), and 338–400 bp (2-fold higher; p < 0.05) upon exposure to KA39 under the same treatment condition (Figure 4E). With reference to the TMB, no significant alterations were recorded upon treatment with KA39 at IC50 for 48 h, according to the TMB values (Table 6). Among all human cancer cell lines included in our experimental studies, DLD-1, DU-145, and PC-3 cells were the most sensitive to KA39, as TGI and IC50 values indicate (Table 1). Nevertheless, HT-29 cancer cells, the cell line less susceptible to KA39, exhibited the most outstanding increase in PD-L1 expression levels in comparison with DLD-1, DU-145, and PC-3 cells. However, MSI appeared to be significantly enhanced in DLD-1 and DU-145 cancer cells in which KA39 generated a higher cytostatic and cytotoxic effect. Comparing with DLD-1 and DU-145 cells, less meaningful but statistically significant MSI enhancement was detected in HT-29, LS174T, and PC-3 cells. With reference to TMB assay and non-synonymous mutations, no considerable alterations were displayed by the tested cancer cell lines, as shown by the TMB values of untreated and treated cancer cells.

4. Discussion

PD-L1, also termed as CD274 or B7-H1, is the physiological ligand of the PD-1 receptor, and both are most important immune checkpoints. PD-L1 expressed by tumor cells is bound to PD-1, which is located on activated T cells. Cancer cells, through PD-L1/PD-1 interaction, are capable of suppressing the tumor-reactive T cells and evading cancer immune surveillance [26,27]. Even though chemotherapy provides important therapeutic benefits, harmful effects may be induced on anticancer immunity, such as the drug-induced PD-L1 expression in cancer cells. To the best of our knowledge, current studies are addressing the effects of anticancer agents on PD-L1 expression in a variety of cancers, including pancreatic, ovarian, and breast [27,28]. Moreover, there appears to be a dose-dependent relationship between PD-L1 upregulation and chemopreventive or cytotoxic agents as, for example, in decitabine and cisplatin administered in leukemia and hepatoma cells, respectively [28,29]. Qin et al. [29] showed that PD-L1 is overexpressed in H22 hepatoma cells following exposure to cisplatin at a concentration less than IC50. According to our findings, all four cancer cell lines treated with KA39 showed significantly elevated PD-L1 expression levels, though the most impressive increase was induced in HT-29 cancer cells (Figure 2A–D). HT-29 cells were less sensitive to KA39 with the TGI concentration and IC50 being approximately 2-fold higher compared to those of DLD-1, DU-145, and PC-3 cells (Table 1). PD-L1 overexpression in the treated HT-29 cells occurred in a dose-dependent manner. It is suggested that oncogenic signaling pathways such as RAS-RAF-MEK-ERK, PI3K-AKT-mTOR, JAK-STAT, and NF-κB are strongly involved in the anticancer agent-mediated PD-L1 expression probably by a signaling crosstalk. In view of the PI3K-AKT-mTOR pathway, inhibition of either PI3K or its downstream signaling molecule AKT leads to repression of PD-L1 expression in tumor cells [30,31,32]. On the contrary, as shown in experimental studies using breast cancer cell lines, loss of phosphatase and tensin homolog (PTEN), due to mutation or depletion, leads to PI3K activation, which, in turn, upregulates the expression of PD-L1 [31,32]. Regarding the PTEN-deficient PC-3 cell line [21], KA39-induced PD-L1 expression was barely higher than in PTEN wild-type DU-145 cells; however, it was not as notable as in HT-29 and DLD-1 cells (both PTEN wild type), in which PD-L1 was upregulated to a far greater extent (Figure 2A,B). Moreover, taking into consideration that the KA39 derivative behaves as an AKT inhibitor [6], downregulation of PD-L1 would be expected. Nevertheless, our results support an acceleration of PD-L1 expression in response to KA39 exposure irrespective of the PTEN status and AKT inhibition, signifying a distinct mechanism of action. Accumulating evidence suggests that PD-L1 upregulation may occur in the context of DNA-damage-induced signaling in tumor cells [33]. As we have previously reported, KA39 induces topIIα inhibition as well [5]. TopIIα inhibitors, as DNA-damaging agents, stimulate the expression of type I IFNs and other cytokines via the activation of the cGAS-STING-TBK1-IRF3 pathway [34]. Furthermore, an association of the cGAS-STING pathway with PD-L1 upregulation has been reported [35]. Wang et al. [34] also found an immune response impelled by the topoisomerase II inhibitor, in particular teniposide-induced PD-L1 expression in multiple cancer cells in vitro. Mechanically, the cytoplasmic DNA, caused by exposure to topII inhibitors, serves as a DNA damage signal, which can be sensed by cyclic GMP-AMP synthase (cGAS). cGAS binding to cytosolic DNA promotes the synthesis of the second messenger cyclic GMP-AMP (cGAMP), which binds to the adaptor protein Stimulator of IFN Gene (STING). The activated STING recruits a signaling cascade that triggers the transcription of type I IFNs genes [36]. It is thought that type I INFs regulate PD-L1 expression through the JAK1/JAK2-STAT1/STAT2/STAT3-IRF1 axis, with IRF1 being bound to the PD-L1 promoter and hence triggering its production [33,34,37]. The MSI phenomenon emerges from a deficient mismatch repair (dMMR) mechanism, which is responsible for the accumulation of mutations in the genome’s short tandemly repeats (STRs), termed as microsatellites [9]. There are three distinct types of MSI phenotypes linked to MMR functionality: (1) MSI-H associated with a dMMR system, (2) low microsatellite instability (MSI-L), and (3) MSS, with the last two being related to pMMR status [38]. The MSI-H phenotype appears in several sporadic cancers, including colorectal, gastric, small intestine, urothelial, endometrial, and, more rarely, prostate [9,39]. Loss of MMR function contributes to enhanced chemoresistance as dMMR cells are less sensitive to commonly used chemotherapeutic drugs such as alkylating agents, platinum compounds, topoisomerase poisons, and purine analogues [40]. However, anti-PD-1 and anti-PD-L1 immunotherapies are much more efficient in dMMR/MSI-H tumors. Concurrent coexistence of neoantigens produced by MMR mutations, with PD-L1 immune checkpoint expression, provides a breeding ground for MSI-H tumors to be treated with anti-PD-L1 therapy [38,41,42,43]. The MSI condition is linked to an impaired MMR mechanism whose dysfunctionality results from mutations, either germline or spontaneous, in MMR genes [12]. The MMR pathway, responsible for the maintenance of genomic integrity, undertakes the repair of postreplicative DNA base mismatches as well as inserted/deleted loops incorporated into microsatellites. Four key genes support MMR’s functionality: mutL homologue 1 (MLH1), postmeiotic segregation increased 2 (PMS2), mutS homologue 2 (MSH2), and mutS6 (MSH6) [44]. The MMR mechanism is initiated with the mismatch being recognized by the MutSα heterodimer (MSH2/MSH6). Afterward, MutSα interacts with the MutLα complex (MLH1/PMS2), forming a “sliding clamp” that moves up and down on the DNA sequence that contains the mismatch. This sliding clamp acts in an ATP-hydrolysis-dependent manner [45]. Once the daughter strand has been identified, the MutSα/MutLa complex guides DNA Exonuclease 1 (EXO1) in order to carry out an excision at the mismatch site. The repair process is completed once the removed DNA sequence is replaced by DNA polymerase δ and the remaining gaps are sealed by DNA ligase I [46,47]. Microsatellites are known for their extreme vulnerability to errors that arise from DNA replication, recombination, or external sources such as radiation or chemical agents [44]. Our study points out a considerable accumulation of oligonucleotides in all five cancer cell lines treated with the anticancer agent KA39, comprising dMMR as well as pMMR cancer cells. Nonetheless, augmentation of DNA fragments, impelled by KA39, was remarkably higher in dMMR DLD-1 and DU-145 cells than in pMMR HT-29 and PC-3 cells, even in dMMR LS174T cells. Furthermore, it is noteworthy that MSI was enhanced in terms of quantity, as more oligonucleotides resulted from KA39 exposure, whereas no alterations were revealed in the relocation of DNA fragments. Each MSI-H cancer cell line carries specific MMR deficiencies (Table 2). DLD-1 cells are dMMR cancer cells bearing a missense mutation in the MSH6 gene, which is responsible for complete loss of the protein. In the absence of the MSH6 protein, single-base mismatches cannot be repaired, though the MMR pathway retains its functionality in general terms. The lack of MSH6 expression does not influence the other MutS proteins, as MSH2 counterbalances its loss by binding to MSH3 [48]. Thus, it can be suggested that in DLD-1 cells, the MMR pathway maintains its recognition activity to a certain extent. With respect to dMMR DU-145 cells, the MutLα heterodimer is completely absent, as both MLH1 and PMS2 proteins are lacking, and consequently the MMR repair activity is significantly diminished. It is interesting to note that the loss of the MLH1 protein has a crucial impact on the MMR mechanism as it leads to inactivation of MutLα’s endonuclease activity, degradation of PMS2, and, hence, an extreme accumulation of errors [17,18,49]. With regard to dMMR LS174T cells, all proteins (MSH2, MSH6, PMS2, and MLH1) are expressed at low levels. However, studies have shown that MLH1 appears to a far lesser extent, probably indicating an attenuated activity of the MutLa complex [50]. Presumably, the KA39 agent further deteriorated the MMR mechanism, mainly in dMMR cells, by disrupting the recognition or repair activity of the MMR mechanism. Nevertheless, the exact molecular mechanism through which KA39 disrupts the MMR pathway is unclear. MSI-H cancer cell lines such as DLD-1 (MSH6 deficiency) and DU-145 (MLH1 and PMS2 deficiencies) cells showed a greater susceptibility to KA39 than the MSS cancer cell line HT-29, pointing out a kind of synthetic lethality. However, the genetic and molecular profile of a cell line influence its cellular response to an anticancer drug; MSS PC-3 and MSI-H LS174T cells share similar sensitivity to KA39 as MSI-H DU-145 and MSS HT-29 cells, respectively (Table 1). Studies related to the MMR pathway support an association of MMR deficiency with resistance to topII inhibitors, though the findings around this area are controversial [51,52]. In pMMR cancer cells, the cleavage complex, induced by a topII inhibitor, is recognized by the MMR pathway, activating eventually the apoptotic procedure. In contrast, the genomic instability of dMMR cells increases the mutation rates in the topII gene, leading, as a consequence, to mutated topII unable to be bound to a topII inhibitor [53,54]. As previously discussed, our results regarding the drug sensitivity to KA39 exhibit heterogeneity, which may be attributable to their specific characteristics. A growing body of evidence supports the implication of AKT in the MMR pathway via PMS2, a component of the MutLα heterodimer. More particularly, binding of the phosphorylated AKT Ser473 to PMS2 leads to the degradation of MutLα’s component, inducing genomic instability and DNA damage. By contrast, inhibition of AKT ensures the stability and nuclear localization of PMS2. It appears that cells with hyperactivated AKT carry ineffective MMR responsible for enhanced accumulation of mutations, drug resistance, and inactivation of the apoptotic procedure [55,56]. Even though KA39 acts as a potent AKT inhibitor as well [6], the MMR pathway was significantly impaired, pointing out that KA39 is not a pure AKT inhibitor. Probably, KA39 targets other elements of the repair mechanism. The TMB represents the number of exonic non-synonymous mutations per megabase (Mb) [57]. Given that the TMB serves as a measure of somatic coding mutations, the volume of neoantigens can be evaluated and, by extension, the responsiveness to ICB therapy can be predicted. It is interesting to note that a higher number of mutations signifies higher response rates, as shown in MSI-H tumors known for their immunogenicity, which is associated with an increasing TMB [42,58]. KA39 produced no direct alterations on the TMB and on the non-synonymous mutation number in the tested cancer cell lines independent of their MMR status. However, a significant increase (>2-fold) of unknown importance was induced at the synonymous mutation number in DLD-1 cells, which bear an MSH6 deficiency (Table 6).

5. Conclusions

The impact of the KA39 triazolo[3,4-b]thiadiazole derivative was investigated on three predictive biomarkers for cancer immunotherapy: PD-L1, MSI, and TMB. According to our findings, a notable increase in PD-L1 expression and MSI was demonstrated, presumably in the context of DNA damage introduced by KA39, while no changes in the TMB were induced. Conclusively, KA39 cannot be considered a mutagenic agent, and microsatellite errors were accumulated by destabilizing the MMR mechanism during cancer cell treatment. Altogether, the significant in vitro anticancer activity in combination with PD-L1 upregulation and MSI enhancement implies that KA39 is a promising anticancer agent able to be developed for cancer chemo-immunotherapy.
  55 in total

1.  Defects of DNA mismatch repair in human prostate cancer.

Authors:  Y Chen; J Wang; M M Fraig; J Metcalf; W R Turner; N K Bissada; D K Watson; C W Schweinfest
Journal:  Cancer Res       Date:  2001-05-15       Impact factor: 12.701

Review 2.  The biochemical basis of microsatellite instability and abnormal immunohistochemistry and clinical behavior in Lynch syndrome: from bench to bedside.

Authors:  C Richard Boland; Minoru Koi; Dong K Chang; John M Carethers
Journal:  Fam Cancer       Date:  2007-07-17       Impact factor: 2.375

3.  Diagnosis of Constitutional Mismatch Repair-Deficiency Syndrome Based on Microsatellite Instability and Lymphocyte Tolerance to Methylating Agents.

Authors:  Sahra Bodo; Chrystelle Colas; Olivier Buhard; Ada Collura; Julie Tinat; Noémie Lavoine; Agathe Guilloux; Alexandra Chalastanis; Philippe Lafitte; Florence Coulet; Marie-Pierre Buisine; Denisa Ilencikova; Clara Ruiz-Ponte; Miriam Kinzel; Sophie Grandjouan; Hilde Brems; Sophie Lejeune; Hélène Blanché; Qing Wang; Olivier Caron; Odile Cabaret; Magali Svrcek; Dominique Vidaud; Béatrice Parfait; Alain Verloes; Ulrich J Knappe; Florent Soubrier; Isabelle Mortemousque; Alexander Leis; Jessie Auclair-Perrossier; Thierry Frébourg; Jean-François Fléjou; Natacha Entz-Werle; Julie Leclerc; David Malka; Odile Cohen-Haguenauer; Yael Goldberg; Anne-Marie Gerdes; Faten Fedhila; Michèle Mathieu-Dramard; Richard Hamelin; Badre Wafaa; Marion Gauthier-Villars; Franck Bourdeaut; Eamonn Sheridan; Hans Vasen; Laurence Brugières; Katharina Wimmer; Martine Muleris; Alex Duval
Journal:  Gastroenterology       Date:  2015-06-25       Impact factor: 22.682

4.  ESMO recommendations on microsatellite instability testing for immunotherapy in cancer, and its relationship with PD-1/PD-L1 expression and tumour mutational burden: a systematic review-based approach.

Authors:  C Luchini; F Bibeau; M J L Ligtenberg; N Singh; A Nottegar; T Bosse; R Miller; N Riaz; J-Y Douillard; F Andre; A Scarpa
Journal:  Ann Oncol       Date:  2019-08-01       Impact factor: 32.976

Review 5.  Role of AKT signaling in DNA repair and clinical response to cancer therapy.

Authors:  Qun Liu; Kristen M Turner; W K Alfred Yung; Kexin Chen; Wei Zhang
Journal:  Neuro Oncol       Date:  2014-05-07       Impact factor: 12.300

Review 6.  A National Cancer Institute Workshop on Microsatellite Instability for cancer detection and familial predisposition: development of international criteria for the determination of microsatellite instability in colorectal cancer.

Authors:  C R Boland; S N Thibodeau; S R Hamilton; D Sidransky; J R Eshleman; R W Burt; S J Meltzer; M A Rodriguez-Bigas; R Fodde; G N Ranzani; S Srivastava
Journal:  Cancer Res       Date:  1998-11-15       Impact factor: 12.701

7.  PI(3) kinase is associated with a mechanism of immunoresistance in breast and prostate cancer.

Authors:  C A Crane; A Panner; J C Murray; S P Wilson; H Xu; L Chen; J P Simko; F M Waldman; R O Pieper; A T Parsa
Journal:  Oncogene       Date:  2008-10-13       Impact factor: 9.867

8.  Frequent inactivation of PTEN in prostate cancer cell lines and xenografts.

Authors:  R J Vlietstra; D C van Alewijk; K G Hermans; G J van Steenbrugge; J Trapman
Journal:  Cancer Res       Date:  1998-07-01       Impact factor: 12.701

9.  DNA mismatch repair gene MLH1 induces apoptosis in prostate cancer cells.

Authors:  Shinichiro Fukuhara; Inik Chang; Yozo Mitsui; Takeshi Chiyomaru; Soichiro Yamamura; Shahana Majid; Sharanjot Saini; Hiroshi Hirata; Guoren Deng; Ankurpreet Gill; Darryn K Wong; Hiroaki Shiina; Norio Nonomura; Rajvir Dahiya; Yuichiro Tanaka
Journal:  Oncotarget       Date:  2014-11-30

Review 10.  Targeted literature review on use of tumor mutational burden status and programmed cell death ligand 1 expression to predict outcomes of checkpoint inhibitor treatment.

Authors:  Tina Krieger; Isobel Pearson; Judith Bell; Jim Doherty; Paul Robbins
Journal:  Diagn Pathol       Date:  2020-01-30       Impact factor: 2.644

View more
  1 in total

1.  Identification of RNA Methylation-Related lncRNAs Signature for Predicting Hot and Cold Tumors and Prognosis in Colon Cancer.

Authors:  Rong He; Changfeng Man; Jiabin Huang; Lian He; Xiaoyan Wang; Yakun Lang; Yu Fan
Journal:  Front Genet       Date:  2022-04-06       Impact factor: 4.772

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.