Cigarette smoking is the leading cause of all histological types of lung cancer, and the role that microRNAs (miRNAs) serve in its pathogenesis is being increasingly recognized. The aim of the present study was to investigate the role of miR‑200b on migration in cigarette smoke‑induced malignant transformed cells. In the present study, miR‑200b expression was found to be increased in cigarette smoke (CS)‑exposed BEAS‑2B cells, lung cancer cell lines and tumor tissue samples. Using wound healing and Transwell migration assays, the migratory ability was shown to be increased in miR‑200b‑overexpressing cells, whereas miR‑200b knockdown resulted in reduced migration. Additionally, the expression of E‑Cadherin was downregulated, whereas that of N‑Cadherin was upregulated in miR‑200b mimic‑transfected cells, suggesting an increase in epithelial‑mesenchymal transition. Downstream, using four target gene prediction tools, six target genes of miR‑200b were predicted, amongst which, ETS proto‑oncogene 1 transcription factor (ETS1) was shown to be significantly associated with tumor invasion depth and negatively associated with miR‑200b expression. The interaction between miR‑200b and ETS1 was confirmed using a dual‑luciferase reporter assay. Using rescue experiments, the increased migratory ability of the miR‑200b‑overexpressing cells was reversed by ETS1 overexpression. In summary, this study showed that miR‑200b overexpression serves a carcinogenic role and promotes the migration of BEAS‑2B cells following long‑term exposure to CS by targeting ETS1.
Cigarette smoking is the leading cause of all histological types of lung cancer, and the role that microRNAs (miRNAs) serve in its pathogenesis is being increasingly recognized. The aim of the present study was to investigate the role of miR‑200b on migration in cigarette smoke‑induced malignant transformed cells. In the present study, miR‑200b expression was found to be increased in cigarette smoke (CS)‑exposed BEAS‑2B cells, lung cancer cell lines and tumor tissue samples. Using wound healing and Transwell migration assays, the migratory ability was shown to be increased in miR‑200b‑overexpressing cells, whereas miR‑200b knockdown resulted in reduced migration. Additionally, the expression of E‑Cadherin was downregulated, whereas that of N‑Cadherin was upregulated in miR‑200b mimic‑transfected cells, suggesting an increase in epithelial‑mesenchymal transition. Downstream, using four target gene prediction tools, six target genes of miR‑200b were predicted, amongst which, ETS proto‑oncogene 1 transcription factor (ETS1) was shown to be significantly associated with tumor invasion depth and negatively associated with miR‑200b expression. The interaction between miR‑200b and ETS1 was confirmed using a dual‑luciferase reporter assay. Using rescue experiments, the increased migratory ability of the miR‑200b‑overexpressing cells was reversed by ETS1 overexpression. In summary, this study showed that miR‑200b overexpression serves a carcinogenic role and promotes the migration of BEAS‑2B cells following long‑term exposure to CS by targeting ETS1.
Lung cancer is the most prevalent type of cancer in the world, accounting for ~1.8 million new lung cancer cases and 1.6 million lung cancer-associated deaths annually (1). The 5-year survival rate of patients with lung cancer varies from 4–17%, based on their pathological stage and region (2). Lung cancer can be categorized as either non-small cell lung cancer or small cell lung cancer according to its pathological features. The early symptoms of lung cancer are not obvious, usually resulting in diagnosis in the middle or later stages of its development (3). The etiological complexity and frequent metastasis of lung cancer are the primary factors underlying the difficulty in treatment and the high mortality rates associated with it (4). Tumor metastasis is a complex biological process, and its mechanism is poorly understood. The epithelial-mesenchymal transition (EMT) process is considered an early and critical step in the tumor metastatic cascade (5). Cigarette smoking is the leading cause of all histological types of lung cancer (6). Our previous work on the carcinogenic potential of cigarette smoke (CS) in normal human bronchial epithelial (BEAS-2B) cells showed aberrant DNA methylation and transcriptional profiles, as well as an increase in tumorgenicity and migratory ability (7–9).MicroRNAs (miRNAs/miRs) are endogenous single-stranded non-coding RNAs of ~20–24 nucleotides in length (10). It has been widely reported that miRNAs negatively regulate the expression of various mRNAs by binding to the 3′-untranslated regions (3′-UTR) of mRNAs (11). miRNAs exhibit unique and diverse expression patterns and modulate several cellular processes and signaling pathways related to tumorigenesis, cell proliferation, metastasis, invasion and apoptosis (12,13). Our previous study identified multiple miRNAs that are aberrantly expressed in CS-induced malignantly transformed cells (9). The present study focused on one of these miRNAs, miR-200b, as the aberrant expression of the miR-200 family has been reported to be associated with the occurrence and development of various types of malignant tumors, such as hepatocellular carcinoma (14), colon cancer (15), breast cancer (16), ovarian cancer (17) and lung cancer (18). The miR-200 family is comprised of five members, miR-200a, miR-200b, miR-200c, miR-429 and miR-141. Accumulating evidence suggests that miR-200b serves an important role in EMT, cancer stem cell maintenance, apoptosis and in the cell cycle (19). miR-200b has also been reported to be upregulated in lung cancer cells, where it is associated with cell proliferation and metastasis (20). However, the exact role of miR-200b in mediating lung cancer cell migration and invasion, as well as the underlying molecular mechanisms involved remain to be determined.The aim of the present study was to identify the biological function and regulatory mechanism of miR-200b in the CS-induced malignant transformed BEAS-2B cells to explore the molecular mechanisms underlying CS-induced lung cancer. Bioinformatics analysis and in vitro experiments were used to analyze and verify the function and target gene of miR-200b.
Materials and methods
Data source and bioinformatics analysis
Log2 transformed RNA-seq expression data in lung cancer tissues, including lung adenocarcinoma [The Cancer Genome Atlas (TCGA) LUAD] and lung squamous cell carcinoma (TCGA LUSC), were obtained from TCGA database through the University of California Santa Cruz (UCSC) Xena Browser (xena.ucsc.edu) (21). Additionally, four datasets for the analysis of miR-200b-3p (miR-200b), accession nos. GSE62182 (22), GSE74190 (23), GSE51853 (24) and GSE48414 (25), and two datasets for ETS proto-oncogene 1 transcription factor (ETS1) analysis, accession nos. GSE19804 (26) and GSE27262 (27), were downloaded from the Gene Expression Omnibus (GEO) database (ncbi.nlm.nih.gov/geo/). The protein levels were determined using the ‘CPTAC lung adenocarcinoma’ dataset, which was downloaded from the Clinical Proteomic Tumor Analysis Consortium (CPTAC) data portal (cptac-data-portal.georgetown.edu/cptacpublic) (28). The Pearson correlation analysis of miR-200b with ETS1 was analyzed using the webtool ‘LinkedOmics’ (linkedomics.org/admin.php). Enrichment analysis was performed using the webtool Database for Annotation, Visualization and Integrated Discovery (DAVID; david.ncifcrf.gov/).
Cell culture
Normal human bronchial epithelial cells (BEAS-2B), as well as lung adenocarcinoma cells (A549 and H1299) and lung squamous carcinoma cells (H226) were obtained from the American Type Culture Collection and cultured in high-glucoseDMEM (Biological Industries; Sartorius AG) supplemented with 10% FBS (Biological Industries; Sartorius AG) in a 37°C incubator with 5% CO2.
In vitro cell model for CS-induced malignant transformation
The BEAS-2B cells were used to establish an in vitro model of CS-induced malignant transformation, the detailed procedure of which has been described previously (7). Briefly, aliquots of exponentially growing BEAS-2B cells (1×105) were plated onto a Transwell membrane (0.4 µm pore; Corning, Inc.). An automatic smoking machine was used to produce CS, which was then pumped into an inhalation chamber where the BEAS-2B cells were directly exposed to CS for 10 min every other day at a smoke concentration of 20%. This procedure of exposing cells to CS was continued for 10, 20 and 30 passages, and such cells were referred to as experimental S10, S20 and S30 cells, respectively. BEAS-2B cells that were not exposed to CS were used as the control cells.
Transfection
Aliquots containing 2×105 BEAS-2B cells were seeded in each well of 6-well plates and cultured for 24 h. Then, the cells were transfected with: i) 50 nM mimic of miR-200b (UAAUACUGCCUGGUAAUGAUGA); ii) mimic negative control (NC, UUCUCCGAACGUGUCA); iii) 100 nM inhibitor of miR-200b (UCAUCAUUACCAGGCGGUAUUA); or iv) 5-carboxyfluorescein (FAM) labeled inhibitor NC (CAGUACUUUUGUGUAGUACAA). The four oligos were obtained from Guangzhou RiboBio Co., Ltd. Transfection was performed using Lipofectamine® 6000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Transfection efficiency was evaluated by reverse transcription-quantitative (RT-q)PCR and fluorescence of FAM-inhibitor NC transfected cells. The cells were harvested 24 h after transfection and used for wound healing and Transwell assays, as well as for RNA and protein extraction, as described below.
Wound healing assay
Aliquots of 2×105 exponentially growing mimic- and inhibitor-transfected cells were seeded into separate 6-well plates and cultured under standard conditions until they reached 100% confluency. Subsequently, a scratch was made on each plate using a P10 pipette tip. The culture medium was replaced with fresh serum-free DMEM and the cells were cultured further. Images of the wound were obtained at 0 and 24 h using an inverted microscope (magnification, ×200; Olympus Corporation) and quantitated using ImageJ version 1.8.0 (National Institutes of Health).
Transwell migration assay
Aliquots of exponentially growing transfected cells (2×105 cells in 500 µl serum-free medium) were seeded into the upper chambers of the Transwell inserts (Corning, Inc.), whereas the lower chambers were filled with 1 ml complete medium with 10% FBS. All plates were incubated at 37°C for 24 h. Subsequently, the cells on the membrane of the upper chamber were removed with a cotton swab. Cells in the lower chamber were fixed with 4% paraformaldehyde at room temperature for 15 min and stained with 0.5% crystal violet solution at room temperature for 15 min. Images of the cells were taken using an inverted microscope (magnification, ×200; Olympus Corporation) and analyzed using ImageJ version 1.8.0 (National Institutes of Health).
RNA extraction and RT-qPCR
Total RNA was extracted using TRIzol® reagent (Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions from cell samples. From each sample, ~1.5 µg RNA was reverse transcribed into cDNA using a RevertAid First Strand cDNA Synthesis Kit for mRNA detection (Thermo Fisher Scientific, Inc.), or a Mir-X™ miRNA First-Strand Synthesis kit for miRNA detection (Clontech Laboratories, Inc.) according to the manufacturer's instructions. qPCR was performed using a NovoScript® SYBR Two-Step RT-qPCR kit (Novoprotein Scientific, Inc.) on a QuantStudio™ 6 Flex RT-qPCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.). Thermocycling conditions were initial hold at 95°C for 10 min, 40 cycles of 95°C for 15 sec and 60°C for 60 sec. The sequences of the primer pairs used for qPCR are listed in Table SI. GAPDH and U6 were used as the internal controls. The relative expression of each target was analyzed using the 2−ΔΔCq method (29).
Protein extraction and western blot analysis
Exponentially growing cells were washed with ice-cold PBS and lysed in ice-cold RIPA buffer (Beyotime Institute of Biotechnology) for protein extraction. Total protein was quantified using BCA reagent (Beyotime Institute of Biotechnology). Then, ~30 µg of each protein sample was mixed with a quarter volume of 5X loading buffer and boiled at 95°C for 10 min. The lysates were loaded on a 10% sodium dodecyl sulfate (SDS)-gel, resolved using SDS-polyacrylamide gel electrophoresis, and subsequently the proteins were transferred to PVDF membranes (EMD Millipore). The membranes were blocked using TBS with 0.1% Tween-20 (TBST) buffer containing 5% BSA (Beyotime Institute of Biotechnology) at room temperature for 2 h, and then probed with specific primary antibodies overnight at 4°C. After washing with TBST, membranes were incubated at room temperature for 2 h with mouse or rabbit anti-rabbit IgG antibody. The antibodies used in this experiment were: Epithelial marker, E-cadherin (CDH1; 1:1,000; cat. no. 20874-1-AP; ProteinTech Group, Inc.), mesenchymal marker, N-cadherin (CDH2; 1:1,000; cat. no. 22018-1-AP; ProteinTech Group, Inc.), GAPDH (1:1,000; cat. no. 5174; Cell Signaling Technology, Inc.), horseradish peroxidase (HRP)-conjugated anti-rabbit IgG secondary antibody (1:20,000; cat. no. ab7090; Abcam) and HRP-tagged anti-mouse IgG secondary antibody (1:3,000; cat. no. 7076; Cell Signaling Technology, Inc.). Signals were visualized using enhanced chemiluminescence (ECL) plus reagents (Invitrogen; Thermo Fisher Scientific, Inc.) and a GeneTools GBox system (Syngene Europe). The intensity of each band was semi-quantified using ImageJ.
Dual-luciferase reporter assays
To verify whether ETS1 was a direct target of miR-200b, the complete sequence of the ETS1 wild-type 3′-UTR (ETS1_UTR_WT) was amplified by PCR from human genomic DNA using the forward primer, 5′-GCTCTAGAGCTATCACTCTAGTTTTGAAGC-3′ and reverse primer, 5′-GCTCTAGAGCCTTTCATTGTGACAGAATCC-3′. Both primers contained the recognition sequence for the XbaI restriction enzyme at the 5′ ends. Subsequently, the sequence was cloned into the pGL3 (cat. no. 48743; Addgene) vector downstream of the luciferase open reading frame. Additionally, the site-directed mutagenesis for ETS1 3′-UTR was performed using a site-directed mutagenesis kit (Beyotime Institute of Biotechnology) to remove the miR-200b binding site.Aliquots of 2×105 exponentially growing BEAS-2B cells were seeded into 24-well plates and co-transfected with the mimics (miR-200b) and the constructed pGL3 plasmids, as well as the Renilla luciferase plasmid (pRL, Addgene, cat. no. 27163, which was used as the internal control) at a ratio of 5:5:1 using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). Lysates were collected 48 h after transfection. Firefly and Renilla luciferase activities were measured using a Firefly luciferase Reporter Gene Assay kit (Beyotime Institute of Biotechnology).
Target gene prediction
The target genes of miRNAs were predicted using miRDB (mirdb.org/miRDB/), miRTarBase (mirtarbase.cuhk.edu.cn/php/index.php) and miRanda (microrna.org/) online analysis tools. To further enhance the reliability of bioinformatics analysis, the overlapping target genes were identified using a Venn diagram generated with VennDiagram package (version: 1.6.20) in R (version: 4.0.4).
ETS1 plasmid construction and rescue testing
The complete coding sequence of ETS1 was amplified by PCR from human genomic DNA using the forward primer, 5′- GGAATTCC GCCACCATGAGCTACTTTGTGGATTCT-3′ and reverse primer, 5′- ACGCGTCGACTCACTCGTCGGCATCTGG CTT-3′. The ETS1 plasmid was constructed by inserting the CDS into a mammalian expression vector, pCDH-EF1-copGFP (Addgene, Inc.), which contained a CMV promoter driving the expression of GFP and ETS1. The negative control used in this study was the empty vector. A total of 2.5 µg pCDH-EF1-copGFP-ETS1 (pCDH ETS1) or empty vector (pCDH Blank) was transfected into BEAS-2B cells (105 cells per well of 6-well plate) to rescue the low-expression induced by mimic transfection. Transfection was performed using Lipofectamine® 6000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. After 48 h, transfected cells were harvested for further detection.
Statistical analysis
All results are presented as the mean ± standard deviation (n=3 replicates for each experiment) and were analyzed using SPSS version 22.0 (IBM Corp.). Histograms were plotted using GraphPad Prism version 7 (GraphPad Software, Inc.). Differences between groups were compared using an unpaired Student's t-test or a one-way ANOVA with a Tukey's post hoc test where appropriate. P<0.05 was considered to indicate a statistically significant difference.
Results
miR-200b expression is upregulated in CS-exposed cells and lung cancer cell lines
Our previous study identified several differentially expressed miRNAs, including miR-200b-3p (miR-200b), based on the miRNA sequencing results (8) (Fig. 1A). The results from RT-qPCR analysis indicated that miR-200b was significantly upregulated in S10, S20 and S30 cells (Fig. 1B), as well as in humanlung cancer cells, including A549, H1299 and H226 (Fig. 1C). Next, the expression of miR-200b in six lung cancer datasets was analyzed. The results showed that miR-200b was significantly increased in lung cancer tissues when compared with normal tissues (Fig. 1D-I).
Figure 1.
miR-200b is upregulated in CS-exposed cells and lung cancer. (A) Reverse transcription-quantitative PCR analysis of miR-200b in (B) CS-exposed BEAS-2B cells and (C) lung cancer cells. Differential analysis of miR-200b expression in six datasets, (D) GSE62182, (E) GSE74190, (F) GSE51853, (G) GSE48414, as well as in the (H) LUAD and (I) LUSC datasets in The Cancer Genome Atlas. **P<0.01 vs. normal BEAS-2B cells. miR, microRNA; CS, cigarette smoke; qPCR, quantitative PCR; LUAD, lung adenocarcinoma; LUSC, lung squamous cell carcinoma.
miR-200b promotes migration of lung cancer cells
Using the LinkedOmics online tool, positively and negatively correlated genes of miR-200b-5p in LUAD and LUSC were obtained (Fig. S1A and B). A total of 380 and 818 overlapping genes were significantly positively and negatively correlated with miR-200b in both LUAD and LUSC datasets, respectively (Fig. S1C and D). Additionally, further enrichment analysis demonstrated that these correlated genes were significantly enriched in several cancer-related signaling pathways, particularly cell migration-related pathways, including ‘Focal adhesion’, ‘ECM-receptor interaction’, ‘Cell adhesion molecules’ and ‘NF-kappa B’ and ‘Jak-STAT’ signaling pathways (Fig. S1E). Transfection efficiency was evaluated by RT-qPCR and FAM-inhibitor NC. RT-qPCR results revealed that miR-200b-5p levels were elevated significantly in the mimic-transfected cells, compared with mimic NC-transfected cells (Fig. S2A). Fluorescent imaging demonstrated that the FAM-inhibitor NC became abundant within the cells, suggesting that the miRNA oligos used in this study were successfully transfected into BEAS-2B cells s(Fig. S2B). The results from the Transwell and wound-healing assays showed that transfection of cells with miR-200b mimic enhanced the migration of BEAS-2B cells. Conversely, transfection with the inhibitor of miR-200b significantly reduced the migratory capability of BEAS-2B cells (Fig. 2A-D). The results also showed that the mRNA expression levels of CDH1 were downregulated in cells transfected with miR-200b mimic, whereas they were upregulated in cells transfected with the miR-200b inhibitor (Fig. 2E). By contrast, CDH2 mRNA expression was upregulated in cells transfected with miR-200b mimic and downregulated in cells transfected with miR-200b inhibitors (Fig. 2F). The changes in protein levels of CDH1 and CDH2 in the transfected cells were consistent with the changes in mRNA expression (Fig. 2G-I).
Figure 2.
miR-200b promotes BEAS-2B cell migration. (A) Representative images and (B) quantification of wound healing assays showing cell migration was significantly increased in mimic-transfected BEAS-2B cells. (C) Representative images and (D) quantification of Transwell migration assays of BEAS-2B cells transfected with miR-200b mimics or inhibitors. Reverse transcription-quantitative PCR analysis of (E) CDH1 and (F) CDH2 expression in BEAS-2B cells transfected with mimics or inhibitors. (G) Western blot analysis of CDH1 and CDH2 in BEAS-2B cells transfected with mimics or inhibitors. Semi-quantitative results of the protein expression levels of (H) CDH1 and (I) CDH2 in BEAS-2B cells transfected with mimics or inhibitors. **P<0.01 vs. mimic NC group; #P<0.05, ##P<0.01 vs. inhibitor NC group. miR, microRNA; NC, negative control; CDH1, E-Cadherin; CDH2, N-Cadherin.
ETS1 is a target of miR-200b in lung cancer cells
Using the TargetScan, miRanda, miRWalk and miRTarBase online tools, a total of six intersected target genes of miR-200b were obtained, including ETS1, ZFPM2, RND3, E2F3, QKI and XIAP (Fig. 3A). The pathological analysis indicated that in TCGA LUAD dataset, ETS1 expression was downregulated in lung cancer tissues at advanced invasion depth (T2) compared with tissues at stage T1 (Fig. 3B). The decreased expression of ETS1 in lung cancer tissues of patients was found in TCGA LUAD (Fig. 3C), TCGA LUSC (Fig. 3D), GSE19804 (Fig. 3E), and GSE27262 (Fig. 3F) datasets, as well as in the proteomics dataset, CPTAC_LUAD (Fig. 3G). Additionally, the RT-qPCR and western blot analysis showed significant downregulation of ETS1 in S20 and S30 cells (Fig. 3H and I).
Figure 3.
ETS1 is a downstream target of miR-200b. (A) Venn diagram showing the intersection of the target genes predicted by four online tools, TargetScan, miRanda, miRWalk and miRTarBase. (B) In TCGA LUAD dataset, ETS1 was downregulated in lung cancer tissues at stage T2 compared with tissues at stage T1. Differential analysis of ETS1 expression in four datasets, (C) TCGA LUAD, (D) TCGA LUSC, (E) GSE19804 and (F) GSE27262, as well as the (G) CPTAC LUAD proteomics dataset. (H) Reverse transcription-quantitative PCR analysis showed ETS1 expression was downregulated in CS-exposed cells. (I) Western blotting results showed ETS1 protein expression was downregulated in CS-exposed cells. **P<0.01 vs. normal BEAS-2B cells. TCGA, The Cancer Gene Atlas; CPTAC, Clinical Proteomic Tumor Analysis Consortium; LUAD, lung adenocarcinoma; LUSC, lung squamous cell carcinoma; CS, cigarette smoke; miR, microRNA; ETS1, ETS proto-oncogene 1 transcription factor; ZFPM2, zinc finger protein ZFPM2; RND3, rho-related GTP-binding protein RhoE; E2F3, transcription factor E2F3; QKI, protein quaking; XIAP, E3 ubiquitin-protein ligase XIAP.
In addition, correlation analysis revealed that the expression levels of miR-200b were weakly and moderately negatively correlated with ETS1 mRNA expression in TCGA LUAD (Fig. 4A) and TCGA LUSC (Fig. 4B) datasets respectively. The mRNA and protein expression levels of ETS1 were significantly downregulated in cells transfected with miR-200b mimics, whereas expression was upregulated in cells transfected with inhibitors (Fig. 4C and D). As shown in Fig. 4E, two binding sites for miR-200b were present in the 3′UTR of ETS1. The relative luciferase activity of the reporter gene in BEAS-2B cells co-transfected with pGL3-ETS1 WT 3′UTR and miR-200b mimic was significantly decreased compared with the control (co-transfected with pGL3-ETS1 3′UTR and mimic NC). Mutating one of the two binding sites alone can still result in downregulation of relative luciferase activity when compared with mimic NC groups, whereas mutating both sites simultaneously avoids this downregulation (Fig. 4F).
Figure 4.
ETS1 is directly regulated by miR-200b. Correlation between ETS1 and miR-200b expression levels in (A) TCGA LUAD and (B) TCGA LUSC datasets. (C) ETS1 mRNA expression levels in the mimic- or inhibitor-transfected BEAS-2B cells. (D) Western blotting results of ETS1 expression in the mimic- or inhibitor-transfected BEAS-2B cells. (E) Sequence comparison between miR-200b-3p and the 3′UTR of ETS1. (F) Relative luciferase activity was measured in BEAS-2B cells co-transfected with 50 nM miR-200b mimic and the pGL3-ETS1 3′UTR construct. **P<0.01 vs. mimic NC group; ##P<0.01 vs. inhibitor NC group. TCGA, The Cancer Gene Atlas; LUAD, lung adenocarcinoma; LUSC, lung squamous cell carcinoma; UTR, untranslated region; miR, microRNA; ETS1, ETS proto-oncogene 1 transcription factor; NC, negative control; WT, wild-type; Mut, mutant.
ETS1 mediates the pro-migration effect of miR-200b
To further confirm that the effects of miR-200b were mediated by repression of ETS1 in BEAS-2B cells, rescue experiments in which ETS1 was overexpressed were performed. The transfection efficiency of ETS1 overexpression vectors was verified by RT-qPCR (Fig. S2C) and western blot (Fig. S2D and E). The enhanced migratory ability of BEAS-2B cells induced by miR-200b mimic was reduced by transfection of the ETS1 overexpression vector. Compared with the cells transfected with mimic NC and blank vector, BEAS-2B cells transfected with miR-200b mimic and blank vector exhibited increased migration ability. However, the enhanced migratory ability induced by the mimic miR-200b was downregulated by co-transfection with the ETS1 vector (Fig. 5A and B). In the wound healing assays, a similar trend was observed (Fig. 5C and D).
Figure 5.
Overexpression of ETS1 reverses the pro-migratory effect of miR-200b upregulation. (A) Representative images and (B) quantification of the Transwell migration assays of BEAS-2B cells co-transfected with miR-200b mimic and an ETS1 overexpression vector. (C) Representative images and (D) quantification of wound healing assays showing significant increases in cell migration in the miR-200b mimic-transfected BEAS-2B cells, which was partially reversed following ETS1 overexpression. pCDH Blank, empty pCDH-EF1-copGFP vector; pCDH ETS1, ETS1 overexpression plasmid constructed from pCDH-EF1-copGFP; miR, microRNA; ETS1, ETS proto-oncogene 1 transcription factor; NC, negative control.
Discussion
Previously, it has been reported that certain miRNAs directly activate EMT transcription factors, whereas others are able to reverse the EMT process by targeting several signaling pathways (10). In the present study, miR-200b was demonstrated to be involved in the migration and EMT process of lung cancer cells. miR-200b is a member of the miR-200 family and has been reported to serve contrasting roles in different types of cancer. Studies reported that its expression is downregulated in several malignant tumors, exhibiting a tumor-suppressing role (30–33). For example, miR-200b was identified as a repressor of invasiveness in esophageal squamous cell carcinoma by modulating multiple key cell cycle regulators and the Wnt/β-catenin signaling pathways (34). Conversely, miR-200b has also been found to promote cellular proliferation and serve a tumor-promoting role in several other tumors, such as cervical cancer and colorectal cancer, as well as in lung cancer (20,35–37). It has been reported that miRNA dysregulation may serve as a biomarker of damage caused by acute and chronic environmental exposure (38). Our previous miRNA high throughput sequencing analysis identified several differentially expressed miRNAs in the CS-induced malignantly transformed BEAS-2B cells (9). In the present study, elevated miR-200b levels were found in the CS-induced malignant BEAS-2B cells and several lung cancer cell lines, which was corroborated by analysis of external lung cancer tissue databases. Furthermore, it was demonstrated that miR-200b overexpression significantly enhanced the cellular migratory ability and EMT of cells as demonstrated by the reduction in CDH1 expression and increase in CDH2 expression levels. Importantly, these alterations in cell behavior have also been demonstrated in CS-induced malignantly transformed cells (9).ETS1 is a 54-kDa nuclear protein that serves a major role in the regulation of transcription factors (39). Transcription factors of the ETS family are involved in normal cell development, proliferation and differentiation (40). Previously, studies have found multiple miRNAs that downregulate ETS1 expression by directly targeting the 3′UTR region of ETS1 (41). For example, in humanhepatocellular carcinoma cells, miR-1, miR-129-5p, miR-193b and miR-499 can induce the downregulation of ETS1 expression, and thus reduce migration and invasion (42–44).Similar to a previous study (45), it was presented in the present study that ETS1 was a target gene of miR-200b, through multiple target gene prediction databases. The dual-luciferase reporter assay confirmed this targeting regulatory relationship between miR-200b and ETS1. However, multiple aspects distinguish the present study from previously published literature. In the present study, not only did we show the downregulation of ETS1 expression in lung cancer cell lines in vitro and in tumor tissue samples, but we also further confirmed this relationship using a controlled model of long-term CS-exposed cells. Moreover, in addition to establishing the importance of the miR-200b-ETS1 cascade in elevating the migratory ability of cells, we further showed a reversal of the miR-200b-induced increase in migration when ETS1 overexpression plasmids were transfected into the miR-200b overexpressing BEAS-2B cells. Similarly, this increase in migratory ability was dampened by transfection of miR-200b inhibitors.The present study had some limitations that are worth mentioning. First, only one cell line, the immortalized bronchial epithelial cell BEAS-2B, was used to investigate the role of miR-200b in promoting migration, while no lung cancer cell lines were used for comparative analysis. The present study also lacks the necessary animal experiments for miR-200b function. Further studies will shed more light on its function with more in vitro or in vivo experiments.In summary, the present study demonstrated the upregulation of miR-200b in CS-exposed BEAS-2B cells, lung cancer cell lines and tumor tissue samples. Downstream, miR-200b was shown to serve a carcinogenic role by targeting the 3′-UTR of ETS1, in-turn promoting cell migration and EMT. These insights into the miR-200b-ETS1 axis may facilitate the development of treatments for CS-induced lung cancer. With the development of improved delivery vehicles for these therapeutics, we hypothesize that miRNA therapies will soon become a clinical reality in the treatment of cancer.
Authors: Jeffrey R Whiteaker; Goran N Halusa; Andrew N Hoofnagle; Vagisha Sharma; Brendan MacLean; Ping Yan; John A Wrobel; Jacob Kennedy; D R Mani; Lisa J Zimmerman; Matthew R Meyer; Mehdi Mesri; Henry Rodriguez; Amanda G Paulovich Journal: Nat Methods Date: 2014-07 Impact factor: 28.547
Authors: Cherylle Goebel; Christopher L Louden; Robert McKenna; Osita Onugha; Andrew Wachtel; Thomas Long Journal: Cancer Genomics Proteomics Date: 2019 Jul-Aug Impact factor: 4.069
Authors: Matheus Correa-Costa; Vinicius Andrade-Oliveira; Tarcio T Braga; Angela Castoldi; Cristhiane F Aguiar; Clarice S T Origassa; Andrea C D Rodas; Meire I Hiyane; Denise M A C Malheiros; Francisco J O Rios; Sonia Jancar; Niels O S Câmara Journal: Lab Invest Date: 2014-02-03 Impact factor: 5.662