| Literature DB >> 34122107 |
Rundong Jiang1,2,3, Jiaqi Xu3,4,5, Yuezhong Zhang3,6, Xuanmeng Zhu3,7,8, Jiachen Liu3, Yurong Tan9.
Abstract
Ligustrazine (Entities:
Keywords: NFκB; acute lung injury; apoptosis; inflammasome complex; ligustrazine; pyroptosis
Year: 2021 PMID: 34122107 PMCID: PMC8193053 DOI: 10.3389/fphar.2021.680512
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.810
Primers used for the qRT-PCR study.
| Gene | Forward primer (5'→3′) | Reverse primer (5'→3′) |
|---|---|---|
| TNF-α | CAGGCGGTGCCTATGTCTC | CGATCACCCCGAAGTTCAGTAG |
| IL-1β | GCAACTGTTCCTGAACTCAACT | ATCTTTTGGGGTCCGTCAACT |
| IL-18 | GACTCTTGCGTCAACTTCAAGG | CAGGCTGTCTTTTGTCAACGA |
| IL-10 | GCTGGACAACATACTGCTAACC | ATTTCCGATAAGGCTTGGCAA |
| Caspase-1 | ACAAGGCACGGGACCTATG | TCCCAGTCAGTCCTGGAAATG |
| NLRP3 | ATCAACAGGCGAGACCTCTG | GTCCTCCTGGCATACCATAGA |
| iNOS | GGAGTGACGGCAAACATGACT | TCGATGCACAACTGGGTGAAC |
| IL-6 | TAGTCCTTCCTACCCCAATTTCC | TTGGTCCTTAGCCACTCCTTC |
| CD206 | CTCTGTTCAGCTATTGGACGC | CGGAATTTCTGGGATTCAGCTTC |
| TLR4 | ACACCTGCCTCTTCCCTCCC | CTCCAGTCGGTCAGCAAACG |
| GAPDH | AGGTCGGTGTGAACGGATTTG | GGGGTCGTTGATGGCAACA |
FIGURE 1TMP played a protective role in LPS-induced cell damage (n = 3). (A) RAW264.7 cells were treated with different concentrations of LPS for 24 h and then detected by CCK-8 assay. (B) CCK-8 assay was used to detect the cytotoxicity of TMP to RAW264.7 cells. (C) The PI- positive rates of RAW264.7 cells were detected using flow cytometry after 24 h stimulation with LPS (1 μg/ml). (D) The apoptosis rates of RAW264.7 cells were detected using flow cytometry when LPS (1 μg/ml) were co-treated with TMP (10 μg/ml) or Dex (5 μM) for 24 h. (E) After 24 h of treatment with LPS (1 μg/ml), the cells were observed under an inverted optical microscope. The red arrow showed the formation of apoptosis bodies, and the white arrow showed the cell swelling or the rupture of the cell membrane. Averages ±SD were shown. *p < 0.05, **p < 0.01, ***p < 0.001.
FIGURE 2TMP regulated expression of inflammatory cytokines of macrophage when stimulated by LPS (n = 3). After RAW264.7 and Ana-1 cells were co-cultured with LPS (1 μg/ml) and TMP (10 μg/ml) or Dex (5 μM) for 24 h, IL-1β (A), IL-18 (B), TNF-ɑ (C) and IL-10 (D) mRNA expression level were detected by qRT-PCR. ELISA method was used to detect IL-1β (A), IL-18 (B), TNF-ɑ (C) and IL-10 (D) secretion. Averages ±SD were shown. *p < 0.05, **p < 0.01, ***p < 0.001, n.s = no significance.
FIGURE 3TMP inhibited M1-and promoted M2-type polarization to inhibit inflammatory responses (n = 3). RAW264.7 and Ana-1 cells were exposed to TMP (10 μg/ml) or Dex (5 μM) and LPS (1 μg/ml) for 24 h. (A) the qRT-PCR experiment was performed to determine M1-type biomarker (IL-6, iNOS) and M2-type biomarker (CD206) expressed in RAW264.7 and Ana-1 cell. (B) After RAW264.7 cells were stained with CD80-APC/CD86-BV650 (M1) and CD206-BV421 (M2), the expression levels of macrophage subsets were evaluated using flow cytometry. The figure below showed the quantitative expression of the phenotype of M1/M2 macrophages. (C) Immunofluorescence staining was used to detect M1-type macrophage biomarker iNOS and M2-type macrophage biomarker CD206. Blue was DAPI and green was iNOS or CD206. Averages ±SD were shown. *p < 0.05, **p < 0.01, ***p < 0.001.
FIGURE 4TMP had a protective role in LPS-induced ALI in mice (n ≥ 5). C57BL/6J male mice (18–22 g) aged 6–8 weeks were randomly divided into control group,LPS (30 mg/kg) group, TMP (50 mg/kg) group and Dex (5 mg/kg) group. (A) The survival time of mice was monitored for 72 h, and each point on the line represents the cumulative mortality. (B) After LPS administration for 6 h, lung tissue samples were collected and tissue sections were made and stained with Hematoxylin and Eosin. (C-E) BALF specimens were collected at 6 h after treatments. After Giemsa staining, neutrophils were counted. (F) Detection of the inhibitory effect of TMP on myeloperoxidase (MPO) activity. Averages ±SD were shown. *p < 0.05, **p < 0.01, ***p < 0.001.
FIGURE 5TMP inhibited the releases of pro-inflammatory cytokines from lung tissue through regulating the polarization of alveolar macrophages (n ≥ 4). Mice were randomly divided into control group, LPS group, LPS + Dex group and LPS + TMP group. After 6 h of treatments, venous blood samples were collected from the mice and the serum inflammatory factors including IL-1β (A), IL-18 (B), and TNF-ɑ (C) were detected using ELISA method. (D) After the mice were sacrificed, the lung tissues of the mice were taken to make paraffin sections, and immunofluorescence was used to label the polarization of macrophages. DAPI was used for nuclear staining, the green fluorescent labeled CD68, the red fluorescent-labeled iNOS or CD206, and merge figures were the overlay of CD68 and iNOS or CD206. Averages ±SD were shown. *p < 0.05, **p < 0.01, ***p < 0.001.
FIGURE 6Phosphorylation protein profiling analysis revealed inflammation signaling pathways regulated by TMP. Three groups of Control, LPS (1 μg/ml), LPS (1 μg/ml) + TMP (10 μg/ml) after 24 h of treatments were collected for phosphorylation protein profiling analysis. (A) Heat map of phosphorylated proteins with differentially expressed between LPS and TMP, red indicated high expression, blue indicated low expression, and colorless indicated no significant difference. A total of 370 differentially expressed proteins were detected. (B) The scatter diagram displayed differentially expressed proteins, and the points distributed outside the two longitudinal boundary lines and above the horizontal boundary represented significantly different proteins. (C) KEGG pathway analysis showed the signal pathway enriched by down-regulated proteins. (D) GO analysis of target genes in biological processes showed that down-regulated proteins were more abundant in mRNA processing, ribonucleoprotein complex biogenesis, and RNA splicing.
FIGURE 7TMP inhibited inflammation through inhibiting TLR4/NFκB signaling pathway (n ≥ 3). C57BL/6J male mice (18–22 g) aged 6–8 weeks were randomly divided into the control group, the LPS group, the TMP group and the Dex group. (A) Except for the control group, mice were given an intraperitoneal injection of LPS for 6 h, and lung tissues were taken for RNA extraction. After that, the mRNA expression of TLR4 in the lungs was detected by qPCR. (B) RAW264.7 cells were treated in previous mentioned ways, and the protein expression of TLR4 and TRAF6 were examined. (C)After the above-mentioned corresponding drug treatments, lung tissue and Ana-1 cells were collected for protein extraction, then the purpose protein expression level of NFκB p-65, p-p65 were tested through Western Blot experiment. The figure below showed the quantitative data of p-65 and p-p65 protein expression. *p < 0.05, **p < 0.01, ***p < 0.001.
FIGURE 8TMP inhibited the activation of NLRP3 inflammasome and caspase-1 induced pyroptosis (n = 3). TMP (10 μg/ml) or Dex (5 μM) and LPS (1 μg/ml) were co-treated with RAW264.7 or Ana-1 cells for 24 h (A, B) qRT-PCR analysis of NLRP3, caspase-1 mRNA expression. (C,D) After co-treatment of RAW264.7 or Ana-1 cells with LPS and TMP, Western Blot was used to detect the expression of NLRP3, caspase-8 and caspase-1/P20 protein. The figure below showed the quantitative data of NLRP3 and caspase-1/p20 protein expression. (E) In vivo, after treatment with TMP or Dex, lung tissue was taken for qRT-PCR to detect the gene expression of NLRP3. (F) After extracting protein from lung tissues, we performed Western Blot protein quantification experiment on caspase-1 and caspase-3. The right picture showed the quantitative data of caspase-1 and caspase-3 protein expression. Averages ± SD were shown. *p < 0.05, **p < 0.01, ***p < 0.001.
FIGURE 9Schematic diagram of TMP on inflammatory signaling pathway. LPS activated the TLR4/TRAF6/NFκB/NLRP3/caspase-1 and TLR4/caspase-8/caspase-3 signaling pathway to induce pyroptosis and apoptosis. The signaling pathways were suppressed by TMP.