Maria F Ullo1, Jeremy S Logue1. 1. Department of Regenerative and Cancer Cell Biology, Albany Medical College, Albany, United States.
Abstract
Melanoma cells have been shown to undergo fast amoeboid (leader bleb-based) migration, requiring a single large bleb for migration. In leader blebs, is a rapid flow of cortical actin that drives the cell forward. Using RNAi, we find that co-depleting cofilin-1 and actin depolymerizing factor (ADF) led to a large increase in cortical actin, suggesting that both proteins regulate cortical actin. Furthermore, severing factors can promote contractility through the regulation of actin architecture. However, RNAi of cofilin-1 but not ADF led to a significant decrease in cell stiffness. We found cofilin-1 to be enriched at leader bleb necks, whereas RNAi of cofilin-1 and ADF reduced bleb sizes and the frequency of motile cells. Strikingly, cells without cofilin-1 and ADF had blebs with abnormally long necks. Many of these blebs failed to retract and displayed slow actin turnover. Collectively, our data identifies cofilin-1 and ADF as actin remodeling factors required for fast amoeboid migration.
Melanoma cells have been shown to undergo fast amoeboid (leader bleb-based) migration, requiring a single large bleb for migration. In leader blebs, is a rapid flow of cortical actin that drives the cell forward. Using RNAi, we find that co-depleting cofilin-1 and actin depolymerizing factor (ADF) led to a large increase in cortical actin, suggesting that both proteins regulate cortical actin. Furthermore, severing factors can promote contractility through the regulation of actin architecture. However, RNAi of cofilin-1 but not ADF led to a significant decrease in cell stiffness. We found cofilin-1 to be enriched at leader bleb necks, whereas RNAi of cofilin-1 and ADF reduced bleb sizes and the frequency of motile cells. Strikingly, cells without cofilin-1 and ADF had blebs with abnormally long necks. Many of these blebs failed to retract and displayed slow actin turnover. Collectively, our data identifies cofilin-1 and ADF as actin remodeling factors required for fast amoeboid migration.
Cell migration requires tight spatiotemporal control of the filamentous-actin (F-actin) cytoskeleton. For mesenchymal migration, actin assembly/disassembly and myosin contraction must occur within specific regions of the cell (Pollard and Borisy, 2003). Relative to other, recently described modes of migration, the mechanisms by which mesenchymal cells coordinate these processes are reasonably well understood. Whereas, in amoeboid cells, which migrate using intracellular-driven protrusions of the plasma membrane (PM) or blebs, the mechanisms conferring spatiotemporal control of the F-actin cytoskeleton are not well known.Within tissues, cells encounter a variety of physicochemical environments. We and others discovered that in response to tissue confinement, cancer cells frequently undergo phenotypic transitions, including to what has been termed ‘fast amoeboid migration’ (Logue et al., 2015; Liu et al., 2015; Ruprecht et al., 2015; Bergert et al., 2015; Mistriotis et al., 2019; Wisniewski et al., 2020). A hallmark of amoeboid migration is the presence of blebs, which form as a result of PM-cortical actin separation (Charras et al., 2008). Typically, blebs are rapidly retracted following the reassembly of cortical actin on bleb membranes and the recruitment of myosin (Charras et al., 2008). However, during fast amoeboid migration, cells form a very large and stable bleb. Within these blebs, is a cortical actin network that flows from the bleb tip to the neck, which separates leader blebs from the cell body (Logue et al., 2015; Liu et al., 2015; Ruprecht et al., 2015; Bergert et al., 2015). Together with non-specific friction, flowing cortical actin provides the motive force for cell movement (Ruprecht et al., 2015). Accordingly, we simultaneously termed this mode of migration, leader bleb-based migration (LBBM) (Logue et al., 2015). Because migration plasticity is thought to be a major contributor of metastasis, our aim here is to identify the essential factors required for the rapid cortical actin flow in leader blebs.Previous studies have demonstrated that myosin is enriched at the neck of leader blebs. Indeed, the myosin at this location has been shown to be required for rapid cortical actin flow (Liu et al., 2015; Ruprecht et al., 2015; Bergert et al., 2015). However, what drives the disassembly of F-actin at the neck to replenish the pool of G-actin at the leader bleb tip is unknown. Thus, we hypothesize that actin disassembly factors within leader blebs play a pivotal role in this process. Similarly, in mesenchymal cells, retrograde actin flow is driven by both myosin contraction and actin disassembly, the latter of which is accelerated by the actin depolymerizing factor (ADF)/cofilin family of severing factors (Bravo-Cordero et al., 2013). Severing depends on ADF/cofilin inducing a structural change within the actin filament, an activity known to be repressed by LIM kinase (LIMK) phosphorylation on Ser 3 (Yang et al., 1998). However, the consequence of actin severing is variable, depending on the availability of barbed end capping proteins. At a sufficiently high level, new barbed ends are capped, promoting actin disassembly from new pointed ends (Wioland et al., 2017). Conversely, if left uncapped, increased polymerization from new barbed ends may occur (Wioland et al., 2017). The effects of ADF/cofilin on actin severing is also concentration dependent, where low and high levels of ADF/cofilin sever and stabilize actin filaments, respectively (Andrianantoandro and Pollard, 2006). Additionally, by competing for F-actin binding (e.g., Arp2/3) and other mechanisms, ADF/cofilin can regulate actin architecture (Chan et al., 2009; Gressin et al., 2015). The effects of ADF/cofilin on cortical actin are even less certain, as the focus of many studies has been on the actin within lamellipodia. Although Wiggan et al. have previously reported bleb defects in HeLa cells depleted of actin severing factors, the role of ADF and cofilin-1 in regulating the cortical actomyosin flow in fast amoeboid cells has not been determined (Wiggan et al., 2012).By combining an in vitro assay for the precise confinement of cells with quantitative imaging approaches, we report that ADF and cofilin-1, together, are required for the rapid disassembly of incoming cortical actin at leader bleb necks. Under conditions of confinement, we find that melanoma and lung adenocarcinoma cells depleted of both proteins display dramatic defects in bleb morphology and dynamics. Consequently, cells without ADF and cofilin-1 cannot undergo LBBM. Thus, we reveal unanticipated roles for ADF and cofilin-1 in driving confined (leader bleb-based) migration.
Results
ADF and cofilin-1 are required for LBBM
Using our previously described approach for cell confinement, which involves placing cells under a slab of PDMS held at a defined height (~3 µm) above cover glass, cancer cells will switch to LBBM (Figure 1A and Video 1; Logue et al., 2018). Moreover, within leader blebs, we find a rapid flow of cortical actin, which together with non-specific friction, provides the motive force for cell movement (Figure 1B and Video 2; Bergert et al., 2015). As indicated by an enrichment in EGFP tagged regulatory light chain (EGFP-RLC), we observe a concentration of myosin at the leader bleb neck that separates the leader bleb from the cell body (Figure 1C and Video 2; Liu et al., 2015; Ruprecht et al., 2015; Bergert et al., 2015). In concert with myosin, we wondered if the cortical actin flow in leader blebs requires the action of specific actin disassembly factors.
Figure 1.
ADF and cofilin-1 are required for leader bleb-based migration.
(A) Ventral Z-section of a melanoma A375-M2 cell, which has been confined down to 3 µm, with mEmerald-LifeAct. (B) Kymograph from (A; dashed line), showing cortical actin flow. (C) Ventral Z-section of a melanoma A375-M2 cells, which has been confined down to 3 µm, with EGFP tagged regulatory light chain (EGFP-RLC). (D) Western blot confirming CFL1, actin depolymerizing factor (ADF), and ADF + CFL1 RNAi in melanoma A375-M2 cells. (E) Individual cell migration tracks (plot of origin) for non-targeting, CFL1, ADF, and CFL1 + ADF RNAi cells, as well as CFL1 + ADF RNAi cells rescued by transfection with EGFP-cofilin-1 plasmid. In each, cells were tracked over a period of 5 hr. Relative y (µm) and relative × (µm) are shown in each. (F) Percentage of highly motile cells from (E). Cells that traveled a distance equivalent to at least one cell length over the course of the 5 hr time-lapse were classified as highly motile. (G) Average speed (µm/min) from cells in (E; mean ± SEM). Statistical significance was determined by one-way ANOVA and a Dunnett’s post hoc test. (H) Instantaneous top speed (µm/min) for highly motile cells in (E; mean ± SEM). (I) Cofilin-1 levels (fold change; fluorescence intensity) of adhered RNAi cells by immunofluorescence confirming rescue by transfection with EGFP-cofilin-1 or not rescued with EGFP. Statistical significance was determined by an unpaired one-sample t-test. All data are representative of at least three independent experiments. *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, and ****p ≤ 0.0001.
Spreadsheet of x-y coordinates of cells for each frame within a video. Time interval between frames for all cells is 8 min. Data for CFL1, actin depolymerizing factor (ADF), CFL1 + ADF RNAi, as well as CFL1 + ADF RNAi cells rescued by transfection with EGFP-cofilin-1 plasmid are provided. These data are displayed as plots of origin in Figure 1E.
(A) Quantitative evaluation of cofilin-1 (left) and actin depolymerizing factor (ADF) (right) RNAi as measured by Western blotting of total cell lysates. (B) Quantitative evaluation of cofilin-1 and ADF mRNA levels by qRT-PCR in A375-M2 cells (mean ± SEM). (C) Direction autocorrelation plots of confined highly motile cells after RNAi. (D) Transmigration of melanoma A375-M2 cells through 8 (above) or 12 µm (below) pores after non-targeting, CFL1, ADF, and CFL1 + ADF RNAi. Statistical significance was determined by one-way ANOVA and a Dunnet’s post hoc test. All data are representative of at least three independent experiments. *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, and ****p ≤ 0.0001.
Video 1.
Time-lapse imaging of melanoma A375-M2 cells confined down to 3 µm with far-red plasma membrane dye.
Video 2.
Time-lapse imaging of a melanoma A375-M2 cell confined down to 3 µm with mScarlet-LifeAct and EGFP tagged regulatory light chain (EGFP-RLC).
ADF and cofilin-1 are required for leader bleb-based migration.
(A) Ventral Z-section of a melanoma A375-M2 cell, which has been confined down to 3 µm, with mEmerald-LifeAct. (B) Kymograph from (A; dashed line), showing cortical actin flow. (C) Ventral Z-section of a melanoma A375-M2 cells, which has been confined down to 3 µm, with EGFP tagged regulatory light chain (EGFP-RLC). (D) Western blot confirming CFL1, actin depolymerizing factor (ADF), and ADF + CFL1 RNAi in melanoma A375-M2 cells. (E) Individual cell migration tracks (plot of origin) for non-targeting, CFL1, ADF, and CFL1 + ADF RNAi cells, as well as CFL1 + ADF RNAi cells rescued by transfection with EGFP-cofilin-1 plasmid. In each, cells were tracked over a period of 5 hr. Relative y (µm) and relative × (µm) are shown in each. (F) Percentage of highly motile cells from (E). Cells that traveled a distance equivalent to at least one cell length over the course of the 5 hr time-lapse were classified as highly motile. (G) Average speed (µm/min) from cells in (E; mean ± SEM). Statistical significance was determined by one-way ANOVA and a Dunnett’s post hoc test. (H) Instantaneous top speed (µm/min) for highly motile cells in (E; mean ± SEM). (I) Cofilin-1 levels (fold change; fluorescence intensity) of adhered RNAi cells by immunofluorescence confirming rescue by transfection with EGFP-cofilin-1 or not rescued with EGFP. Statistical significance was determined by an unpaired one-sample t-test. All data are representative of at least three independent experiments. *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, and ****p ≤ 0.0001.
Raw data from manual tracking.
Spreadsheet of x-y coordinates of cells for each frame within a video. Time interval between frames for all cells is 8 min. Data for CFL1, actin depolymerizing factor (ADF), CFL1 + ADF RNAi, as well as CFL1 + ADF RNAi cells rescued by transfection with EGFP-cofilin-1 plasmid are provided. These data are displayed as plots of origin in Figure 1E.
Protein levels and migration parameters.
(A) Quantitative evaluation of cofilin-1 (left) and actin depolymerizing factor (ADF) (right) RNAi as measured by Western blotting of total cell lysates. (B) Quantitative evaluation of cofilin-1 and ADF mRNA levels by qRT-PCR in A375-M2 cells (mean ± SEM). (C) Direction autocorrelation plots of confined highly motile cells after RNAi. (D) Transmigration of melanoma A375-M2 cells through 8 (above) or 12 µm (below) pores after non-targeting, CFL1, ADF, and CFL1 + ADF RNAi. Statistical significance was determined by one-way ANOVA and a Dunnet’s post hoc test. All data are representative of at least three independent experiments. *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, and ****p ≤ 0.0001.In addition to being frequently up-regulated in cancer, the ADF/cofilin family of actin severing factors are known to be essential for actin turnover in mesenchymal cells (Bravo-Cordero et al., 2013; Bracalente et al., 2018). Therefore, we set out to determine if ADF and/or cofilin-1 are important for LBBM. In melanoma A375 cells, a widely used cell line for the study of amoeboid migration, both ADF and cofilin-1 are expressed, with cofilin-1 mRNA levels being threefold higher (Figure 1—figure supplement 1B). Using A375 cells, we depleted cells of ADF and cofilin-1 alone and together by RNAi (Figure 1D and Figure 1—figure supplement 1A). By manually tracking the movement of cells over time, we found that cells depleted of cofilin-1 were significantly less motile (Figure 1E–H and Figure 1—figure supplement 1C). Additionally, the adhesive transmigration of cells through small pores was hindered after depleting cofilin-1 (Figure 1—figure supplement 1D). Depleting cells of ADF led to a slight reduction in the number of highly motile cells (Figure 1E–H and Figure 1—figure supplement 1C). Strikingly, depleting cells of both ADF and cofilin-1 appeared to have an additive effect on reducing LBBM, whereas the adhesive transmigration of cells through small pores did not display this additive behavior and was not affected by ADF depletion (Figure 1E–H and Figure 1—figure supplement 1D). These results suggest that these proteins play non-overlapping roles during LBBM (Figure 1E–H). In agreement with this concept, transfection of EGFP-cofilin-1 into cells depleted of both proteins was insufficient to restore LBBM (Figure 1E–I).
Figure 1—figure supplement 1.
Protein levels and migration parameters.
(A) Quantitative evaluation of cofilin-1 (left) and actin depolymerizing factor (ADF) (right) RNAi as measured by Western blotting of total cell lysates. (B) Quantitative evaluation of cofilin-1 and ADF mRNA levels by qRT-PCR in A375-M2 cells (mean ± SEM). (C) Direction autocorrelation plots of confined highly motile cells after RNAi. (D) Transmigration of melanoma A375-M2 cells through 8 (above) or 12 µm (below) pores after non-targeting, CFL1, ADF, and CFL1 + ADF RNAi. Statistical significance was determined by one-way ANOVA and a Dunnet’s post hoc test. All data are representative of at least three independent experiments. *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, and ****p ≤ 0.0001.
Together, ADF and cofilin-1 are required to retract blebs
Subsequently, we wanted to know what is responsible for the decrease in LBBM upon depleting ADF and/or cofilin-1. Initially, we analyzed the area of the largest bleb (i.e., leader bleb), relative to the cell body, in cells depleted of ADF and/or cofilin-1. This analysis revealed that depleting cells of cofilin-1 reduced the area of the largest bleb by ~15% of control while depleting cells of both ADF and cofilin-1 reduced the area of the largest bleb by ~40% of control (non-targeting; Figure 2A–B and Videos 3–5). The area of all blebs was similarly reduced (Figure 2C). Strikingly, in cells depleted of both ADF and cofilin-1, ~30% of cells displayed blebs with elongated necks (Figure 2A,D and Video 6). Detailed analyses of these cells revealed that ~60% display blebs that never retract into the cell body (Figure 2E). Moreover, we found this effect to not be specific to melanoma A375 cells, as depleting lung adenocarcinomaA549 cells of both ADF and cofilin-1 similarly resulted in the elongation of bleb necks (Figure 2F–G). In melanoma A375 cells, depleting both ADF and cofilin-1 had an additive effect on reducing the rate of bleb retraction, which points to these proteins having non-overlapping functions specifically at bleb necks (Figure 2H). In support of this role, we determined the location of EGFP-cofilin-1 in confined cells. Our initial efforts were unsuccessful because of a high degree of soluble (i.e., unbound to F-actin) protein, but in cells depleted of endogenous ADF and cofilin-1 we could detect an enrichment of EGFP-cofilin-1 at leader bleb necks (Figure 2I; arrow).
Figure 2.
Together, actin depolymerizing factor (ADF) and cofilin-1 are required to retract blebs.
(A) Montage of non-targeting, CFL1, ADF, and CFL1 + ADF RNAi with EGFP alone (volume marker) in melanoma A375-M2 cells. (B–C) Quantitation of area for leader (A) and all blebs (B) after non-targeting, CFL1, ADF, and ADF + CFL1 RNAi. Statistical significance was determined by one-way ANOVA and a Dunnet’s post hoc test. (D) Percent of non-targeting, CFL1, ADF, and CFL1 + ADF RNAi cells with elongated bleb necks. (E) Percent of ADF + CFL1 RNAi cells from (D) with elongated bleb necks that retract vs. un-retracted. (F–G) Lung adenocarcinoma A549 cells after non-targeting and CFL1 + ADF RNAi stained with a far-red fluorescent membrane dye (F). Percent of non-targeting, CFL1, ADF, and CFL1 + ADF RNAi cells with elongated bleb necks (G). (H) Bleb retraction rates for non-targeting (45 blebs; 26 cells), CFL1 (40 blebs; 20 cells), ADF (48 blebs; 30 cells), and CFL1 + ADF RNAi (38 blebs; 23 cells). Statistical significance was determined by one-way ANOVA and a Dunnet’s post hoc test. (I) EGFP-cofilin-1 localization in an A375-M2 cell confined down to 3 µm. Arrow points to an enrichment of cofilin-1 at the leader bleb neck. (I’) Regional analysis of EGFP-cofilin-1 average fluorescence intensity in ROIs sampled from bleb neck to tip (mean ± SEM). Representative regions taken within white box and dashed lines in (I). All data are representative of at least three independent experiments. *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, and ****p ≤ 0.0001.
Spreadsheet of leader bleb and bleb (i.e., all blebs) area measurements. Each measurement is a percent of the total cell area. Data for CFL1, actin depolymerizing factor (ADF), and CFL1 + ADF RNAi are provided. These data are graphed in Figure 2B–C.
Video 3.
Time-lapse imaging of a melanoma A375-M2 cell confined down to 3 µm with the volume marker, mScarlet, after control (non-targeting) RNAi.
Video 5.
Time-lapse imaging of a melanoma A375-M2 cell confined down to 3 µm with the volume marker, mScarlet, after RNAi of CFL1 alone.
Video 6.
Time-lapse imaging of a melanoma A375-M2 cell confined down to 3 µm with the volume marker, EGFP, after RNAi of CFL1 + actin depolymerizing factor (ADF).
Together, actin depolymerizing factor (ADF) and cofilin-1 are required to retract blebs.
(A) Montage of non-targeting, CFL1, ADF, and CFL1 + ADF RNAi with EGFP alone (volume marker) in melanoma A375-M2 cells. (B–C) Quantitation of area for leader (A) and all blebs (B) after non-targeting, CFL1, ADF, and ADF + CFL1 RNAi. Statistical significance was determined by one-way ANOVA and a Dunnet’s post hoc test. (D) Percent of non-targeting, CFL1, ADF, and CFL1 + ADF RNAi cells with elongated bleb necks. (E) Percent of ADF + CFL1 RNAi cells from (D) with elongated bleb necks that retract vs. un-retracted. (F–G) Lung adenocarcinomaA549 cells after non-targeting and CFL1 + ADF RNAi stained with a far-red fluorescent membrane dye (F). Percent of non-targeting, CFL1, ADF, and CFL1 + ADF RNAi cells with elongated bleb necks (G). (H) Bleb retraction rates for non-targeting (45 blebs; 26 cells), CFL1 (40 blebs; 20 cells), ADF (48 blebs; 30 cells), and CFL1 + ADF RNAi (38 blebs; 23 cells). Statistical significance was determined by one-way ANOVA and a Dunnet’s post hoc test. (I) EGFP-cofilin-1 localization in an A375-M2 cell confined down to 3 µm. Arrow points to an enrichment of cofilin-1 at the leader bleb neck. (I’) Regional analysis of EGFP-cofilin-1 average fluorescence intensity in ROIs sampled from bleb neck to tip (mean ± SEM). Representative regions taken within white box and dashed lines in (I). All data are representative of at least three independent experiments. *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, and ****p ≤ 0.0001.
Raw leader bleb and bleb area measurements.
Spreadsheet of leader bleb and bleb (i.e., all blebs) area measurements. Each measurement is a percent of the total cell area. Data for CFL1, actin depolymerizing factor (ADF), and CFL1 + ADF RNAi are provided. These data are graphed in Figure 2B–C.
ADF and cofilin-1 rapidly disassemble cortical actin
Thus far, our results suggest that ADF and cofilin-1 are important for the rapid turnover of cortical actin at bleb necks. In agreement with this concept, a large concentration of F-actin is found at the necks of blebs in cells depleted of ADF and cofilin-1 (Figure 3A). In order to more directly test the role of ADF and cofilin-1 in regulating cortical actin, we turned to freshly trypsinized (spherical) cells. Previous work by us and others has shown that the properties of the cortical actin network in spherical cells correlate with LBBM (Logue et al., 2015; Liu et al., 2015; Bergert et al., 2012). In spherical cells, actin is predominantly cortical and endogenous cofilin-1 is diffuse throughout the cytoplasm with some enrichment at the cell periphery (Figure 3B). By combining the specificity of phalloidin for F-actin with flow cytometry, we then determined how the level of cortical actin is affected by ADF and/or cofilin-1 depletion. In cells depleted of cofilin-1, F-actin levels were increased by ~10%, whereas depletion of ADF did not lead to a significant change in the level of F-actin (Figure 3C). Interestingly, depleting ADF with cofilin-1 had the largest effect, increasing F-actin levels by ~30% (Figure 3C). Serine 3 of cofilin-1 is phosphorylated by LIMK, inhibiting its severing activity (Yang et al., 1998). In cells depleted of endogenous ADF and cofilin-1, transfection of EGFP-cofilin-1 reduced the level of F-actin to levels similar to control (non-target; Figure 3D). Similarly, F-actin was restored to near control levels by transfection of EGFP-cofilin-1 (S3A; constitutively active), whereas transfection of EGFP-cofilin-1 (S3E; constitutively inactive) led to an increased level of F-actin (Figure 3D). Additionally, in comparison to EGFP alone, increasing levels of EGFP-cofilin-1 correlated with reductions in F-actin (Figure 3E). Thus, cortical actin levels are regulated by ADF and cofilin-1 severing.
(A) mEmerald-LifeAct and far-red fluorescent membrane dye in cells after non-targeting and CFL1 + ADF RNAi. (B) Cells freshly plated on poly-L-lysine coated cover glass stained for endogenous cofilin-1 and filamentous-actin (F-actin) (phalloidin). (C) F-actin levels (normalized to non-target; mean ± SEM) after CFL1, ADF, and CFL1 + ADF RNAi in trypsinized (spherical) cells, as determined by flow cytometry. Statistical significance was determined by one-way ANOVA and a Dunnet’s post hoc test. (D) F-actin levels (normalized to non-target; mean ± SEM) after CFL1 + ADF RNAi, as well as after CFL1 + ADF RNAi with EGFP-cofilin-1 WT, S3A, or S3E, as determined by flow cytometry. Statistical significance was determined by one-way ANOVA and a Dunnet’s post hoc test. (E) F-actin level (normalized to EGFP alone; mean ± SEM) as a function of increasing EGFP-cofilin-1 in cells depleted of endogenous cofilin-1 and ADF by RNAi, as determined by flow cytometry. Statistical significance was determined by one-way ANOVA and a Dunnet’s post hoc test. (F) Top, barbed end assay workflow. Bottom, representative image of a freshly plated (spherical) cell subjected to the barbed end assay. (G) As shown in (F; bottom), the level of cortical barbed ends was measured in cells after non-targeting (71 cells), CFL1 (53 cells), ADF (47 cells), and CFL1 + ADF RNAi (83 cells). Statistical significance was determined by one-way ANOVA and a Dunnet’s post hoc test. (H) As shown in (F; bottom), the level of cortical barbed ends was measured in cells with non-targeting and EGFP (42 cells), as well as after CFL1 + ADF RNAi with EGFP (32 cells) or EGFP-cofilin-1 (27 cells). Statistical significance was determined by one-way ANOVA and a Dunnet’s post hoc test. All data are representative of at least three independent experiments. *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, and ****p ≤ 0.0001.
(A) Cortical barbed end levels in melanoma A375-M2 cells after vehicle (DMSO; 53 cells) or cytochalasin B (2 µM; 24 cells) treatment. Statistical significance was determined using an unpaired Student’s t-test. All data are representative of at least three independent experiments. *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, and ****p ≤ 0.0001.
(A) mEmerald-LifeAct and far-red fluorescent membrane dye in cells after non-targeting and CFL1 + ADF RNAi. (B) Cells freshly plated on poly-L-lysine coated cover glass stained for endogenous cofilin-1 and filamentous-actin (F-actin) (phalloidin). (C) F-actin levels (normalized to non-target; mean ± SEM) after CFL1, ADF, and CFL1 + ADF RNAi in trypsinized (spherical) cells, as determined by flow cytometry. Statistical significance was determined by one-way ANOVA and a Dunnet’s post hoc test. (D) F-actin levels (normalized to non-target; mean ± SEM) after CFL1 + ADF RNAi, as well as after CFL1 + ADF RNAi with EGFP-cofilin-1 WT, S3A, or S3E, as determined by flow cytometry. Statistical significance was determined by one-way ANOVA and a Dunnet’s post hoc test. (E) F-actin level (normalized to EGFP alone; mean ± SEM) as a function of increasing EGFP-cofilin-1 in cells depleted of endogenous cofilin-1 and ADF by RNAi, as determined by flow cytometry. Statistical significance was determined by one-way ANOVA and a Dunnet’s post hoc test. (F) Top, barbed end assay workflow. Bottom, representative image of a freshly plated (spherical) cell subjected to the barbed end assay. (G) As shown in (F; bottom), the level of cortical barbed ends was measured in cells after non-targeting (71 cells), CFL1 (53 cells), ADF (47 cells), and CFL1 + ADF RNAi (83 cells). Statistical significance was determined by one-way ANOVA and a Dunnet’s post hoc test. (H) As shown in (F; bottom), the level of cortical barbed ends was measured in cells with non-targeting and EGFP (42 cells), as well as after CFL1 + ADF RNAi with EGFP (32 cells) or EGFP-cofilin-1 (27 cells). Statistical significance was determined by one-way ANOVA and a Dunnet’s post hoc test. All data are representative of at least three independent experiments. *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, and ****p ≤ 0.0001.
Cytochalasin B blocks access to cortical barbed ends.
(A) Cortical barbed end levels in melanoma A375-M2 cells after vehicle (DMSO; 53 cells) or cytochalasin B (2 µM; 24 cells) treatment. Statistical significance was determined using an unpaired Student’s t-test. All data are representative of at least three independent experiments. *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, and ****p ≤ 0.0001.Many studies have shown that cofilin-1 severing can result in distinct outcomes. In lamellipodia, cofilin-1 severing promotes actin polymerization at new barbed ends, whereas in the lamella, actin is de-polymerized at new pointed ends (Bravo-Cordero et al., 2013). The prevalence of each outcome has been proposed to depend on the concentration of capping proteins (Wioland et al., 2017). Therefore, we determined the relative level of barbed ends within the cortical actin network of freshly trypsinized (spherical) cells. The treatment of cells with cytochalasin B (which blocks G-actin from binding the barbed end) confirmed the specificity of the approach (Figure 3—figure supplement 1A). In cells depleted of cofilin-1, we observed a more than ~50% increase the level of cortical barbed ends, whereas depleting ADF marginally increased the level of cortical barbed ends (Figure 3G). Depleting cells of both proteins appeared to have an additive effect, increasing the level of cortical barbed ends by ~100% (Figure 3G). However, in cells depleted of ADF and cofilin-1, transfection of EGFP-cofilin-1 was sufficient to restore cortical barbed ends to a level similar to control (Figure 3H). Collectively, these results suggest that ADF and cofilin-1 regulate cortical actin levels by promoting the de-polymerization of actin at newly formed pointed ends.
Figure 3—figure supplement 1.
Cytochalasin B blocks access to cortical barbed ends.
(A) Cortical barbed end levels in melanoma A375-M2 cells after vehicle (DMSO; 53 cells) or cytochalasin B (2 µM; 24 cells) treatment. Statistical significance was determined using an unpaired Student’s t-test. All data are representative of at least three independent experiments. *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, and ****p ≤ 0.0001.
Rapid cortical actin flow requires ADF and cofilin-1 severing at leader bleb necks
Lasting changes in the F/G-actin ratio, such as occurs during RNAi of ADF and/or cofilin-1, can have a range of effects on cellular physiology. Therefore, using a previously described SuperNova-cofilin-1 construct, we performed chromophore assisted light inactivation (CALI) for establishing the direct effects of cofilin-1 depletion (Vitriol et al., 2013; Takemoto et al., 2013). In cells depleted of ADF and cofilin-1, SuperNova-cofilin-1 is predominantly observed at leader bleb necks (Figure 4A). After 1 min of intense red light irradiation, we found that ~50% of SuperNova-cofilin-1 is destroyed, as indicated by a reduction in red fluorescence (Figure 4A). Using LifeAct-mEmerald for monitoring actin dynamics, we observed an accumulation of actin and the elongation of leader bleb necks within minutes of inactivating cofilin-1 (Figure 4B and Video 7). Moreover, after inactivating SuperNova-cofilin-1, cortical actin flow rates in leader blebs were reduced by ~50%, whereas irradiation of SuperNova alone did not change actin flow rates (Figure 4C–D and Figure 4—figure supplement 1A). Thus, as demonstrated by CALI, cofilin-1 directly regulates the cortical actin in leader blebs.
Figure 4.
Rapid cortical actin flow requires actin depolymerizing factor (ADF) and cofilin-1 severing at leader bleb necks.
(A) Left, SuperNova-cofilin-1 localization in cells depleted of endogenous cofilin-1 and ADF by RNAi before and after 1 min of red light irradiation. Right, quantitative analysis of CALI, as determined by the fold change in SuperNova emission. (B) Montage of mEmerald-LifeAct before and after cofilin-1 inactivation in a cell depleted of endogenous cofilin-1 and ADF by RNAi. (C) Kymographs of cortical actin (mEmerald-LifeAct) flow from the leader bleb tip before and after cofilin-1 inactivation. (D) Quantitative evaluation of cortical actin flow rates before and after cofilin-1 inactivation. Statistical significance was determined by a paired Student’s t-test. (E) Left, representative image of a freshly plated (spherical) cells with mEos3.2-LifeAct. Right, montage of mEos3.2-LifeAct within the shown ROI before and after photoactivation. (F) Average decay curve for mEos3.2-LifeAct at bleb necks (normalized to the initial fluorescence level; F/F0). The curve was fit using a non-linear single phase decay function. (G) t1/2 for mEos3.2-LifeAct after photoactivation at bleb necks for non-targeting, CFL1, ADF, and CFL1 + ADF RNAi. Statistical significance was determined by one-way ANOVA and a Dunnet’s post hoc test. All data are representative of at least three independent experiments. *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, and ****p ≤ 0.0001.
(A) Cortical actin (mEmerald-LifeAct) flow rates before and after the inactivation (i.e., red light irradiation) of SuperNova alone. (B) Left, sample ROI from a paraformaldehyde (PFA) treated melanoma A375-M2 cell with mEos3.2-LifeAct. Right, average mEos3.2-LifeAct decay (three cells; mean ± SEM) after photoactivation. All data are representative of at least three independent experiments.
Video 7.
Time-lapse imaging of a melanoma A375-M2 cell confined down to 3 µm with mEmerald-LifeAct after chromophore assisted light inactivation (CALI) of SuperNova-cofilin-1.
The cell was depleted of endogenous actin depolymerizing factor (ADF) and cofilin-1 by RNAi.
Figure 4—figure supplement 1.
Actin turnover measurement controls.
(A) Cortical actin (mEmerald-LifeAct) flow rates before and after the inactivation (i.e., red light irradiation) of SuperNova alone. (B) Left, sample ROI from a paraformaldehyde (PFA) treated melanoma A375-M2 cell with mEos3.2-LifeAct. Right, average mEos3.2-LifeAct decay (three cells; mean ± SEM) after photoactivation. All data are representative of at least three independent experiments.
Rapid cortical actin flow requires actin depolymerizing factor (ADF) and cofilin-1 severing at leader bleb necks.
(A) Left, SuperNova-cofilin-1 localization in cells depleted of endogenous cofilin-1 and ADF by RNAi before and after 1 min of red light irradiation. Right, quantitative analysis of CALI, as determined by the fold change in SuperNova emission. (B) Montage of mEmerald-LifeAct before and after cofilin-1 inactivation in a cell depleted of endogenous cofilin-1 and ADF by RNAi. (C) Kymographs of cortical actin (mEmerald-LifeAct) flow from the leader bleb tip before and after cofilin-1 inactivation. (D) Quantitative evaluation of cortical actin flow rates before and after cofilin-1 inactivation. Statistical significance was determined by a paired Student’s t-test. (E) Left, representative image of a freshly plated (spherical) cells with mEos3.2-LifeAct. Right, montage of mEos3.2-LifeAct within the shown ROI before and after photoactivation. (F) Average decay curve for mEos3.2-LifeAct at bleb necks (normalized to the initial fluorescence level; F/F0). The curve was fit using a non-linear single phase decay function. (G) t1/2 for mEos3.2-LifeAct after photoactivation at bleb necks for non-targeting, CFL1, ADF, and CFL1 + ADF RNAi. Statistical significance was determined by one-way ANOVA and a Dunnet’s post hoc test. All data are representative of at least three independent experiments. *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, and ****p ≤ 0.0001.
Actin turnover measurement controls.
(A) Cortical actin (mEmerald-LifeAct) flow rates before and after the inactivation (i.e., red light irradiation) of SuperNova alone. (B) Left, sample ROI from a paraformaldehyde (PFA) treated melanoma A375-M2 cell with mEos3.2-LifeAct. Right, average mEos3.2-LifeAct decay (three cells; mean ± SEM) after photoactivation. All data are representative of at least three independent experiments.
Time-lapse imaging of a melanoma A375-M2 cell confined down to 3 µm with mEmerald-LifeAct after chromophore assisted light inactivation (CALI) of SuperNova-cofilin-1.
The cell was depleted of endogenous actin depolymerizing factor (ADF) and cofilin-1 by RNAi.We then determined rates of actin turnover at leader bleb necks. For this, we used a version of LifeAct tagged with the photoactivable (green/red) fluorescent protein, mEos, for performing fluorescence loss after photoactivation assays. Using a 405 nm laser, a pool of mEos-LifeAct was photoactivated at leader bleb necks. Subsequently, fluorescence decay at leader bleb necks was measured and used for determining rates of actin turnover (Figure 4E). However, as our measurements will be a composite of the actin turnover rate and the binding kinetics of LifeAct, these data should be strictly viewed as apparent rates of actin turnover. To demonstrate proof of concept, curves were fit with a single phase decay, yielding an R-squared value of 0.8348 (Figure 4F). In contrast, a rapid decline in red fluorescence was not observed in paraformaldehyde treated cells (Figure 4—figure supplement 1B). In control (non-target) cells, we found the actin at leader bleb necks to be rapidly turned over (t1/2; Figure 4G). While the rate of actin turnover in cells depleted of cofilin-1 or ADF alone was similar to control (non-target), depleting both ADF and cofilin-1 led to a significant decrease in the actin turnover rate (t1/2; Figure 4G). These data suggest that ADF and cofilin-1, together, are critical for the rapid turnover of cortical actin at leader bleb necks.
Cofilin-1 supports both actin turnover and myosin contractility at leader bleb necks
Because the cortical actin flow in leader blebs is driven by myosin, we wondered if ADF and/or cofilin-1 are important for cortical contractility. To address this possibility, we determined the compressibility of cells using a previously described gel sandwich approach (Liu et al., 2015). Briefly, freshly trypsinized (spherical) cells are placed between two polyacrylamide gels of known stiffness (1 kPa). Subsequently, the ratio of the cell height (h) to the diameter (d) is used to determine compressibility (Figure 5A). After depleting cofilin-1, we found cells to be significantly more compressible, whereas depleting ADF had no effect (Figure 5A). Moreover, in cofilin-1 depleted cells, the depletion of ADF did not have any additional effect on cell compressibility (Figure 5A). Reconstituting ADF and cofilin-1 RNAi cells with RFP-cofilin-1 rescued cell compressibility to levels similar to control, whereas RFP-ADF was unable to rescue compressibility (Figure 5B–C). Therefore, cofilin-1 may be particularly important for contractility. In support of this idea, cofilin-1 has been shown to modulate contractility through a variety of mechanisms, which involve changes in both actin turnover and network architecture (Chan et al., 2009; Chugh et al., 2017; Ennomani et al., 2016). As determined by immunofluorescence imaging of phosphorylated regulatory light chain (pRLC), we could confirm that signaling to myosin was not significantly affected by depleting ADF and/or cofilin-1 (Figure 5D–E). In confined cells, depleting ADF and cofilin-1 leads to the elongation of leader bleb necks, which are decorated with myosin (EGFP-RLC; Figure 5F). We then used CALI to determine if the accumulation of myosin at leader blebs necks is directly caused by the removal of these proteins. Indeed, within minutes of SuperNova-cofilin-1 inactivation, we observed myosin accumulating at leader bleb necks (EGFP-RLC; Figure 5G and Video 8). Additionally, the flow of myosin toward leader bleb necks was significantly impeded after cofilin-1 inactivation, as determined by tracking individual myosin minifilaments (Figure 5H). While ADF may be particularly important for actin turnover, these results point to cofilin-1 as having important roles in both actin turnover and myosin contractility at leader bleb necks.
Figure 5.
Cofilin-1 supports both actin turnover and myosin contractility at leader bleb necks.
(A) A previously described gel sandwich assay was used to measure the stiffness (h/d) of spherical cells after non-targeting (91 cells), CFL1 (30 cells), actin depolymerizing factor (ADF) (25 cells), and CFL1 + ADF RNAi (42 cells). (B) Cell stiffness (h/d) of spherical cells with non-targeting (181 cells) or siCFL1 + siADF RNAi rescued with RFP-cofilin-1 (41 cells) or RFP-ADF (74 cells). (A–B) Statistical significance was determined by one-way ANOVA and a Dunnet’s post hoc test. (C) Cofilin-1 (left) and ADF (right) levels (fluorescence intensity; fold change) of adhered RNAi cells by immunofluorescence confirming rescue by transfection with RFP-cofilin-1 (left) or RFP-ADF (right). Statistical significance was determined by an unpaired one-sample t-test. (D) Immunofluorescence imaging of endogenous phosphorylated regulatory light chain (pRLC) (S18), total RLC, and filamentous-actin (F-actin) (phalloidin) in freshly plated (spherical) cells after non-targeting, CFL1, and CFL1 + ADF RNAi. (E) Ratio of cortical pRLC (S18) to total RLC fluorescence intensity after non-targeting (114 cells), CFL1 (107 cells), ADF (124 cells), and CFL1 + ADF RNAi (91 cells). Statistical significance was determined by one-way ANOVA and a Dunnet’s post hoc test. (F) Localization of EGFP tagged regulatory light chain (EGFP-RLC) in a cell confined down to 3 µm after CFL1 + ADF RNAi. (G) EGFP-RLC dynamics in a cell depleted of cofilin-1 and ADF before and after chromophore assisted light inactivation (CALI) of SuperNova-cofilin-1. Arrow points to myosin accumulating at an elongating leader bleb neck after cofilin-1 inactivation. (H) Myosin minifilament flow rate before and after cofilin-1 inactivation. Statistical significance was determined using a paired Student’s t-test. All data are representative of at least three independent experiments. *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, and ****p ≤ 0.0001.
Spreadsheet of stiffness (h/d) measurements for CFL1, actin depolymerizing factor (ADF), CFL1 + ADF RNAi, as well as CFL1 + ADF RNAi cells rescued by transfection with RFP-cofilin-1 or RFP-ADF plasmid are provided. These data are graphed in Figure 5A–B.
Video 8.
Time-lapse imaging of a melanoma A375-M2 cell confined down to 3 µm with EGFP tagged regulatory light chain (EGFP-RLC) after chromophore assisted light inactivation (CALI) of SuperNova-cofilin-1.
The cell was depleted of endogenous actin depolymerizing factor (ADF) and cofilin-1 by RNAi.
Cofilin-1 supports both actin turnover and myosin contractility at leader bleb necks.
(A) A previously described gel sandwich assay was used to measure the stiffness (h/d) of spherical cells after non-targeting (91 cells), CFL1 (30 cells), actin depolymerizing factor (ADF) (25 cells), and CFL1 + ADF RNAi (42 cells). (B) Cell stiffness (h/d) of spherical cells with non-targeting (181 cells) or siCFL1 + siADF RNAi rescued with RFP-cofilin-1 (41 cells) or RFP-ADF (74 cells). (A–B) Statistical significance was determined by one-way ANOVA and a Dunnet’s post hoc test. (C) Cofilin-1 (left) and ADF (right) levels (fluorescence intensity; fold change) of adhered RNAi cells by immunofluorescence confirming rescue by transfection with RFP-cofilin-1 (left) or RFP-ADF (right). Statistical significance was determined by an unpaired one-sample t-test. (D) Immunofluorescence imaging of endogenous phosphorylated regulatory light chain (pRLC) (S18), total RLC, and filamentous-actin (F-actin) (phalloidin) in freshly plated (spherical) cells after non-targeting, CFL1, and CFL1 + ADF RNAi. (E) Ratio of cortical pRLC (S18) to total RLC fluorescence intensity after non-targeting (114 cells), CFL1 (107 cells), ADF (124 cells), and CFL1 + ADF RNAi (91 cells). Statistical significance was determined by one-way ANOVA and a Dunnet’s post hoc test. (F) Localization of EGFP tagged regulatory light chain (EGFP-RLC) in a cell confined down to 3 µm after CFL1 + ADF RNAi. (G) EGFP-RLC dynamics in a cell depleted of cofilin-1 and ADF before and after chromophore assisted light inactivation (CALI) of SuperNova-cofilin-1. Arrow points to myosin accumulating at an elongating leader bleb neck after cofilin-1 inactivation. (H) Myosin minifilament flow rate before and after cofilin-1 inactivation. Statistical significance was determined using a paired Student’s t-test. All data are representative of at least three independent experiments. *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, and ****p ≤ 0.0001.
Raw stiffness measurements.
Spreadsheet of stiffness (h/d) measurements for CFL1, actin depolymerizing factor (ADF), CFL1 + ADF RNAi, as well as CFL1 + ADF RNAi cells rescued by transfection with RFP-cofilin-1 or RFP-ADF plasmid are provided. These data are graphed in Figure 5A–B.
Time-lapse imaging of a melanoma A375-M2 cell confined down to 3 µm with EGFP tagged regulatory light chain (EGFP-RLC) after chromophore assisted light inactivation (CALI) of SuperNova-cofilin-1.
The cell was depleted of endogenous actin depolymerizing factor (ADF) and cofilin-1 by RNAi.
Discussion
Here, we identify ADF and cofilin-1 as key mediators of the rapid (cortical) actin flow in leader blebs. This is significant as the rapid flow of cortical actin in leader blebs is essential for confined migration (Liu et al., 2015; Ruprecht et al., 2015; Bergert et al., 2015). We report that melanoma cells depleted of cofilin-1 poorly undergo LBBM, whereas removing ADF did not have a significant effect. Because ADF and cofilin-1 are thought to have redundant or overlapping roles, we were surprised to then find that depleting cofilin-1 together with ADF led to a near complete inhibition of LBBM. Therefore, we set out to determine the basis for this effect in cancer cells.Initially, we used high spatial and temporal resolution imaging for close inspection of RNAi cells. Cells lacking cofilin-1 alone had much smaller blebs. Without both cofilin-1 and ADF, many cells had blebs with elongated necks that would not retract. A similar elongated neck phenotype was observed by Wiggan et al., whereas they reported an increase in the frequency of HeLa cells with blebs after cofilin-1 RNAi (Wiggan et al., 2012). While these authors contend that cofilin-1 inhibits contractility by competing with myosin for F-actin binding, our results are in line with work showing that cofilin-1 increases contractility through optimizing actin filament lengths and de-branching (Chan et al., 2009; Chugh et al., 2017; Ennomani et al., 2016). This led us to wonder if ADF and/or cofilin-1 may be important for actin turnover at bleb necks. In agreement with this concept, in cells lacking endogenous cofilin-1 and ADF, EGFP-cofilin-1 was enriched at bleb necks.In confined cells, we observed a dramatic accumulation of actin at bleb necks. In order to better understand how ADF and cofilin-1 regulate the overall level of cortical actin, we utilized spherical cells which predominantly have cortical actin. Using flow cytometry, we found that depleting cells of cofilin-1 could significantly increase the overall level of actin. Although ADF on its own had no effect, depleting cofilin-1 with ADF increased the overall level of actin even further, which might suggest that ADF augments the severing activity of cofilin-1. Similarly, the level of cortical barbed ends was significantly increased in the absence of cofilin-1, whereas removing ADF marginally increased the level of cortical barbed ends. Depleting both cofilin-1 and ADF appeared to have an additive effect, leading to the largest increase in the level of uncapped (polymerization competent) barbed ends. This result suggests that cofilin-1 severing, in collaboration with ADF, leads to the rapid disassembly of cortical actin and not polymerization at new barbed ends.Because changes in the cellular F/G-actin ratio can trigger specific transcriptional programs, such as through the activation of the transcription factor, MRTF-A, we wanted to determine if the effects we observed on LBBM are a direct result of down-regulating actin severing (Olson and Nordheim, 2010). For this, we utilized CALI for the rapid inactivation of SuperNova-cofilin-1. In cells depleted of ADF and cofilin-1, SuperNova-coflin-1 was sufficient to restore normal bleb morphology and dynamics. However, within minutes of cofilin-1 inactivation, actin began to accumulate at elongated bleb necks. By kymograph analysis, we also observed a significant decrease in the cortical actin flow rate. Using a photoactivatable LifeAct construct, we then directly measured the rate of actin turnover (i.e., fluorescence decay) at bleb necks. While depleting ADF or cofilin-1 alone did not have a significant effect on actin turnover rates, depleting both proteins led to a large increase in the rate of actin turnover at bleb necks. Thus, in cells lacking ADF and cofilin-1, defects in bleb morphology and dynamics correlate with a reduction in actin turnover at the neck.Cofilin-1 has been previously implicated in regulating actomyosin contractility. Therefore, using spherical cells, we determined the overall effect of ADF and cofilin-1 on cortical contractility. As indicated by increased compressibility, cells were found to be less stiff after depleting cofilin-1. In contrast, removing ADF had little effect on cell stiffness. Moreover, depleting both ADF and cofilin-1 was similar to removing cofilin-1 alone and could be rescued by an RNAi resistant version of cofilin-1 but not ADF. Therefore, cofilin-1 may be particularly important to support actomyosin contractility. In line with this notion, cofilin-1 has been shown to support myosin contractility through optimizing actin filament lengths and de-branching (Chan et al., 2009; Chugh et al., 2017; Ennomani et al., 2016). As indicated by the lack of any change in pRLC levels or localization, removing these proteins does not appear to effect signaling to myosin. The role of cofilin-1 in supporting myosin contractility is further supported by CALI. More specifically, we demonstrate that inactivating cofilin-1 decreases the rate at which myosin minifilaments flow toward the bleb neck.Thus, our data are consistent with a model whereby ADF and cofilin-1 play key roles during LBBM. More specifically, we assert that ADF and cofilin-1, together, optimize actin disassembly and myosin contractility at bleb necks (Figure 6, top). Whereas, in the absence of these proteins, incoming cortical actin fails to disassemble and accumulates with myosin at the elongated necks of persistent blebs (Figure 6, below). Collectively, this study further points to rapid (cortical) actin flows as being essential for confined (leader bleb-based) migration. This is significant as many cancer cells have been shown to undergo LBBM (Logue et al., 2015; Liu et al., 2015).
Figure 6.
Model of actin depolymerizing factor (ADF) and cofilin-1 function within leader blebs.
Top, in the presence of both ADF and cofilin-1, cells display large blebs with rapid cortical actin flow. Below, in the absence of cofilin-1 or ADF, cells form smaller blebs with slower cortical actin flow. Bottom, without both ADF and cofilin-1, blebs display several defects, including a failure to retract and an accumulation of actomyosin at elongated necks.
Model of actin depolymerizing factor (ADF) and cofilin-1 function within leader blebs.
Top, in the presence of both ADF and cofilin-1, cells display large blebs with rapid cortical actin flow. Below, in the absence of cofilin-1 or ADF, cells form smaller blebs with slower cortical actin flow. Bottom, without both ADF and cofilin-1, blebs display several defects, including a failure to retract and an accumulation of actomyosin at elongated necks.This work also reveals an unanticipated role for ADF. In melanoma cells, ADF appears to augment the activity of cofilin-1 at bleb necks. Largely, ADF and cofilin-1 are thought to have redundant or overlapping roles (Hotulainen et al., 2005). However, ADF has been shown to have significant monomer sequestering activity (Chen et al., 2004). We speculate that, in the absence of both proteins, dampened actin severing coupled with uncontrolled filament elongation contributes to the severe phenotypes we observe. Thus, the dissemination of melanoma tumors is likely to be blocked by the simultaneous inhibition of ADF and cofilin-1. As actin severing by ADF and cofilin-1 can be regulated by a number of functional interactions, such as with Aip1 and cyclase-associated protein 1, future work will endeavor to determine the contribution of these factors in regulating the cortical actomyosin flow in fast amoeboid cells (Bertling et al., 2004; Nadkarni and Brieher, 2014; Chen et al., 2015; Shekhar et al., 2019; Kotila et al., 2019).
Materials and methods
Cell culture
A375-M2 (CRL-3223) and A549 (CCL-185) were obtained from the American Type Culture Collection (ATCC; Manassas, VA). Cells were cultured in high-glucoseDMEM supplemented with 10% FBS (cat no. 12106C; Sigma Aldrich, St. Louis, MO), GlutaMAX (Thermo Fisher, Carlsbad, CA), antibiotic-antimycotic (Thermo Fisher), and 20 mM HEPES at pH 7.4 for up to 30 passages. Cells were tested, and negative, for mycoplasma using MycoAlert PLUS Mycoplasma Detection Kit (Lonza, Walkersville, MD).
Confinement
This protocol has been described in detail elsewhere (Logue et al., 2018). Briefly, PDMS (cat no. 24236–10; Dow Corning 184 SYLGARD) was purchased from Krayden (Westminster, CO); 2 mL was cured overnight at 37°C in each well of a six-well glass bottom plate (cat no. P06-1.5H-N; Cellvis, Mountain View, CA). Using a biopsy punch (cat no. 504535; World Precision Instruments, Sarasota, FL), an 8 mm hole was cut and 3 mL of serum-free media containing 1% BSA was added to each well and incubated overnight at 37°C. After removing the serum-free media containing 1% BSA, 300 µL of complete media containing trypsinized cells (250,000 to 1 million) and 2 µL of 3.11 µm beads (cat no. PS05002; Bangs Laboratories, Fishers, IN) were then pipetted into the round opening. The vacuum created by briefly lifting one side of the hole with a 1 mL pipette tip was used to move cells and beads underneath the PDMS. Finally, 3 mL of complete media was added to each well and cells were recovered for ~60 min before imaging.
Plasmids
SuperNova-cofilin-1 was a gift from Dr Kazuyo Sakai (Osaka University, Osaka, Japan). EGFP-cofilin-1 WT (no. 50859; a gift from Dr James Bamburg), S3A (no. 50854; a gift from Dr. James Bamburg), S3E (no. 50855; a gift from Dr James Bamburg), and mEos3.2-LifeAct (no. 54696; a gift from Michael Davidson) were obtained from Addgene (Watertown, MA). RFP-cofilin-1 and RFP-ADF were a gift from Dr James Bamburg (Colorado State University); 1 µg of plasmid was used to transfect 400,000 cells in each well of a six-well plate using Lipofectamine 2000 (5 µL; Thermo Fisher) in OptiMEM (400 µL; Thermo Fisher). After 20 min at room temperature, plasmid in Lipofectamine 2000/OptiMEM was then incubated with cells in complete media (2 mL) overnight.
Pharmacological treatments
Latrunculin-A (cat no. 3973) and cytochalasin B (cat no. 5474) were purchased from Tocris Bioscience (Bristol, UK). DMSO (Sigma Aldrich) was used to make 5 and 2 mM stock solutions of Latrunculin-A and cytochalasin B, respectively. To disassemble actin, cells resuspended in flow buffer were treated with 5 µM Latrunculin-A for 10 min at room temperature before flow cytometry. For barbed end assays, cytochalasin B was pre-diluted in complete media before it was incubated with cells for 1 hr at 37°C.
Locked nucleic acids
Non-targeting (cat no. 4390844), cofilin-1 (cat no. 4392420; s2936), and ADF (cat no. 4392422; s21737) locked nucleic acids (LNAs) were purchased from Thermo Fisher. All LNA transfections were performed using RNAiMAX (5 µL; Thermo Fisher) and OptiMEM (400 µL; Thermo Fisher); 100,000 cells were trypsinized and seeded in six-well plates in complete media. After cells adhered (~1 hr), LNAs in RNAiMAX/OptiMEM were added to cells in complete media (2 mL) at a final concentration of 50 nM. Cells were incubated with LNAs for 2 days.
Western blotting
Whole-cell lysates were prepared by scraping cells into ice-cold RIPA buffer (50 mM HEPES pH 7.4, 150 mM NaCl, 5 mM EDTA, 0.1% SDS, 0.5% deoxycholate, and 1% Triton X-100) containing protease and phosphatase inhibitors (Roche, Switzerland). Before loading onto 4–12% NuPAGE Bis-Tris gradient gels (Thermo Fisher), DNA was sheared by sonication and samples were boiled for 10 min in loading buffer. Following SDS-PAGE, proteins in gels were transferred to nitrocellulose membranes and subsequently immobilized by air drying overnight. After blocking in Tris-buffered saline containing 0.1% Tween 20 and 1% BSA, primary antibodies against cofilin-1 (cat no. MA5-17275; Thermo Fisher) and ADF (cat no. MA5-25485; Thermo Fisher and cat no. D8818; Sigma Aldrich) were incubated with membranes overnight at 4°C. Bands were then resolved with IRDye conjugated secondary antibodies on an Odyssey scanner from LI-COR Biosciences, Lincoln, NE. GAPDH (cat no. 97166; Cell Signaling Technology, Danvers, MA) was used to confirm equal loading.
qRT-PCR
Total RNA was isolated from cells using the PureLink RNA Mini Kit (Thermo Fisher) and was used for reverse transcription using a high-capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA). cDNA was used for qRT-PCR using PowerUp SYBR Green Master Mix (Thermo Fisher) and primers, humanCFL1: GCAACCTATGAGACCAAGGAGAG (forward sequence), humanADF: GCACCAGAACTAGCACCTCTGA (forward sequence), and humanGAPDH: GTCTCCTCTGACTTCAACAGCG (forward sequence), on a CFX96 real-time PCR detection system (Bio-Rad). Relative mRNA levels were calculated by the ΔCt method.
Transmigration
Transmigration assays were performed using polycarbonate filters with 8 or 12 µm pores (Corning; Corning, NY). Prior to the assays, cells were serum-starved for 24 hr and polycarbonate filters were fibronectin (10 µg/mL; Millipore, Burlington, MA) coated for 1 hr followed by air drying; 100,000 cells in serum-free media were seeded in the top chamber while the bottom chamber contained media with 20% FBS to attract cells. After 24 hr, cells from the bottom of the filter were trypsinized and counted using an automated cell counter (TC20; Bio-Rad, Hercules, CA). Transmigration was then calculated as the ratio of cells on the bottom of the filter vs. the total.
Flow cytometry
Roughly 1 × 106 trypsinized cells in flow buffer (HBS with 1% BSA) were fixed using 4% paraformaldehyde (cat no. 15710; Electron Microscopy Sciences, Hatfield, PA) for 20 min at room temperature. After washing, cell pellets were resuspended in flow buffer and incubated with 0.1% Triton X-100, Alexa Fluor 647-conjugated phalloidin (cat no. A22287; Thermo Fisher), and DAPI (Sigma Aldrich) for 30 min at room temperature. Data were acquired on a FACSCalibur (BD Biosciences, Franklin Lakes, NJ) flow cytometer. Flow cytometric analysis was performed using FlowJo (Ashland, OR) software.
Barbed end assay
The protocol for the barbed end assay was used with minor modifications (Vitriol et al., 2007; Symons and Mitchison, 1991). Prior to barbed end assays, cells were trypsinized and plated on poly-L-lysine coated six-well glass bottom plates (Cellvis). To allow for a minimal level of cell attachment, cells were incubated for 10 min in a tissue culture incubator. Cells were then gently permeabilized for 1 min with saponin buffer (138 mM KCl, 4 mM MgCl2, 3 mM EGTA, 0.1% saponin, 1 mM ATP, 3 µM phalloidin, and 1% BSA) followed by one wash with saponin-free buffer. Permeabilized cells were then incubated with Alexa Fluor 568-conjugated G-actin from rabbit muscle (cat no. A12374; Thermo Fisher) for 3 min in a tissue culture incubator and washed with saponin-free buffer. Treated cells were then fixed with 4% paraformaldehyde in HEPES-buffered saline (HBS), washed with HBS alone, and immediately imaged.
Immunofluorescence
After washing with HBS, cells in six-well glass bottom plates (Cellvis) were fixed with 4% paraformaldehyde (Electron Microscopy Sciences) in HBS for 20 min at room temperature. Blocking, permeabilization, antibody incubation, and washing were done in HBS with 1% BSA, 1% fish gelatin, 0.1% Triton X-100, and 5 mM EDTA. A 1:250 dilution of ADF (cat no. MA5-25485; Thermo Fisher), cofilin-1 (cat no. MA5-17275; Thermo Fisher), pRLC (cat no. PA5-17727 or MA5-15163; Thermo Fisher), or RLC (cat no. PA5-17624; Thermo Fisher) antibody was incubated with cells overnight at 4°C. After extensive washing, a 1:400 dilution of Alexa Fluor 488-conjugated anti-rabbit secondary antibody (cat no. A-21206; Thermo Fisher) was then incubated with cells for 2 hr at room temperature. Cells were then incubated with a 1:250 dilution of Alexa Fluor 568-conjugated phalloidin (cat no. A12380; Thermo Fisher) and a 1:1000 dilution of DAPI (cat no. D1306; Thermo Fisher). Cells were again extensively washed and then imaged in HBS. Fluorescence intensity of cofilin-1 or ADF was measured in adhered cells with either EGFP-cofilin-1, RFP-cofilin-1, RFP-ADF, or an empty vector fluorescent protein. A minimum of 26 cells over three independent experiments were averaged and normalized to the control in each experimental n-value.
Cell stiffness assay
The protocol for the gel sandwich assay was used with minor modifications (Liu et al., 2015). Six-well glass bottom plates (Cellvis) and 18 mm coverslips were activated using 3-aminopropyltrimethoxysilane (Sigma Aldrich) for 5 min and then for 30 min with 0.5% glutaraldehyde (Electron Microscopy Sciences) in PBS; 1 kPa polyacrylamide gels were made using 2 µL of blue fluorescent beads (200 nm; Thermo Fisher), 18.8 µL of 40% acrylamide solution (cat no. 161–0140; Bio-Rad), and 12.5 µL of bis-acrylamide (cat no. 161–0142; Bio-Rad) in 250 µL of PBS. Finally, 2.5 µL of ammonium persulfate (10% in water) and 0.5 µL of tetramethylethylenediamine was added before spreading 9 µL drops onto treated glass under coverslips. After polymerizing for 40 min, the coverslip was lifted in PBS, extensively rinsed and incubated overnight in PBS. Before each experiment, the gel attached to the coverslip was placed on a 14 mm diameter, 2 cm high PDMS column for applying a slight pressure to the coverslip with its own weight. Then, both gels were incubated for 30 min in media before plates were seeded. After the bottom gels in plates was placed on the microscope stage, the PDMS column with the top gel was placed on top of the cells seeded on the bottom gels, confining cells between the two gels. After 1 hr of adaptation, the height of cells was determined with beads by measuring the distance between gels, whereas the cell diameter was measured using a far-red PM dye (cat no. C10046; Thermo Fisher). Stiffness was defined as the height (h) divided by the diameter (d).
Microscopy
Live high-resolution imaging was performed using a General Electric (Boston, MA) DeltaVision Elite imaging system mounted on an Olympus (Japan) IX71 stand with a computerized stage, environment chamber (heat, CO2, and humidifier), ultrafast solid-state illumination with excitation/emission filter sets for DAPI, CFP, GFP, YFP, and Cy5, critical illumination, Olympus PlanApo N 60X/1.42 NA DIC (oil) objective, Photometrics (Tucson, AZ) CoolSNAP HQ2 camera, proprietary constrained iterative deconvolution, and vibration isolation table.
Chromophore assisted light inactivation
Live confined cells co-transfected with SuperNova-cofilin-1 and either mEmerald-LifeAct or EGFP-RLC were imaged every 12 s for 5 min before CALI. Cells were then subjected to 1 min of high intensity red light irradiation (DeltaVision Elite). Images were subsequently acquired every 12 s for 1 hr post-irradiation.
Actomyosin flow rates
Actin and myosin minifilament flow rates were calculated from images taken every 12 s of mEmerald-LifeAct and EGFP-RLC, respectively. Kymographs of each were generated in Fiji (https://imagej.net/Fiji) and spanned the length of leader blebs.
Fluorescence loss after photobleaching
Cells transiently transfected with the photoactivatable construct, mEos3.2-LifeAct, were imaged using a Zeiss (Germany) laser scanning confocal microscope (LSM880) with fast Airy Scan. Regions at bleb necks were photo-converted using the 405 nm laser at 20% power (three iterations). Regions were sampled every 15 ms for 10 and 150 cycles before and after photo-conversion, respectively. Fluorescence measurements were acquired using ZEN software (Zeiss) and decay was calculated as F/F0. Non-linear one-phase decay curves were fit to data using Prism (GraphPad, San Diego, CA).
Cell migration
To perform cell speed, plot of origin, and direction autocorrelation analyses, we used an Excel (Microsoft, Redmond, WA) plugin, DiPer, developed by Gorelik and colleagues and the Fiji plugin, MTrackJ, developed by Erik Meijering for manual tracking (Gorelik and Gautreau, 2014; Meijering et al., 2012). For minimizing positional error, cells were tracked every other frame. Brightfield imaging was used to confirm that beads were not obstructing the path of a cell. Cells that traveled a distance equivalent to at least one cell length over the course of the 5 hr time-lapse were classified as highly motile.
Bleb morphology and dynamics
For leader bleb and total bleb areas, freshly confined cells were traced from high-resolution images with the free-hand circle tool in Fiji (https://imagej.net/Fiji). From every other frame, the percentage of cell area for leader blebs and percentage of cell area for total blebs were calculated in Excel (Microsoft). Frame-by-frame measurements were then used to generate an average for each cell. Bleb retraction rates were determined by dividing the bleb length by the amount of time taken to completely retract the bleb into the cell body. For each cell, retraction rates were calculated from two to three blebs.
Cofilin-1 enrichment
For regional analyses of EGFP-cofilin-1 distribution, 10 ROIs each representing 10% of the length of the leader bleb were drawn using Fiji (https://imagej.net/Fiji). Mean gray values of each ROI were normalized to the first ROI taken at the bleb neck.
Statistics
All box plots are Tukey in which ‘+’ and line denote the mean and median, respectively. Sample sizes were determined empirically and based on saturation. As noted in each figure legend, statistical significance was determined by either a two-tailed Student’s t-test or multiple-comparison test post hoc. Normality was determined by a D’Agostino and Pearson test in Prism (GraphPad). *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, and ****p ≤ 0.0001.
Illustration
The model for ADF and cofilin-1 function was drawn in BioRender (Toronto, ON).In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.[Editors' note: this paper was reviewed by Review Commons.]Acceptance summary:Your work clarifies the contribution of two isoforms of the ADF/cofilin family of proteins for bleb-based migration. It also highlights beautifully one more time how crucial the precise control of actin turnover is for many actin-based cellular processes.Decision letter after peer review:Thank you for submitting your article "ADF and cofilin-1 collaborate to promote cortical actin flow and the leader bleb-based migration of confined cells" for consideration by eLife. Your article has been reviewed by 2 peer reviewers at Review Commons and 1 peer reviewer at eLife, and the evaluation at eLife has been overseen by a Reviewing Editor and Anna Akhmanova as the Senior Editor.Based on your manuscript, the reviews and your responses, we invite you to submit a revised version incorporating the revisions as outlined in your response to the reviews. Please note that all reviewers found several issues with consistency between data presented and written statements about the same data. Of course this can always happen in a manuscript, but please make sure in the revised manuscript that the data presented clearly supports your written statements and conclusions.In addition, we invite you to consider these few additional comments from eLife.1. A first concern is the absence of reference to important previous papers. Particularly, the work of Wiggins et al. in Dev. Cell 10.1016/j.devcel.2011.12.026 already reports aberrant bleb morphologies and actin accumulation under cofilin depletion in HeLa cells. Please cite this paper and modify the introduction to highlight the novelties of your study compared to previous works.2. Another concern is about the Lifeact/photoconversion experiments, which should be interpreted with caution. Such experiments usually report more Lifeact's binding/unbinding dynamics than F-actin's turnover itself, and the very rapid (second-timescale) lifetime measured in these experiments is coherent with this possibility.We appreciate that a significant difference is measured in the double siRNA condition, suggesting that both effects (actin turnover and Lifeact dynamics) may contribute in those experiments. Please discuss this point.3. In the introduction, description of the biochemical effects of cofilin should go beyond citing one recent publication (Wioland et al.). For complete description, you should also mention the fact that cofilin's activity is highly dependent on its concentration, promoting severing at low concentration but stabilizing on the contrary actin filaments at high concentration (see papers from the Pollard, Blanchoin and De La Cruz labs). You should also mention the fact that cofilin is unlikely to function alone in cells, but together with catalyzing factors such as Aip1 or CAP (see for examples papers from the Michelot, Goode, Brieher and Lappalainen labs). Please discuss whether this complex behavior could change the interpretation of your results or not.4. Following the previous comment, whether ADF and cofilin1 have overlapping functions or not (please consider citing also Hotulainen et al. Mol Biol Cell 2005) is complicated by the strong dependence of cofilin concentration on its activity. For some results (mainly in Figure 5), it is difficult to conclude whether ADF and cofilin1 have indeed different functions, or whether this is just a concentration effect.Therefore, I would suggest 2 things. Would there be a way to compare the expression level of cofilin 1 and ADF1, so that one could evaluate properly the total level of expression of cofilin1 + ADF in each experiment. Then, could you try a rescue experiment, by expressing ADF in siCFL1 cells?Based on your manuscript, the reviews and your responses, we invite you to submit a revised version incorporating the revisions as outlined in your response to the reviews. Please note that all reviewers found several issues with consistency between data presented and written statements about the same data. Of course this can always happen in a manuscript, but please make sure in the revised manuscript that the data presented clearly supports your written statements and conclusions.We apologize for these errors, the manuscript text has now been reviewed for accuracy.In addition, we invite you to consider these few additional comments from eLife.1. A first concern is the absence of reference to important previous papers. Particularly, the work of Wiggins et al. in Dev. Cell 10.1016/j.devcel.2011.12.026 already reports aberrant bleb morphologies and actin accumulation under cofilin depletion in HeLa cells. Please cite this paper and modify the introduction to highlight the novelties of your study compared to previous works.We agree with the reviewer and previously cited the important work by Wiggan et al., however, we had not discussed in significant detail the many differences between our works. Therefore, we have now added to the Introduction, paragraph 3:‘Although Wiggan et al. has previously reported bleb defects in HeLa cells depleted of actin severing factors, the role of ADF and cofilin-1 in regulating the cortical actomyosin flow in fast amoeboid cells has not been determined (15).’Additionally, to the Discussion, paragraph 2:‘A similar elongated neck phenotype was observed by Wiggan et al., whereas they reported an increase in the frequency of HeLa cells with blebs after cofilin-1 RNAi (15). While these authors contend that cofilin-1 inhibits contractility by competing with myosin for F-actin binding, our results are in line with work showing that cofilin-1 increases contractility through optimizing actin filament lengths and de-branching (13,20,21).’2. Another concern is about the Lifeact/photoconversion experiments, which should be interpreted with caution. Such experiments usually report more Lifeact's binding/unbinding dynamics than F-actin's turnover itself, and the very rapid (second-timescale) lifetime measured in these experiments is coherent with this possibility.We appreciate that a significant difference is measured in the double siRNA condition, suggesting that both effects (actin turnover and Lifeact dynamics) may contribute in those experiments. Please discuss this point.This is a very good point, we have now qualified these data by adding to the Results section, ‘Rapid cortical actin flow requires ADF and cofilin-1 severing at leader bleb necks,’ paragraph 2:‘However, as our measurements will be a composite of the actin turnover rate and the binding kinetics of LifeAct, these data should be strictly viewed as apparent rates of actin turnover.’3. In the introduction, description of the biochemical effects of cofilin should go beyond citing one recent publication (Wioland et al.). For complete description, you should also mention the fact that cofilin's activity is highly dependent on its concentration, promoting severing at low concentration but stabilizing on the contrary actin filaments at high concentration (see papers from the Pollard, Blanchoin and De La Cruz labs). You should also mention the fact that cofilin is unlikely to function alone in cells, but together with catalyzing factors such as Aip1 or CAP (see for examples papers from the Michelot, Goode, Brieher and Lappalainen labs). Please discuss whether this complex behavior could change the interpretation of your results or not.These are very good points, we have now discussed the dependence on cofilin-1 concentration and the possible contribution of functional interactions with Aip1 and CAP1 to our Introduction (paragraph 3) and Discussion (last paragraph) sections, respectively (citing work by Pollard, Blanchoin, and others).4. Following the previous comment, whether ADF and cofilin1 have overlapping functions or not (please consider citing also Hotulainen et al. Mol Biol Cell 2005) is complicated by the strong dependence of cofilin concentration on its activity. For some results (mainly in Figure 5), it is difficult to conclude whether ADF and cofilin1 have indeed different functions, or whether this is just a concentration effect.We have now discussed/cited Hotulainen, P et al. (2005) within the revised manuscript.Therefore, I would suggest 2 things. Would there be a way to compare the expression level of cofilin 1 and ADF1, so that one could evaluate properly the total level of expression of cofilin1 + ADF in each experiment. Then, could you try a rescue experiment, by expressing ADF in siCFL1 cells?These are very good points, we have found (1) by measuring endogenous mRNA levels, the relative level of cofilin-1 to be over 3-fold higher than ADF (see Figure 1—figure supplement 1B) and (2) in cells without both cofilin-1 and ADF, that reconstitution with cofilin-1 and not ADF will rescue cell compressibility (see figure 5B). Source data for figure 5A-B have also been provided with the revised manuscript. Together, these data further support the notion that cofilin-1 and ADF have non-overlapping roles during the fast amoeboid (leader bleb-based) migration of cancer cells.From Review Commons:Reviewer #1 (Evidence, reproducibility and clarity (Required)):In this manuscript, Ullo and Logue investigate the roles of ADF and cofilin-1 in confined cell migration using A375 melanoma cells as a model. They found that depletion of both ADF and cofilin-1 suppressed the speed of bleb-based migration in confinement. Moreover, this dual intervention (1) resulted in cells displaying blebs with elongated necks, (2) reduced the bleb retraction rate, (3) increased the number of cortical barbed ends, (4) slowed down the rate of actin turnover at leader bleb necks and (5) impeded myosin minifilament flow rate after cofilin-1 inactivation. Overall, this is an interesting study worthy of publication pending appropriate revision.Comments:1. The authors have made some inaccurate statements throughout their manuscript. Specifically:a. In the abstract, they state that: RNAi of ADF and cofilin-1 led to a significant decrease in cell stiffness. Yet, Figure 5A shows that ADF depletion has no effect.We apologize for the error, the abstract now correctly states that RNAi of ADF has no effect on cell stiffness.b. On p. 6, "While the rate of actin turnover in cells depleted of cofilin-1 or ADF alone was modestly slower"…Yet, Figure 4G shows these individual knockdowns did not alter half-life.We apologize for the error, the manuscript now correctly states that RNAi of cofilin-1 or ADF alone does not significantly alter the half-life of F-actin.c. On p. 8, "depleting both proteins led to a large increase in the rate of actin turnover at bleb necks". Yet, Figure 4G shows the exact opposite (i.e., the half-life of F-actin turnover increased, which means that the turnover rate is reduced).We apologize for the lack of clarity, the manuscript has been edited accordingly.2. Does this Figure 1F represent data from one experiment? What is the S.D.?Figure 1F represents pooled data (percentages) taken from 1E and G. Relevant statistics can be found in Figure 1G.3. The authors should provide the blot showing the extent of cofilin-1 rescue.Cell-by-cell analyses were used to quantify the relative levels of fluorescent protein (FP) tagged versions of cofilin-1 and ADF. More specifically, the level of cofilin-1 or ADF was determined for untransfected and transfected cells by immunofluorescence. Transfected cells were identified using the FP tag. Accordingly, the levels of FP tagged cofilin-1 and ADF were measured relative to the endogenous protein. Using this methodology, we were able to accurately determine that FP tagged versions of cofilin-1 and ADF were similar to endogenous. See figures 1I and 5C.4. Figure 2A: what is the reason for showing cells at different time points? If the authors wish to show the retraction of a bleb(s), some cells at later time points go out of frame (e.g., non-target control).Although I fully understand the reviewer’s point of view that these montages may not be necessary, we feel that these montages may help some readers to fully appreciate the range of observed phenotypes.5. For the sake of completion, the authors should quantify the leader bled area and bleb area for siADF and dual KD in Figures 2C-D.These data have now been added. ADF RNAi was not found to significantly reduce either leader bleb or bleb (i.e., measuring all blebs) areas. Source data for leader bleb area and bleb area have also been provided with the revised manuscript.6. Figure 2I has no quantification. Could the authors provide quantification at the population level?This quantification has now been provided. More specifically, by segmenting leader blebs into 10 different regions, we found cofilin-1 to be enriched near the leader bleb neck in 10 cells.7. In Figure 3D (as well as other figures), it is not clear what groups are being compared statistically.In Figure 3D, groups are being compared to cells before reconstitution. In similar graphs, groups without an “ns” or stars are the comparison group.8. On p. 6, the authors state that "in cells depleted of ADF and cofilin-1, transfection of EGFP-cofilin-1 was not sufficient to restore cortical barbed ends to a level similar to control (Figure 3H). Either their statement is incorrect or "ns" in Figure 3H compares cofilin WT to EGFP alone (which is misleading).We thank the reviewer for pointing out this error, our statement was incorrect and has been corrected to:‘However, in cells depleted of ADF and cofilin-1, transfection of EGFP-cofilin-1 was sufficient to restore cortical barbed ends to a level similar to control (Figure 3H).’9. What is the rationale for performing experiments with trypsinized cells? Are the phenotypes and underlying molecular pathways same for compressed and trypsinized cells ?Because of the nature of our method for cell confinement, many assays that employ chemical treatments or the preparation of cell lysates are unavailable. Therefore, we use freshly trypsinized (spherical) cells, which predominantly have cortical actin and that are amenable to a unique range of assays, to in general study the cortical actin network. Previous work by us (Logue et al. 2015, eLife) and others (Bergert et al. 2012, PNAS and Liu et al. 2015, Cell) have shown that the properties of the cortical actin network in spherical cells are predictive of whether or not a cell will undergo fast amoeboid (leader bleb-based) migration.10. Is the reduction in myosin flow (Figure 5F) due to reduced actin turnover? What is the role of myosin in the neck formation ? From the proposed model in Figure 6, it looks like the neck is formed by myosin based contractility. Will inhibition of myosin activity by blebbistatin reduce the length of the neck ?We will address each question in turn; (1) correct, our model is that actin turnover at the bleb neck is essential for sustained myosin contractility and thus, myosin flow, (2) we and others believe that myosin is essential to the formation of the constricted neck, however, the molecular basis for why myosin is enriched at bleb necks is not well understood, and (3) this is a very interesting idea, we would also predict that the length of the neck would be reduced upon blebbistatin treatment. Unfortunately, this would be difficult to test in cells, as high myosin activity is required to initiate a bleb.11. The authors should do justice and cite relevant articles which show that confinement induces cell blebbing: PMID: 32789173 and PMID: 31690619These articles are now discussed/cited within the revised manuscript.Reviewer #1 (Significance (Required)):Following appropriate revision and clarifications, the resulting manuscript will represent a significant contribution to the area of cell motility.Referees cross-commentingReviewer #2 and I are in agreement. I also concur with her/his point (which I did not include in my review) about the use of two different siRNAs and inclusion of data on cell directionality. Lastly, I was "generous" regarding the estimated time to complete revisions because the π is a young Assistant Professor, and I just wanted to eliminate the pressure associated with time constraints so that he revises the manuscript meticulously.We wish to thank the reviewer for their comments, which have undoubtedly improved our manuscript.Reviewer #2 (Evidence, reproducibility and clarity (Required)):This paper interrogates the function of ADF-1 and cofilin in the leader-bleb based migration, as observed primarily in melanoma cells in confinement. Overall, this paper is reasonable and the data generally supports the conclusions, though robust statistical analysis is lacking in places. The experiments appear to be carefully performed and the FLAP experiments are innovative and informative. The main findings are that ADF-1 and cofilin each have roles in the phenotype of cells that undergo bleb-based migration and the results of inhibiting either one are distinct from (and milder than) those of inhibiting both.Specific Comments1. When the authors switch from studying cells with obvious leader based blebs to ones that are "spherical" it is unclear what else changes: is the confinement different? Are these migratory cells, etc?Because of the nature of our method for cell confinement, many assays that employ chemical treatments or the preparation of cell lysates are unavailable. Therefore, we use freshly trypsinized (spherical) cells, which predominantly have cortical actin and that are amenable to a unique range of assays, to in general study the cortical actin network. Previous work by us (Logue et al. 2015, eLife) and others (Bergert et al. 2012, PNAS and Liu et al. 2015, Cell) have shown that the properties of the cortical actin network in spherical cells are predictive of whether or not a cell will undergo fast amoeboid (leader bleb-based) migration.2. In at least some cases, the figures are not labeled and described (in captions and text) well enough to help the reader understand their import. For example, Figure 1B is hardly described in either the caption or the text. In Figure 1e there are no axis labels. Are those microns? While the authors say how the cells were selected as "highly motile" in the Methods section it would be convenient if this was restated in the figure caption.We apologize for the lack of clarity, the manuscript has been edited accordingly.3. An additional concern about Figure 1 is as follows: the authors state that ADF KD results in a decrease in mobility but that statement is not accurate given the data they show, where ADF is not statistically different than control and actually has the cell with the highest average speed (although it is possible that the highest cell both in ADF and in the control are statistical outliers and should be removed from the datasets. The authors should conduct a Grubs test to confirm whether they should keep these data points in their analysis). Additionally, generally when people are discussing changes in mobility they are looking not just at the speed but also at the directionality and directional persistence of cells. It would be interesting to present this data here as well and it simply requires analysis of tracks the authors already have in hand.We apologize for the lack of clarity, the manuscript has now been edited to more accurately state:‘Depleting cells of ADF led to a slight reduction in the number of highly motile cells (Figure 1E-H).’As a general practice, we don’t remove any cells from our migration analyses. This is because it is not uncommon to observe a wide range of migration parameters under conditions of confinement.Directional autocorrelations have now been provided. Please note that these autocorrelations were only done for highly motile cells, as directionality measurements on non- or poorly moving cells (e.g., moving in place) would not be informative. Accordingly, conditions with few motile cells will have a relatively low n-value. See Figure 1—figure supplement 1C.4. The data presented in Figure 2A is intriguing but also points to difficulty of concluding that the effects of ADF and cofilin are "additive." At times the authors use "non-overlapping," which I believe is more accurate given the results presented in Figure 2 and elsewhere in the manuscript. The blebs apparent in the dual knockdown are wild-looking and distinct from those seen in any of the other panels. The authors hardly discuss this even though they feature the elongated neck phenotype and highlight that it is not present in other treatments. If the effect of ADF and cofilin are "additive" one would think you would have a similar phenotype but featuring, for example, short necks in each case and then a long one when both are disrupted. At the very end of the paper the authors discuss that cofilin-1 is required for actin turnover and myosin contractility at the bleb neck. They have a very brief statement that KD of both proteins leads to an elongated bleb neck, but then spend the rest of the paragraph focusing on the effects of just cofilin-1. I think that investigating the long-necked blebs further would be of interest, especially since these cells continue to be motile and without any clear "leader bleb". Is actin present in these blebs? What is the flow like? How does this direct motility (and directionality) in these cells. Investigation of this morphology may lead to a better understanding of exactly how cofilin-1 and ADF interact to regulate blebbing and migration, as only lack of both proteins results in this altered morphology.We apologize for the confusion, 25/79 cells display the severe elongated neck phenotype (Figure 2D). In cells lacking both cofilin-1 and ADF, actin (Figure 3A) and myosin (Figure 5D) accumulate at bleb necks. In the absence of sufficient turnover, cortical actin flow is impeded (Figure 4D) and thus, these cells do not undergo leader bleb-based migration. Accordingly, these data help to form the basis of our model in which ADF and cofilin-1 collaborate to promote actomyosin flow and leader bleb-based migration (Figure 6).5. It is generally expected that authors will try two different siRNAs (or one siRNA and a function-inhibiting antibody) to provide reassurance that effects are on-target.In general, we agree with the reviewer’s point of view, however, in this paper we have used RNAi, reconstitution, and CALI in order to provide reassurance that effects are on-target.6. The authors state, "ADF and cofilin-1 rapidly disassemble cortical actin" and the authors discuss a change in the level of F-actin. However, it is not clear whether there is an overall change in actin level in the KD cells or if there is (as suggested) simply a change in ratio of F-actin : G-actin, which implies two rather different functions of these proteins.We apologize for the confusion, as we use phalloidin, our assays specifically measure changes in the level of F-actin.7. It would be very interesting indeed if the authors could test their speculation about uncontrolled filament elongation is contributing to the unusual phenotypes observed.In future work, which is likely to require purified proteins in actin polymerization and other assays (beyond the scope of the current work), we will aim to test the idea that uncontrolled actin polymerization contributes to the observed phenotypes.Reviewer #2 (Significance (Required)):General interest level in leader bleb-based migration is not especially high due to the fact that it is provoked by (non-physiological) confined environments. Even without direct physiological relevance, migratory strategies that cancer cells may adopt may be of interest to a broad community and the findings here (of "additive" effects of ADF and cofilin-1) may have relevance beyond this particular migratory mode. The main weaknesses of the manuscript is the incomplete description of the additive affect of ADF and cofilin: while the authors attempt to capture this in their discussion and schematic depiction, how the two proteins interact with respect to leader based bleb migration and related processes such as actin turnover remain incompletely described.We would note that our assay was designed to simulate tissue environments in which cells are under conditions of high mechanical confinement. Work by us and others has shown that these assays efficiently promote the transition to fast amoeboid (leader bleb-based) migration, similar to what has been previously observed in vivo (Tozluoglu et al. 2013, Nature Cell Biology, Ruprecht et al. 2015, Cell and Venturini et al. 2020, Science).We in general agree with the reviewer’s point of view that much remains to be done with regards to understanding the non-overlapping roles of cofilin-1 and ADF during leader bleb-based migration. However, we view this paper as providing the rationale for future (in-depth) biochemical studies. As mentioned in our point-by-point responses (above), this work is likely to involve using purified proteins in actin polymerization and other assays, which we feel is beyond the scope of the current paper.The main audience for this work will be anyone interested in novel migratory strategies in cancer cells as well as those who wish to understand origins of cell motility from a biophysical point of view.Reviewer expertise is in novel migratory strategies of cancer cells, particularly in three-dimensional in vitro environments.Referees cross-commentingI think the other reviewer and I are generally in agreement. There are some interesting things in this manuscript but there are inconsistencies between written statements and data presented in places as well as lack of robust statistical analysis. Certainly, all data presented in figures and written description of such should be reconciled.We apologize for these errors, as discussed in our point-by-point responses (above), these issues have now been reconciled.The other question brought up by both reviewers that must be addressed is the fact that the authors switch from studying confined to trypsinized spherical cells at some point. Why should these two situations be studied side-by-side? There is an implication that the same underlying molecular pathways are relevant, but what evidence is there that this is the case?We have copied our response to specific comment 1 (reviewer 2):Because of the nature of our method for cell confinement, many assays that employ chemical treatments or the preparation of cell lysates are unavailable. Therefore, we use freshly trypsinized (spherical) cells, which predominantly have cortical actin and that are amenable to a unique range of assays, to in general study the cortical actin network. Previous work by us (Logue et al. 2015, eLife) and others (Bergert et al. 2012, PNAS and Liu et al. 2015, Cell) have shown that the properties of the cortical actin network in spherical cells are predictive of whether or not a cell will undergo fast amoeboid (leader bleb-based) migration.
Key resources table
Reagent type (species) or resource
Designation
Source or reference
Identifiers
Additional information
Cell line (Homo sapiens)
A375-M2
ATCC
CRL-3223
Metastatic melanoma
Cell line (Homo sapiens)
A549
ATCC
CCL-185
Lung adenocarcinoma
Chemical compound, drug
SYLGARD 184
Dow Corning
Cat no. 24236–10
PDMS
Transfected construct (Homo sapiens)
EGFP-cofilin-1 WT, S3A, and S3E
Addgene (a gift from Dr James Bamburg)
Plasmid no. 50859, 50854, and 50855
Plasmid constructs to transfect
Transfected construct (Homo sapiens)
RFP-cofilin-1
Dr James Bamburg (Colorado State University)
n/a
Plasmid construct to transfect
Transfected construct (Homo sapiens)
RFP-ADF
Dr James Bamburg (Colorado State University)
n/a
Plasmid construct to transfect
Transfected construct (Homo sapiens)
SuperNova-cofilin-1
Dr Kazuyo Sakai (Osaka University, Osaka, Japan)
n/a
Plasmid construct to transfect and destroy cofilin-1 by CALI
Transfected construct (Saccharomyces cerevisiae)
mEos3.2-LifeAct
Addgene (a gift from Michael Davidson)
Plasmid no. 54696
Plasmid construct to transfect and monitor F-actin dynamics
Sequence-based reagent (Homo sapiens)
Non-targeting siRNA
Thermo Fisher
Cat no. 4390844
Control siRNA to transfect
Sequence-based reagent (Homo sapiens)
Cofilin-1 siRNA
Thermo Fisher
Cat no. 4392420; s2936
Cofilin-1 siRNA to transfect
Sequence-based reagent (Homo sapiens)
ADF siRNA
Thermo Fisher
Cat no. 4392422; s21737
ADF siRNA to transfect
Antibody
Anti-cofilin-1 (mouse monoclonal)
Thermo Fisher
Cat no. MA5-17275
WB (1:1000), IF (1:250)
Antibody
Anti-ADF (mouse monoclonal)
Thermo Fisher
Cat no. MA5-25485
WB (1:1000), IF (1:250)
Sequence-based reagent (Homo sapiens)
Cofilin-1 forward qPCR primer
Thermo Fisher
n/a
GCAACCTATGAGACCAAGGAGAG
Sequence-based reagent (Homo sapiens)
ADF forward qPCR primer
Thermo Fisher
n/a
GCACCAGAACTAGCACCTCTGA
Sequence-based reagent (Homo sapiens)
GAPDH forward qPCR primer
Thermo Fisher
n/a
GTCTCCTCTGACTTCAACAGCG
Recombinant DNA protein
Alexa Fluor 568-conjugated G-actin from rabbit muscle
Thermo Fisher
Cat no. A12374
Fluorescent G-actin to label actin barbed ends
Software
Fiji
n/a
https://imagej.net/Fiji
Microscopy
Software
Prism
GraphPad
n/a
Statistical analyses
Software
BioRender
Toronto, ON
n/a
Illustration
Other
DeltaVision Elite
GE
n/a
Commercial deconvolution microscopy system
Other
LSM880 with fast Airy Scan
Zeiss
n/a
Commercial point scanning confocal microscopy system
Authors: Hui Chen; Barbara W Bernstein; Judith M Sneider; Judith A Boyle; Laurie S Minamide; James R Bamburg Journal: Biochemistry Date: 2004-06-08 Impact factor: 3.162
Authors: Jeremy S Logue; Alexander X Cartagena-Rivera; Michelle A Baird; Michael W Davidson; Richard S Chadwick; Clare M Waterman Journal: Elife Date: 2015-07-11 Impact factor: 8.140
Authors: Francisco Merino-Casallo; Maria Jose Gomez-Benito; Silvia Hervas-Raluy; Jose Manuel Garcia-Aznar Journal: Cell Adh Migr Date: 2022-12 Impact factor: 3.255