| Literature DB >> 34177588 |
Shaoxuan Zhang1, Boxing Sun1, Dali Wang1, Ying Liu1, Jing Li1, Jiajia Qi1, Yonghong Zhang1, Chunyan Bai1, Shuang Liang1.
Abstract
4,4'-(9-Fluorenylidene) diphenol (BPFL, also known as BHPF and fluorene-9-bisphenol) is a novel bisphenol A substitute that is used in the plastics industry as an organic synthesis intermediate and is a potential endocrine disruptor. However, the deleterious effects of BPFL on porcine Sertoli cells (SCs) and the possible underlying mechanisms are still unclear. Chlorogenic acid (CA) is a free radical scavenger in the cellular antioxidant system that prevents oxidative damage and apoptosis. In the present research, we found that BPFL induced impairments in porcine SCs in a dose-dependent manner and that CA protected porcine SCs against BPFL exposure-induced impairments. Cell viability, proliferation and apoptosis assay results revealed that BPFL exposure could inhibit porcine SC proliferation and induce apoptosis, while CA supplementation ameliorated the effects of BPFL. Further analysis revealed that BPFL exposure induced oxidative stress, mitochondrial membrane potential dysfunction and DNA damage accumulation. Transcriptome analysis and further real-time quantitative PCR and Western blot results showed that BPFL exposure induced endoplasmic reticulum stress and apoptosis. Supplementation with CA dramatically ameliorated these phenotypes in BPFL-exposed porcine SCs. Overall, the present research reveals the possible underlying mechanisms by which BPFL exposure induced impairments and CA supplementation protected against these impairments in porcine SCs.Entities:
Keywords: BPFL; ameliorates; chlorogenic acid; impairments; porcine sertoli cells
Year: 2021 PMID: 34177588 PMCID: PMC8219976 DOI: 10.3389/fphar.2021.678772
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.810
Primers used for RT-qPCR analysis.
| Symbol | Primer | Primer Sequence (5′–3′) | Gene ID (NCBI) |
|---|---|---|---|
| TBP | F-primer | GCGATTTGCTGCTGTAATCA | 110259740 |
| R-primer | CCCCACCATGTTCTGAATCT | ||
| Bax | F-primer | GCCGAAATGTTTGCTGACG | 396633 |
| R-primer | CAGCCGATCTCAAGGAAG | ||
| Bcl-2 | F-primer | CAAGCCTTCAACCATTATCTCAGT | 100049703 |
| R-primer | GGGGGGTAAAGAAAACAGCAT | ||
| Caspase 8 | F-primer | CCTGGTATATCCAATCACTGTGC | 595105 |
| R-primer | CTCAGGGTGAAAGTAGGTTGTGG | 100518913 | |
| Caspase 9 | F-primer | AACTTCTGCCATGAGTCGGG | |
| R-primer | CCAAAGCCTGGACCATTTGC |
FIGURE 1Chlorogenic acid (CA) ameliorates the BPFL exposure-induced decrease in cell viability in porcine Sertoli cells (SCs). (A, B) Porcine SCs were exposed to 0–100 μM for 24 and 48 h at 37°C, and cell viability was detected by CCK-8 assay respectively. (C) The viability of porcine SCs after 48 h of treatment with BPFL (50 μM) with/without CA (0–200 μM). (**p < 0.01) indicates a significant difference from the control (0.1% DMSO).
FIGURE 2CA ameliorates BPFL exposure-induced proliferation arrest and apoptosis in porcine SCs. (A) Micrographs showing the incorporation of EDU in porcine SCs treated with BPFL and CA after 48 h. The proliferating cells fluoresce in red. The nuclei (Hoechst) are shown in blue. (B) Quantitative analysis of proliferation level was calculated by the percentage of red cells versus blue cells. (C) Cell apoptosis was detected by flow cytometry with Annexin V-FITC/PI double staining. (D) Analysis of the percentage of apoptotic cells after different treatments is shown in a histogram. (**p < 0.01) indicates a significant difference from the control (0.1% DMSO).
FIGURE 3RNA-seq analysis of the effects of BPFL exposure on SCs. (A) The number of genes differentially expressed after BPFL treatment. (B) Volcano plot analysis of genes differentially expressed after BPFL treatment. (C) Gene Ontology enrichment analysis of the differential gene expression after BPFL treatment. (D) Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis of genes downregulated after BPFL treatment. (E) KEGG enrichment analysis of genes upregulated after BPFL treatment.
FIGURE 4CA ameliorates BPFL exposure-induced oxidative stress and DNA damage in porcine SCs. (A) Fluorescence photomicrographs of reactive oxygen species in cultured SCs after BPFL and CA treatment for 48 h. (B) Analysis of the relative reactive oxygen species levels in different treatment groups. (C) SOD activity of SCs after treatment. (D) Representative images of DNA damage in porcine SCs after single-cell gel electrophoresis assay. (E, F) The tail moment values and the tail DNA% of the comet tails were analyzed by ImageJ. (*p < 0.05) indicates a difference from the control (0.1% DMSO); (**p < 0.01) indicates a significant difference from the control (0.1% DMSO).
FIGURE 5CA ameliorates BPFL exposure-induced mitochondrial dysfunction, ERS, apoptosis and autophagy in porcine SCs. (A) Fluorescence photomicrographs of JC-1 aggregates (green) and JC-1 monomers (red) of cultured SCs after BPFL and CA treatment for 48 h. (B) Analysis of the proportion of mitochondrial depolarization in different treatment groups. (C) Western blotting was used to detect the protein expression levels in each treatment group. (D) Histogram showing the relative expression of several proteins in each group compared to the reference proteins in the control group. (E) Relative mRNA expression of genes in different treatment groups. ns indicates no difference from the control (0.1% DMSO); (*p < 0.05) indicates a difference from the control; and (**p < 0.01) indicates a significant difference from the control.
FIGURE 6Schematic diagram illustrating the effect of CA in ameliorating BPFL exposure-induced impairments in porcine SCs. BPFL exposure impaired porcine SCs by inducing oxidative stress, mitochondrial function, DNA damage, ERS and apoptosis. CA supplementation ameliorated the impairments induced by BPFL exposure in porcine SCs.