| Literature DB >> 34202759 |
Jae-Woo Kim1, Yoon-Soo Han2, Hyun-Mee Lee3, Jin-Kyung Kim4, Young-Jin Kim1,2.
Abstract
The use of porous three-dimensional (3D) composite scaffolds class="Gene">has attracted great attention in bone tissue engineering aclass="Chemical">pclass="Chemical">plications because they closely simulate the major features of the natural extracellular matrix (ECM) of bone. This study aimed to class="Chemical">preclass="Chemical">pare biomimetic comclass="Chemical">posite scaffolds via a simclass="Chemical">ple 3D class="Chemical">printing of gelatin/Entities:
Keywords: 3D printing; biomineralization; bone regeneration; composite scaffold; morphological characteristic
Mesh:
Substances:
Year: 2021 PMID: 34202759 PMCID: PMC8267715 DOI: 10.3390/ijms22136794
Source DB: PubMed Journal: Int J Mol Sci ISSN: 1422-0067 Impact factor: 5.923
Figure 1(a) Viscosity and (b) modulus of the gelatin/HA aqueous solution at various temperatures.
Figure 2(a) Final scaffold models designed using 3D modeling CAD software and (b) surface area of scaffold models calculated using 3D modeling CAD software.
Figure 3SEM images of (a) GEHA20, (b) GEHA20-ZZ, and (c) GEHA20-45 scaffolds before biomineralization.
Figure 4SEM images of (a) GEHA20S, (b) GEHA20-ZZS, and (c) GEHA20-45S composite scaffolds after biomineralization.
Figure 5(a) AFM micrographs and (b) pore size (n = 4) of composite scaffolds. * p ˂ 0.05 for comparison between two treatment groups.
Figure 6(a) FTIR, (b) EDX, (c) XRD spectra, and (d) compressive strength of composite scaffolds (n = 4).
Figure 7(a) Proliferation of hBMSCs cultured on composite scaffolds (n = 5) and (b) CLSM images of hBMSCs grown on composite scaffolds after culturing for 7 days. * p ˂ 0.05 for comparison between two treatment groups.
Figure 8ALP activity and expressions of OPG and RANKL proteins in hBMSCs on the composite scaffolds after 14 days of cell culture (n = 5); (a) ALP activity, (b) OPG expression, (c) RANKL expression, and (d) OPG/RANKL ratio. * p ˂ 0.05 for comparison between two treatment groups.
Figure 9Gene expressions in osteogenic differentiation of hBMSCs cultured on composite scaffolds for 14 days (n = 5); (a) COL1, (b) RUNX2, and (c) OPN. * p ˂ 0.05 for comparison between two treatment groups.
qRT-PCR primer sequences for indicated genes.
| Gene | Primer Sequence (5′-3′) | |
|---|---|---|
| Forward | Reverse | |
| COL1 | TCTAGACATGTTCAGCTTTGTGGAC | TCTGTACGCAGGTGATTGGTG |
| RUNX2 | CACTGGCGCTGCAACAAGA | CATTCCGGAGCTCAGCAGAATAA |
| OPN | TCACCAGTCTGATGAGTCTCACCATTC | TAGCATCAGGGTACTGGATGTCAGGTC |
| GAPDH | AGATCATCAGCAATGCAATGCCTCC | ATGGCATGGACTGTGGTCAT |