Literature DB >> 34193022

Pyramiding of cry toxins and methanol producing genes to increase insect resistance in cotton.

Abdul Razzaq1,2, Arfan Ali3, Muhammad Mubashar Zafar1, Aisha Nawaz4, Deng Xiaoying1, Li Pengtao5, Ge Qun1, Muhammad Ashraf6, Maozhi Ren1, Wankui Gong1, Yuan Youlu1.   

Abstract

The idea of enhanced methanol production from cell wall by pectin methyl esterase enzymes (PME) combined with expression of cry genes from Bacillus thuringiensis as a strategy to improve insect pest control in cotton is presented. We constructed a cassette containing two cry genes (cry1Fa and Cry32Aa) and two pme genes, one from Arabidopsis thaliana (AtPME), and other from Aspergillus. niger (AnPME) in pCAMBIA1301 plant expression vector using CAMV-35S promoter. This construction was transformed in Eagle-2 cotton variety by using shoot apex-cut Agrobacterium-mediated transformation. Expression of cry genes and pme genes was confirmed by qPCR. Methanol production was measured in control and in the cry and pme transformed plants showing methanol production only in transformed plants, in contrast to the non-transgenic cotton plants. Finally, insect bioassays performed with transgenic plants expressing cry and pme genes showed 100% mortality for Helicoverpa armigera (cotton bollworm) larvae, 70% mortality for Pectinophora gossypiella (pink bollworm) larvae and 95% mortality of Earias fabia, (spotted bollworm) larvae, that was higher than the transgenic plants expressing only cry genes that showed 84%, 49% and 79% mortality, respectively. These results demonstrate that Bt. cry-genes coupled with pme genes are an effective strategy to improve the control of different insect pests.

Entities:  

Keywords:  Cotton; agrobacterium; eagle-2; insecticidal cry proteins; pectin methyl esterase enzyme; transformation

Mesh:

Substances:

Year:  2021        PMID: 34193022      PMCID: PMC8253136          DOI: 10.1080/21645698.2021.1944013

Source DB:  PubMed          Journal:  GM Crops Food        ISSN: 2164-5698            Impact factor:   3.074


Introduction

Gossypium hirsutum L. is an important economical crop and one of the largest sources of natural fiber worldwide.[1] Cotton crop is subjected to various biotic and abiotic stresses throughout its life cycle.[2] However, the biotic stress caused by pathogens and pests has an important negative impact not only on yield and quality, but also in control measures that increases production cost globally.[1] Cotton fields are prone for lepidopteran infestation such as pink bollworm (Pectinophora gossypiella), army bollworm (Spodoptera litura), American bollworm (Heliothis armigera) and spotted bollworm (Earias fabia). The use of chemical insecticides is not an adequate solution since they seriously damage the environment and human health.[3] Bacillus thuringiensis (Bt) is a soil-born bacterium that produces different insecticidal proteins (named δ-endotoxins, such as Cry toxins), which have been successfully used against insect pest attacks and several Cry insecticidal proteins have been also transformed into cotton crops since 1996.[4] The effectiveness of Bt δ-endotoxins started to decline due to the development of resistance by the insect pests.[5] Despite the proven substantial protective effects of transgenic Bt-cotton plants against insect attack, improvement is still needed in this technology,[6] for instance by combining with some enzymes involved in defense strategies against insect pests.[7] The overproduction of enzymes, involved in insect defense, can be a good alternative to reduce the pest attack and development of insect resistance to Cry toxins.[7] Plant cell walls are heterogeneous structures containing cellulose, hemicellulose, pectin, phenolic compounds and cell wall proteins. Pectins are integral components of plant primary cell wall acting as barriers to insect pests. Pectin methyl esterase enzyme (PME) catalyzes desterification of pectin into pectate and methanol in the plant cell wall to regulate an inhibitory response against insect pests.[3,8] Multiple mechanisms are involved in regulation of PME activity and methanol production in plants such as cell wall pH modifications, expression of inhibitory proteins and differential isoform expression in different tissues at different stages.[9] In this work, PME from Arabidopsis thaliana (AtPME, accession no. NP 566842) and Aspergillus niger (AnPME, accession no. XM_001390469) were used for their overexpression coupled with insecticidal cry genes in transgenic cotton and toxicity was evaluated against different Lepidopteran insect pests. We selected to work with the PME isolated from the fungus A. niger shows high methanol production in tobacco cell suspension culture.[10] It is also reported that activity of PME is elicited by the attack of herbivores in different plant species,[7,11,12] inducing the production of toxic methanol.[13] Methanol is toxic to insect pests,[14] damaged and wounded leaves by the insect attack as a primary source of methanol production by the preexisting PME in the cell wall.[15]

Materials and Methods

Plant Materials

Gossypium hirsutum L. Eagle-2 variety was selected for the expression of two cry genes (cry1Fa and cry32Aa) and two methanol producing genes (AtPME and AnPME). Eagle-2 seeds were obtained from Four Brothers Seeds Multan-Pakistan and planted at research farm of Four Brothers Lahore-Pakistan.

Sequence Selection and Plasmid Construction

Gene sequences of selected pme genes (AtPME, accession no. NP 566842; AnPME, accession no. XM_001390469) were taken from NCBI and after codon optimization, were synthesized by BioBasic, Canada. The synthetic double gene AnPME, AtPME cassette (total 7893 bp) was cloned into the EcoRI and HindIII restriction sites of puc57 vector. While the cry1Fa, cry32Aa gene cassette (total 7954 bp) was cloned into the EcoRI and BamHI restriction sites of pUC57 vector. All genes were under regulation of CaMV35S promoter and Nos terminator was added at the end of these genes (Fig. 1).
Figure 1.

Restriction analysis of puc57 vectors containing the cry1Fa and cry32Aa gene cassette (total 7954 bp size) or the AtPME and AnPME gene cassette (total 7893 bp size). Figure 1a, BamHI and EcoRI restriction analysis of the cry1Fa and cry32Aa gene cassette. M: 10kb ladder. Lane 2: cry1Fa and cry32Aa gene cassette positive sample. Lane 1: negative control of pUC57 without insert samples. Figure 1b, EcoRI and HindIII restriction analysis of the AtPME and AnPME gene cassette. M: 10 Kb ladder. Lane 1, 2: AtPME and AnPME gene cassette positive samples. Figure 1c, schematic representation of both gene cassettes containing cry1Fa and cry32Aa genes or AtPME and AnPME genes, respectively

Restriction analysis of puc57 vectors containing the cry1Fa and cry32Aa gene cassette (total 7954 bp size) or the AtPME and AnPME gene cassette (total 7893 bp size). Figure 1a, BamHI and EcoRI restriction analysis of the cry1Fa and cry32Aa gene cassette. M: 10kb ladder. Lane 2: cry1Fa and cry32Aa gene cassette positive sample. Lane 1: negative control of pUC57 without insert samples. Figure 1b, EcoRI and HindIII restriction analysis of the AtPME and AnPME gene cassette. M: 10 Kb ladder. Lane 1, 2: AtPME and AnPME gene cassette positive samples. Figure 1c, schematic representation of both gene cassettes containing cry1Fa and cry32Aa genes or AtPME and AnPME genes, respectively

Cloning of Genes into Plant Expression Vector pCAMBIA1301

The two pUC57 vectors with the AtPME, AnPME cassette, or the cry1Fa, cry32Aa cassette were transformed into Escherichia coli top10 competent cells through heat shock method and selected on LB media supplemented with tetracycline (50 µg/ml) and ampicillin (50 µg/ml). Plasmids were isolated by using Gene Jet plasmid DNA isolation kit (Thermo Scientific, Vilnius, Lithuania, Cat#K0503) as indicated in the manufacturer protocol. The presence of these genes was confirmed through restriction digestion using EcoRI and HindIII or using EcoRI and BamHI enzymes accordingly to each plasmid. The 7.8 DNA band of AtPME, AnPME cassette and 7.9 Kb band of cry1Fa, and cry32Aa cassette were visualized in 0.8% of agarose gel electrophoresis and excised fragments were purified by using Gene JET Gel Extraction Kit (Thermo Scientific, Vilnius, Lithuania, Cat#K0503). The purified DNA bands were then ligated to the plant expression vector pCAMBIA1301 pre-digested with the corresponding restriction enzymes and transformed into E. coli top10 competent cells. A 1Kb DNA size marker (250bp-10Kb) was received from GeneRulerTM (Thermo Scientific, Cat#SM0311) and used in this study.

Transformation of pCAMBIA1301 vectors with pme and cry gene cassettes into Agrobacterium tumefaciens.

The ligation of the two excised double gene cassettes in pCAMBIA1301 vector was confirmed by restriction digestion using EcoRI and BamHI enzymes or EcoRI and HindIIII accordingly to the pCAMBIA1301-cryCassette or to the pCAMBIA1301-pmeCassette, and further confirmed by PCR using specific primers (see Table 1 and 4) Sequences of the primers used Numerical data for transformation experiments in the field Germination Index Transformation efficiency The optimized PCR conditions used for Cry genes; Initial denaturation at 94°C for 3 minutes, denaturation at 94°C for 45 seconds, annealing at 59°C for 50 seconds, extension at 72°C for 1:30 minutes, final extension at 72°C for 10 minutes whereas the PCR conditions for pme genes; Initial denaturation at 94°C for 3 minutes, denaturation at 94°C for 45 seconds, annealing at 57°C for 45 seconds, extension at 72°C for 1:30 minutes, final extension at 72°C for 10 minutes. The confirmed plasmids were transformed into A. tumefaciens strain LBA4404 competent cells by electroporation.[16] The transformant A. tumefaciens cells were grown on YEP media (Peptone 10 g/L, Yeast extract 10 g/L, Sodium chloride 5 g/L, pH 7.5) supplemented with Kanamycin (50 mg/ml) and Rifampicin (50 mg/ml). The appeared colonies of A. tumefaciens were then further evaluated through colony PCR as been previously reported[17] using the specific primers in Table 1.
Table 1.

Sequences of the primers used

PrimersSequence
GADPH-FTGATGCCAAG GCTGGAATTGCTT
GADPH-RGTGTCGGATCAAGTCGATAACACGG
AnPME-FGGTGCTATCGTTGTTGCTAAGTC
AnPME-RGCAGTAATTGAAGCAGATGAAGG
AtPME -FTCTGTTCCTTTGGGTAACACTTG
AtPME -RGTGATCACGCACCTAAGAAAGAC
Cry1Fa-FATGCGCTGTTTACTTCTAGCAAC
Cry1Fa-RGCACATTTACTGTTTCGTGTTTG
Cry32a-FCTTTTGCTACGGCTGGACTC
Cry32a-RTCACTGCCTTTCTGGCTTTT
VirG-FGAATACCTTACGATCCACGCC
VirG-RGCGAAACCTGCACGTCCGCG

Agrobacterium Tumefaciens Mediated Transformation of Cotton Plants

The seeds of Gossypium hirsutum Eagle-2 plant were surface sterilized and placed in the dark at 30°C for 48 h. The germinated seedlings were used for co-transformation using shoot apex cut method. The embryos were isolated, and injury was introduced to the shoot apex before incubation with the Agrobacterium strain LBA4404 harboring the pCAMBIA1301-cry-pme double cassette. The cultures were incubated for 1 hr at 28°C by placing explants on MS solid medium supplemented with (4.4 g/L, Sucrose 30 g/L, Phytagel 2.4 g/L). The embryos were allowed to grow on MS medium plates for 48–72 h supplemented with cefotaxime (500 mg/ml) followed by screening in MS tubes supplemented with hygromycin (25 mg/ml) for one and a half month. After screening, the cotton plants from the tubes were transplanted into pots containing equal proportion of clay, peat moss and sand (1:1:1). Subsequently, the putative transgenic cotton plants were transplanted to the greenhouses of Four Brothers Genetics Inc. for acclimatization and hardening followed by molecular analysis.

Detection of the Two Double Gene Cassettes in Cotton Plants through PCR

Leaves of the putative transgenic cotton plants were harvested, and DNA was isolated for PCR screening of AnPME, AtPME, cry1Fa, and cry32Aa genes using PCR master mix kit (Thermo Scientific, cat#K1081) using specific primers. In addition, virG gene amplification was also done, by using a specific set of primers from the vir region, to nullify the Agrobacterium contamination. The PCR annealing temperature was set at 60°C.

RNA Extraction and cDNA Preparation

RNA from putative cotton plants was isolated using Agilent kit (Agilent Technologies, Santa Clara, USA, Cat #5185-6000). The RNA was quantified in ng/µl using NanoDrop ND-1000 spectrophotometer at 260 and 280 nm. The DNase-treated total RNA was used to prepare cDNA using the first strand cDNA synthesis kit (Thermo Scientific, Cat #K1632) and cDNA was stored at −20°C.

Expression Analysis of Cotton Transgene

Expression analysis of transgenes was performed by qPCR using specific primers in triplicates with a product size of <200 bp following the protocol of Maxima SYBR Green/ROX (Thermo Scientific, Cat#K0221). The reaction mixture was prepared in a total of 20 µl with the following components of 1 µl of 10 pmol of forward and reverse primers, 5 µl of Maxima® SYBR Green/ROX qPCR Master Mix (2x) and 1 µl (50 ng/µl) of cDNA. Sequences of the primers used for the amplifications of both the genes are given in Table 1. Relative expression was determined according to the 2 (-ΔΔCt) method using GAPDH primers were used as internal control reference gene for normalization in these qPCR experiments. All assays were done in triplicate.

Methanol Quantification in Transgenic Cotton Plants

Transgenic cotton leaves (1 g) were used for determining methanol concentration. Phosphate buffer was prepared in deuterium oxide composed of 0.03% (w/v) sodium salt of trimethylsilyl propionic acid (TSP) (Sigma-Aldrich). After sonication of the samples, they were centrifuged at 13,000 × g for 10 min and supernatant was collected in a tube for methanol content determination, by using mass spectrometry (MS) with the procedure described by.[10] Different concentrations of methanol from 0% to 20% were used as standards.

Insect Bioassays

The efficacy of methanol overproduction was tested on insect bioassays against Helicoverpa armigera, Pectinophora, gossypiella and Earias fabia larvae by comparing toxicity of non-transgenic and transgenic cotton plants. The upper fully expanded positive leaves of the plant that have H. armigera and E. fabia larvae were removed and placed on moist filter paper in laboratory conditions. A 5–7 larvae of 3rd instar were used per leaf in triplicate. The efficacy of transgenic plants against pink bollworm (P. gossypiella) was evaluated by releasing the larvae on young growing bolls and flowers in the field. The mortality rate was observed continuously for 7 days. The mortality rate was calculated by the following formulae; % Mortality = No. of dead Larvae ∕ Total No. of Larvae × 100

Results

Detection of Pme or Cry Genes Cassettes in pUC57 Vector through Restriction Digestion

The two plasmids pUC57 that we received from BioBasic, were digested with BamHI and EcoRI or with EcoRI and HindIII and resolved on 0.8% agarose gel as shown in Fig. 1a. The expected sizes of 7954 bp and 7893 bp, respectively, for the cassettes containing cry genes or pme gene cassettes were observed (Fig. 1b). A schematic representation of both gene cassettes containing cry1Fa and cry32Aa genes or AtPME and AnPME genes, respectively, is also shown in Fig. 1c.

Detection of Transgene in pCAMBIA through Restriction Digestion Analysis and PCR

The purified DNA bands containing these two gene cassettes were ligated to the plant expression vector pCAMBIA1301 pre-digested with the corresponding restriction enzymes. The resulting plasmids were confirmed by restriction digestion analysis. Digestion with EcoRI and HindIII was done for the plasmid containing cry gene cassette and digestion with EcoRI and BamHI was done for the plasmid containing pme gene cassette. The observed band sizes confirmed their successful ligation in pCAMBIA1301. Both cry genes were then amplified resulting in a PCR product of 459 bp for cry1F and 462 bp for cry32A. Similarly, AnPME and AtPME genes were amplified through colony PCR resulting in a PCR product of 557 bp and 554 bp, respectively (Fig. 2).
Figure 2.

Restriction digestion and PCR analysis of both cry genes and pme genes cassettes

Restriction digestion and PCR analysis of both cry genes and pme genes cassettes Figure 2a, EcoRI and BamHI restriction of pCAMBIA1301 vector containing cry gene cassette; Lanes 1, 2: show positive samples; Fig. 2b, EcoRI and HindIII restriction of pCAMBIA1301 vector containing pme gene cassette; Lanes 1, 2: show positive samples; Fig. 2c, confirmation of cry1Fa gene by PCR, M: 10 Kb ladder; Lane 1: shows negative control; Lane 3: shows positive control; Lanes 4, 5, 7, 8, 11 and 12: show positive samples; Lanes 6, 9, and 10: show negative samples. Figure 2d, confirmation of cry32Aa gene by PCR, M: 10Kb ladder; Lane 1, 3: shows negative control; Lanes 4, 5, 7: and 8 show positive samples; Lanes 6, 9, and 10: show negative samples. Figure 2e, confirmation of AnPME gene by PCR, M: 1 Kb ladder; Lane 1: shows positive control; Lanes 3, 4, and 6: show positive samples; Lanes 2, and 5: show negative samples. Figure 2f, confirmation of AtPME gene by PCR, M: 10 Kb ladder; Lane 1: shows positive control; Lanes 3, 4, 5, and 6: show positive samples; Lane 2: shows a negative sample.

Detection of pCAMBIA1301-PMECassette and pCAMBIA1301-cryCassette constructions transformed into A. tumefaciens

A number of random colonies of electroporated A. tumefaciens strain LBA4404 were selected for PCR colony assays, using specific primers designed from cry1Fa, cry32Aa, AnPME and AtPME genes. The PCR products were resolved on 1.5% agarose gel and our results show that all the colonies amplified the expected PCR product of 459 bp and 462 bp for the cry1F and cry32A, respectively, and 557 bp and 554 bp for the Anpme and Atpme genes, respectively, with the exception of the negative control (Fig. 3).
Figure 3.

PCR amplification of both cry genes and pme genes from transformed A. tumefaciens with the corresponding pCAMBIA1301-cryCassette and pCAMBIA1301-pmeCassette constructions

PCR amplification of both cry genes and pme genes from transformed A. tumefaciens with the corresponding pCAMBIA1301-cryCassette and pCAMBIA1301-pmeCassette constructions Figure 3a, Amplification of both cry genes; M: 10 kb ladder; Lane 1: shows negative control; Lane 2: shows positive control; Lanes 3–6: show positive amplification of cry1Fa, and Lane 7–10: show positive amplification of cry32Aa genes in individual A. tumefaciens colonies. Figure 3b, shows an amplification of both pme genes, M: 10 Kb ladder; Lane 1: shows positive control; Lane 2: shows negative control; Lanes 3, 4: show positive amplification of AnPME, and Lane 5, 6: show positive amplification of AtPME genes in individual A. tumefaciens colonies.

Transformation of the Two Double Gene Cassettes into Cotton Plants

The seeds of Gossypium hirsutum Eagle-2 were sterilized and placed in the dark at 30°C for 48 h. The germinated seedlings were used for transformation using shoot apex cut method. These plants were inoculated with both A. tumefaciens strains containing cry gene cassette or pme gene cassettes. Germination index of Eagle-2 was calculated to be 67.50% whereas transformation efficiency was recorded to be 1.35%.

Detection of Transgenic Cotton Plants

Fresh leave samples of the transgenic cotton plants were selected for DNA isolation and analysis of successfully transformed cry genes and pme genes using specific primers that produce PCR products of 459 bp and 462 bp for cry (cry1F & cry32A) genes whereas 557 bp and 454 bp for pme (Anpme & Atpme) genes, respectively (Fig. 4).
Figure 4.

Determination of cry genes and PME genes expression in transgenic cotton plant by PCR analysis

Determination of cry genes and PME genes expression in transgenic cotton plant by PCR analysis Figure 4a, M: 10 Kb ladder; Lane 1, 2: shows negative sample; Lanes 3, 4: show positive for cry1Fa and Lane 5, 6: show positive for cry32Aa, positive samples. Figure 4b, M: 10 Kb ladder; Lane 1: shows positive control; Lane 2: shows negative control; Lanes 3, 5: show positive for AnPME, and Lane 6, 7: show positive for AtPME samples; lane 4: shows negative sample. The mRNA from transgenic plants was isolated and cDNA transcribed. The relative mRNA expression of cry1Fa, cry32Aa, AtPME and AnPME genes was analyzed by using SYBR Green Mix in qPCR assays and higher expression of these genes was found in transgenic plants (Fig. 5). Expression of GAPDH gene was used as internal control reference for normalization in these assays. We analyzed the expression of these genes in four transgenic plants (named K1, K2, K3 and K4) that were positive for transformation with the four genes (cry1Fa, cry32A, AtPMe and AnPME). Control plants were non-transformed Eagle-2 cotton plants.
Figure 5.

Relative expression of cry and PME genes in four transgenic cotton plants (K1, K2, K3 and K4)

Relative expression of cry and PME genes in four transgenic cotton plants (K1, K2, K3 and K4) The relative expression of cry and PME analyzed in different plants shown in the figure was calculated according to the 2 (-ΔΔCt) method using GAPDH as internal control reference gene for normalization. The K2 plants showed the highest relative highest expression of the four AtPME and AnPME, cry1Fa and cry32A genes, while K3 plants showed the lower expression of these genes.

Evaluation of Methanol Concentration in Transgenic Cotton Plants

Transgenic K1-K4 cotton plants were subjected to Mass Spectrometry (MS) for methanol quantification. Transgenic plants K1 and K2 showed the highest contents of methanol, respectively, as compared to K3 and K4 plants and control plants. These data indicated that the methanol production in transgenic plants showed higher values than non-transgenic cotton plants (see Fig. 6).
Figure 6.

Methanol quantification in transgenic cotton plants. Standard curve of methanol was done by Mass Spectrometry (MS) with reference to a methanol standard. The transgenic cotton plants, namely, K1, K2, K3, K4 were subjected to methanol quantification

Methanol quantification in transgenic cotton plants. Standard curve of methanol was done by Mass Spectrometry (MS) with reference to a methanol standard. The transgenic cotton plants, namely, K1, K2, K3, K4 were subjected to methanol quantification

Evaluation of Transgenic Cotton Plants for Resistance against Chewing Insects

Bioassays were performed by using fresh leaves of non-transgenic cotton as negative control, and compared with transgenic cotton plants K1 to K4 expressing double Bt-cry genes and pme genes. We also compared with cotton plants transformed only with the two Bt cry-genes carried out in the laboratory. Each of the sampled fresh leaves was infected with H. armigera and P. gossypiella larvae. A 5–7 larvae of 3rd instar per leaf were used in triplicates. The infestation H. armigera data were recorded, showing 100% mortality on the third day after infection of transgenic cotton plants harboring both Bt cry-genes coupled with AtPME and AnPME, while 84% mortality was observed after fifth days in the control plants transformed only with Bt-cry1Fa and cry32 genes and no mortality was observed in negative control of Eagle-2 cotton plants as shown in Fig. 7.
Figure 7.

Cotton leaf chewing and mortality assay of H. armigera in different transgenic cotton plants

Cotton leaf chewing and mortality assay of H. armigera in different transgenic cotton plants In the case of P. gossypiella larvae were released on freshly growing bolls of the cotton plants. Transgenic cotton plants expressing AtPME and AnPME along with Bt cry-genes showed 70% mortality of P. gossypiella larvae after 3 days, implying resistance toward P. gossypiella larvae. In contrast to transgenic cotton plants harboring only the two Bt cry-genes that showed 49% of P. gossypiella mortality and 0% mortality was observed in non-transgenic Eagle-2 control plants. Finally, regarding spotted Bollworm (Earias fabia) 95% mortality was observed in transgenic harboring double Bt cry and pme gene cassettes, while 79% mortality was observed in transgenic plant expression only the double Bt cry-genes (Fig. 8). Two-way ANOVA showed the significance of our data at P≤ 0.0001 (Fig. 9).
Figure 8.

Pink Bollworm P. gossypiella mortality assays in different transgenic cotton plants. Figure 8a and b, in non-transgenic cotton plants, the cotton boll showed to be completely damaged by P. gossypiella and and larvae that were still alive are highlighted with a red circle mark. Figure 8c and d, in transgenic plants transformed with the double Bt-gene (cry1Fa and cry32Aa), the plant bolls showed insect resistance and only one locule was damaged but P. gossypiella larvae were dead. Figure 8e and f in the transgenic plants transformed with double Bt-gene (cry1Fa and cry32Aa) and double AnPME and AtPME gene in the same plant; the plants showed full resistance and even spotted was found dead on leaf and P. gossypiella free cotton was fully developed

Figure 9.

Mortality analysis against army boll worm Helicoverpa armigera, Pink boll worm Pectinophora gossypiella and spotted bollworm Earias fabia. Two-way ANOVA showed the significance of the data. compared to the non-transformed plants

Pink Bollworm P. gossypiella mortality assays in different transgenic cotton plants. Figure 8a and b, in non-transgenic cotton plants, the cotton boll showed to be completely damaged by P. gossypiella and and larvae that were still alive are highlighted with a red circle mark. Figure 8c and d, in transgenic plants transformed with the double Bt-gene (cry1Fa and cry32Aa), the plant bolls showed insect resistance and only one locule was damaged but P. gossypiella larvae were dead. Figure 8e and f in the transgenic plants transformed with double Bt-gene (cry1Fa and cry32Aa) and double AnPME and AtPME gene in the same plant; the plants showed full resistance and even spotted was found dead on leaf and P. gossypiella free cotton was fully developed Mortality analysis against army boll worm Helicoverpa armigera, Pink boll worm Pectinophora gossypiella and spotted bollworm Earias fabia. Two-way ANOVA showed the significance of the data. compared to the non-transformed plants Figure 7a, Non-transgenic cotton plant leaf completely chewed by H. armigera. Figure 7b, Double Bt-gene (cry1Fa and cry32Aa) plants showed resistance and a little bit chewed by H. armigera. Figure 7c, Double Bt-gene (cry1Fa and cry32Aa) and double AnPME and AtPME gene in the same plant showed full resistance and just a minor cut was observed by H. armigera. Figure 7d, Hatching of H. armigera on negative control Eagle-2 cotton plant leafs. Figure 7e, in double Bt-gene (cry1Fa and cry32Aa) cotton plant leafs, the H. armigera were dead after eating scratched looking portion of leaf. Figure 7f, In the double Bt-gene (cry1Fa and cry32Aa) and double AnPME and AtPME gene plants, the H. armigera were dead even after a minor first cut.

Discussion

Cotton is considered a socioeconomically important crop[18-20] and due to current trend of global market it is necessary to make continuous improvements in cotton varieties.[21] The transformation of new genes into cotton varieties is required to develop resistance against unrelated invading insect pests.[22] For this goal, a unique approach was adopted therein two cassettes were designed. One cassette harbor two pectin methyl esterase genes (pme) from A. thaliana and As. niger and second cassette contains two insecticidal proteins coded by cry genes from B. thuringiensis. Both cassettes were transformed into non-transgenic cotton variety Eagle-2 to achieve resistance against insects as previously depicted in tobacco plants.[8] Initial screening of putative cotton plants was done by hygromycin as reported.[23] Putative transgenic cotton plants were confirmed through PCR by using specific primers as previously done.[24] PCR confirmed transgenic plants were subjected to qPCR for determination of mRNA expression of the transgenic genes as reported.[25] Ultimately, the efficacy of transgene was determined by insect bioassay against different target Lepidopteran larvae.[26] Naturally, plants produce methanol, which is nontoxic for the plants.[27] Methanol after accumulation in leaves is released into atmosphere through stomata[28,29] and is found to be toxic to the insects.[8] In this study, the methanol quantification was done in transgenic and non-transgenic plants by MS as reported before.[10] Transgenic cotton plants K1 and K2 showed a 0.7% and 0.9% increase in methanol concentration when compared with the non-transgenic control plants, while K3 and K4 transformed plants showed only 0.5% and 0.4% methanol concentration, which is less than K1 and K2 plants, but greater than a control plant. Methanol concentration was calculated in correlation with insect bioassay in which K1 and K2 with higher expression of all genes showing 100% mortality in accordance with Hasunuma et al. (2003). In this study, real-time qPCR assays were conducted to analyze mRNA expression of pme and cry genes in transgenic cotton plants. The relative expression of AtPME and AnPME was higher in K2 than in control plants. Insect bioassays were performed on detached leaves, flower and bolls of cotton. The infestation data were recorded and 100% mortality was observed after three days in transgenic cotton plants harboring both Bt cry-genes coupled with AtPME and AnPME genes, while 84% mortality was observed in Bt cry-genes transgenic cotton plants after five days, while there was no mortality observed in negative control cotton plants as shown in Fig. 8. The Pink Bollworm (P. gossypiella) larvae were released on freshly growing bolls of the cotton plants. Transgenic cotton plants showed resistance toward pink bollworm larvae for 3 days with 70% mortality in case of transgenic cotton plants harboring AtPME and AnPME along with Bt cry-genes in contrast with the 49% mortality observed in transgenic cotton plants harboring only the two Bt cry-genes and 0% mortality in non-transgenic control plants. Finally, we observed 95% mortality in spotted bollworm in transgenic plants harboring double Bt-genes and pme genes, while only 79% mortality was observed in transgenic plants expressing only the double Bt cry-genes as shown in Fig. 9. These results indicated that Bt cry-genes coupled with pme genes are a possible and useful strategy to control different insect pests and for lowering the resistance of insects against transgenic cotton varieties.

Conclusion

Transgenic plants expressing simultaneously pme and cry genes were evaluated against different Lepidopteran insect pests and compared against non-transgenic and transgenic plants expressing only Bt cry-genes. Increased mortality in insects was observed in transgenic plants harboring pme and cry gene combination as compared with positive control expressing cry genes only. The increased production of ethanol by pme genes in these transgenic plants explains their improvement in the control against insect attack. This control strategy infers that it may be robust to reduce the attack of different lethal cotton insects. As it is reported that insect attack has become a major concern in cotton growing countries around the world especially in Pakistan where farmers have started walking out from the cultivation of cotton due to the high risk of insect attack. Therefore, the proposed strategy may incur some positive results to win the farmer’s interest in the cotton cultivation.

Compliance with Ethical Standards

Potential Conflict Interest

The authors confirm that there is no actual or potential conflict of interest and also that the work described in this manuscript has not been published previously, that it is not under consideration for publication elsewhere. Its publication has been approved by all authors and implicitly by the responsible authorities where the work was carried out, and all persons entitled to authorship have been so named. The authors also confirm that, if accepted, it will not be published elsewhere including electronically in the same form, in English or in any other language, without the written consent of the copyright-holder.

Research Involvement with Human Participants/ or Animals

The research does not involve with human and animal participants.

Informed Consent

I have read and I understand the provided information and have granted the permission to ask the questions. I understand my participation in the research and liable to produce the given information at any stage.
Table 2.

Numerical data for transformation experiments in the field

Exp. No.No. of embryos isolatedAgrobacterium-treated embryosEmbryos on MS platesDiedSelection tubesPlantlets diedPlants transferred to potsplants died in potsPlants shifted to green house
140340340339671615
234534534534142211
331431131130742211
431030530529871633
535034534534052303
640941041040462422
732031931931452312
841041041040463312
931131131130921101
1033633533533052312
1140041041040641321
1231531231231021110
Total42234216421641595720371423
Table 3.

Germination Index

No. of petri platesTotal seedsNo. of germinated seedsNo. of ungerminated seedsGermination index
140272167.50%
24031  
Table 4.

Transformation efficiency

Agrobacteriumtreated embryosControl plantsPlants shifted to green housetransformation efficiency
  Control plants ExperimentalControl plants Experimental
42165023 5746% 1.35%
  14 in total

Review 1.  Metabolic methanol: molecular pathways and physiological roles.

Authors:  Yuri L Dorokhov; Anastasia V Shindyapina; Ekaterina V Sheshukova; Tatiana V Komarova
Journal:  Physiol Rev       Date:  2015-04       Impact factor: 37.312

Review 2.  New insights into pectin methylesterase structure and function.

Authors:  Jérôme Pelloux; Christine Rustérucci; Ewa J Mellerowicz
Journal:  Trends Plant Sci       Date:  2007-05-10       Impact factor: 18.313

Review 3.  Learning from nature: new approaches to the metabolic engineering of plant defense pathways.

Authors:  Jan Jirschitzka; Derek Joseph Mattern; Jonathan Gershenzon; John Charles D'Auria
Journal:  Curr Opin Biotechnol       Date:  2012-11-07       Impact factor: 9.740

4.  A simple and efficient PCR method for the detection of Agrobacterium tumefaciens in plant tumours.

Authors:  J Cubero; M C Martínez; P Llop; M M López
Journal:  J Appl Microbiol       Date:  1999-04       Impact factor: 3.772

5.  Simultaneous growth and emission measurements demonstrate an interactive control of methanol release by leaf expansion and stomata.

Authors:  K Hüve; M M Christ; E Kleist; R Uerlings; U Niinemets; A Walter; J Wildt
Journal:  J Exp Bot       Date:  2007-03-20       Impact factor: 6.992

6.  Methanol production is enhanced by expression of an Aspergillus niger pectin methylesterase in tobacco cells.

Authors:  Tomohisa Hasunuma; Ei-ichiro Fukusaki; Akio Kobayashi
Journal:  J Biotechnol       Date:  2003-12-05       Impact factor: 3.307

7.  Transgenic cotton and farmers' health in Pakistan.

Authors:  Shahzad Kouser; David J Spielman; Matin Qaim
Journal:  PLoS One       Date:  2019-10-02       Impact factor: 3.240

8.  Enhanced methanol production in plants provides broad spectrum insect resistance.

Authors:  Sameer Dixit; Santosh Kumar Upadhyay; Harpal Singh; Om Prakash Sidhu; Praveen Chandra Verma; Chandrashekar K
Journal:  PLoS One       Date:  2013-11-05       Impact factor: 3.240

Review 9.  Enhancing Integrated Pest Management in GM Cotton Systems Using Host Plant Resistance.

Authors:  Carlos Trapero; Iain W Wilson; Warwick N Stiller; Lewis J Wilson
Journal:  Front Plant Sci       Date:  2016-04-22       Impact factor: 5.753

10.  Amplicon-Based RNA Interference Targeting V2 Gene of Cotton Leaf Curl Kokhran Virus-Burewala Strain Can Provide Resistance in Transgenic Cotton Plants.

Authors:  Aneela Yasmeen; Sarfraz Kiani; Afshan Butt; Abdul Qayyum Rao; Faheem Akram; Aftab Ahmad; Idrees Ahmad Nasir; Tayyab Husnain; Shahid Mansoor; Imran Amin; Shaheen Aftab; Muhammad Zubair; Muhammad Nouman Tahir; Sohail Akhtar; Jodi Scheffler; Brian Scheffler
Journal:  Mol Biotechnol       Date:  2016-12       Impact factor: 2.695

View more
  1 in total

1.  Heterologous expression of cry3Bb1 and cry3 genes for enhanced resistance against insect pests in cotton.

Authors:  Muhammad Mubashar Zafar; Ghulam Mustafa; Fiza Shoukat; Atif Idrees; Arfan Ali; Faiza Sharif; Amir Shakeel; Huijuan Mo; Yuan Youlu; Qurban Ali; Abdul Razzaq; Maozhi Ren; Fuguang Li
Journal:  Sci Rep       Date:  2022-06-27       Impact factor: 4.996

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.