| Literature DB >> 34122091 |
Li Liu1, Qi Li1, Jie Yin1,2, Zheng Zhao1, Lidong Sun1, Qingsen Ran1, Xinke Du1, Yajie Wang1, Yujie Li1, Qing Yang1, Ying Chen1, Xiaogang Weng1, Weiyan Cai1, Xiaoxin Zhu1.
Abstract
Background/Aim: Macrophage polarization and phenotypic switching of smooth muscle cells (SMCs) are multi-faceted events dominating atherosclerosis (AS) progression. TGF-β was proved to been one of the bridge on the cEntities:
Keywords: atherosclerotic plaques stability; macrophage polarization; shenlian extract; smooth muscle cells phenotype switching; transforming growth factor-β
Year: 2021 PMID: 34122091 PMCID: PMC8193129 DOI: 10.3389/fphar.2021.669730
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.810
FIGURE 4SL increases the SMC contractile phenotype in the macrophage/SMC conditional medium transferring model. (A) In vitro, the protocol of macrophage/SMC conditional medium transferring model for efficacy identification of SL. (B-F) RT-PCR assay for ECM related marker (Collagen1), synthetic SMC-related marker (OPN), contractile SMC-related markers (SM-MHC, α-SMA) in HVASMCs from the macrophage/SMC conditional medium transferring model. (G-I) Detection of the protein expression of fibronectin, α-SMA, and GAPDH treated with SL in HVASMCs from the macrophage/SMC conditional medium transferring model. (J) TGF-β levels detected by ELISA in the supernatant of the macrophage/SMC conditional medium transferring model. (K, L) p-Smad 2/3 normalized by Smad 2/3 level in western blotting assay. *p < 0.05 and **p < 0.01 compared with the untreated group, and #p < 0.05 and ##p < 0.01 compared to control groups treated with ox-LDL, n = 3.
Oligonucleotide primers used for RT-PCR.
| Gene | Primer (5'→3′) | Annealing temperature (°C) | Length (bp) |
|---|---|---|---|
| GAPDH | Sense: CTAAGGCCAACCGTGAAAAG | 53 | 492 |
| Anti-sense: ACCAGAGGCATACAGGGACA | |||
| OPN | Sense: TGATGGCCGAGGTGATAGTG | 53 | 210 |
| Anti-sense: CCAATCAGAAGGCGCGTT | |||
| α-SMA | Sense: TGAGCGTGGCTATTCCTTCGT | 52 | 105 |
| Anti-sense: GCAGTGGCCATCTCATTTTCAA | |||
| SM-MHC | Sense: AAGCCAAGAGCTTGGAAGC | 53 | 829 |
| Anti-sense: TCCTCCTCAGAACCATCTGC | |||
| Collagen 1 | Sense: ATGGATTCCAGTTCGAGTATGGC | 53 | 245 |
| Anti-sense: CATCGACAGTGACGCTGTGG |
FIGURE 1SL extract regulated transformation of macrophage phenotype in an inflflammatory injury model. (A, B) Western blotting verifification of M1 macrophage polarization related marker iNOS in cells treated with SL (from 5 to 20 μg ml-1) for 24 h in RAW264.7 cells in the absence or presence of ox-LDL, n=3. (C) Effect of SL on the expression of M1 marker CD86 in RAW264.7 by flflow cytometry. n=4 (D, E) Detection of M1 macrophage polarization related markers (TNF-α and IL-1β) by ELISA in supernatant of RAW264.7 cells treated with SL 24 h, n=3. (F) Effect of SL on expression of the M2 marker CD206 in RAW264.7 by flflow cytometry in the absence or presence of LPS (50 ng ml-1), n=6. (G) Detection of M2 macrophage polarization related marker (TGF-β) by ELISA in supernatant of RAW264.7 cells treated with SL 24 h, n=3. *p < 0.05 and **p < 0.01 compared to untreated group, and #p < 0.05 and ##p < 0.01 compared to control groups treated with model group.
FIGURE 2Transformation of macrophage phenotype induced by SL involves STAT3/SOCS3 pathway. (A–D) Detection of the phospho-JAK2, total-JAK2, phospho-STAT3, total-STAT3, total-SOCS3 and β-actin in SL-treated macrophages for 24 h, n = 3. (E,F) After specific blockading of JAK/STAT3 by JSI-124, total SOCS3 expression was detected by western blotting, n = 3. *p < 0.05 and **p < 0.01 compared to the untreated group, and #p < 0.05 and ##p < 0.01 compared to control groups treated with ox-LDL, ^ ^p < 0.01 compared with the SL-5 group, △△p < 0.01 compared with the SL-10 group, and && p < 0.01 compared with the SL-20 group.
FIGURE 3SL increases SMCs contractile phenotype in macrophage/SMC co-culture model. (A) In vitro, the protocol of co-culture model for efficacy identification of SL. (B–F) RT-PCR assay for ECM related marker (Collagen1), synthetic SMCs related markers (OPN), contractile SMCs related markers (SM-MHC, α-SMA) in HVASMCs from macrophage/SMCs co-culture model (G–I) Detection of the protein expression of Fibronectin, α-SMA and GAPDH treated with SL in HVASMCs from the macrophage/SMC co-culture model. (J, K) TGF-β was neutralized by TGF-β neutralizing antibody (1D11), Western blotting analysis for α-SMA protein expression (L) TGF-β levels detected by ELISA in the supernatant of macrophage/SMC co-culture model (M, N) p-SMA 2/3 normalized by Smad2/3 levels in the western blotting assay. *p < 0.05 and **p < 0.01 compared with the untreated group, and #p < 0.05 and ##p < 0.01 compared to control groups treated with ox-LDL, ^p < 0.05 compared with the SL-5 group, △p < 0.05 compared with the SL-10 group, and &p < 0.05 compared with the SL-20 group, n = 3.
FIGURE 5Specific blocking of TGF-β attenuated the functional plaque stability provided by SL in ApoE-/- mice. (A) Carotid artery coronal images captured by NMR and measurements of areas of the RCA and LCA. (B, C) TNF-α and TGF-β in the serum of treated were detected by ELISA. (D) Intravascular Sirius red, Scale bar, 800 μm. (E, F) IHC analysis and measurement of atherosclerotic aortic root, the expression of M1 macrophage polarization related marker CD86 and M2 macrophage polarization related marker CD206, Scale bar, 1000 μm. (G, H) IHC analysis and measurement of plaque, the expression level of contractile SMCs related markers α-SMA, ECM related marker Fibronectin, Scale bar, 1500 μm. (I) IHC analysis for MMP9, Scale bar, 1000 μm. *p < 0.05 and **p < 0.01 compared to the sham-treated group, and #p < 0.05 and ## p < 0.01 compared to model group, P = Rosuvastatin, Pi = Pirfenidone, n = 3.