| Literature DB >> 34191097 |
Carla Bini1, Arianna Giorgetti2, Alessandra Iuvaro2, Elena Giovannini2, Denise Gianfreda2, Guido Pelletti2, Susi Pelotti2.
Abstract
Fly artifacts resulting from insect activity could act as confounding factors on a crime scene and interfere with bloodstain pattern analysis interpretation. Several techniques have been proposed to distinguish fly artifacts from human bloodstains based on morphological approach and immunological assay, but a DNA-based method has not been developed so far. Even if in forensic genetic investigations the detection of human DNA is generally the primary goal, fly artifacts can provide useful information on the dynamics of crime events. The present study provides a molecular method to detect fly DNA from artifacts deposited by Calliphora vomitoria after feeding on human blood through the analysis of the mitochondrial cytochrome oxidase gene subunit I (COI). Fly artifacts originated from digestive process and of different morphology spanning from red and brownish/light brown, circular and elliptical stains to artifacts with sperm-like tail or a tear-shaped body were collected. The COI amplification was successfully obtained in 94% of fly artifact samples. The method showed high sensitivity and reproducibility, and no human DNA contamination was observed, offering specificity for use in confirmatory test. This molecular approach permits the distinction of fly artifacts from genuine bloodstains and the identification of fly's species through the COI region sequencing by protocols usually applied in forensic genetic laboratories.Entities:
Keywords: Bloodstain pattern analysis; COI sequence; Fly artifacts; Forensic genetics; Species identification; mtDNA
Mesh:
Substances:
Year: 2021 PMID: 34191097 PMCID: PMC8523429 DOI: 10.1007/s00414-021-02643-7
Source DB: PubMed Journal: Int J Legal Med ISSN: 0937-9827 Impact factor: 2.686
Primers sequences used in this study
| Primer | Sequence (5′-3′) | Primer length | |
|---|---|---|---|
| Forward | C1-J-1751 | GGATCTCCTGATATAGCTTTCCC | 23 |
| Reverse | C1-N-2191 | CCCGGTAAAATTAAAATATAAACTTC | 26 |
Fig. 1Examples of fly artifacts of different morphology submitted to the study: brownish/light brown circular or elliptical stains (a), red circular stains (b), and tailed circular or sperm-like stains (c)
Fig. 2Agarose gel results of the COI region amplification of 489 bp including primers sequences. Lanes L: 100 bp DNA marker, 1: positive control (C. vomitoria pupae), 2–5: fly artifacts, 6: negative control (human DNA)