Literature DB >> 34105103

Discrimination of hospital isolates of Acinetobacter baumannii using repeated sequences and whole genome alignment differential analysis.

Roman Kotłowski1, Alicja Nowak-Zaleska2, Grzegorz Węgrzyn3.   

Abstract

An optimized method for bacterial strain differentiation, based on combination of Repeated Sequences and Whole Genome Alignment Differential Analysis (RS&WGADA), is presented in this report. In this analysis, 51 Acinetobacter baumannii multidrug-resistance strains from one hospital environment and patients from 14 hospital wards were classified on the basis of polymorphisms of repeated sequences located in CRISPR region, variation in the gene encoding the EmrA-homologue of E. coli, and antibiotic resistance patterns, in combination with three newly identified polymorphic regions in the genomes of A. baumannii clinical isolates. Differential analysis of two similarity matrices between different genotypes and resistance patterns allowed to distinguish three significant correlations (p < 0.05) between 172 bp DNA insertion combined with resistance to chloramphenicol and gentamycin. Interestingly, 45 and 55 bp DNA insertions within the CRISPR region were identified, and combined during analyses with resistance/susceptibility to trimethoprim/sulfamethoxazole. Moreover, 184 or 1374 bp DNA length polymorphisms in the genomic region located upstream of the GTP cyclohydrolase I gene, associated mainly with imipenem susceptibility, was identified. In addition, considerable nucleotide polymorphism of the gene encoding the gamma/tau subunit of DNA polymerase III, an enzyme crucial for bacterial DNA replication, was discovered. The differentiation analysis performed using the above described approach allowed us to monitor the distribution of A. baumannii isolates in different wards of the hospital in the time frame of several years, indicating that the optimized method may be useful in hospital epidemiological studies, particularly in identification of the source of primary infections.
© 2021. The Author(s).

Entities:  

Keywords:  Acinetobacter baumannii; Antibiotics; Assembled matrix data; DNA polymerase III gene DNA polymerase III subunit gamma/tau; Genetic polymorphisms; Hospital infections

Mesh:

Substances:

Year:  2021        PMID: 34105103      PMCID: PMC8357709          DOI: 10.1007/s13353-021-00640-5

Source DB:  PubMed          Journal:  J Appl Genet        ISSN: 1234-1983            Impact factor:   3.240


Introduction

The genome of each microorganism is a source of knowledge that can be applied for strain differentiation, based on bioinformatic tools and available techniques of molecular biology, suitable for epidemiological investigations. Among the species of the genus Acinetobacter, A. baumannii strains manifest the highest pathogenicity (Wong et al. 2017; Skariyachan et al. 2019). They are highly opportunistic microorganisms, responsible for hospital infections related to ability to adapt to different environmental conditions (Antunes et al. 2014). At the beginning of the twenty-first century, no complete genome sequence of Acinetobacter sp. was known. Barbe et al. (2004) published the first sequence of Acinetobacter sp. ADP1 genome, and later Smith et al. (2007) published the complete genome of A. baumannii ATCC 17,978. Subsequently, the first genomic sequence of the multidrug-resistant A. baumannii strain was published by Adams et al. (2008). Presently, complete sequences of the genomic DNA of A. baumannii are known for about 250 strains (http://www.ncbi.nlm.nih.gov, database retrieved on 10 December 2020). As indicated by various research teams, repeated sequences of A. baumannii and other microorganisms have great impact in the process of generating pathogenicity for immunocompromised hosts (Zhou et al. 2014; Shariat and Dudley 2014; Nabil et al. 2015) or adaptation skills to different environmental conditions (Zhou et al. 2014; Shariat and Dudley 2014; Karah et al. 2015). The presence of tandem DNA repeats in genomes of A. baumannii was confirmed by several groups (Martín-Lozano et al. 2002; Turton et al. 2009; Irfan et al. 2011; Pourcel et al. 2011; Minandri et al. 2012; Ergin et al. 2013; Ahmed and Alp 2015; Villalón et al. 2015). Based on these sequences, different methods of differentiation of A. baumannii strains have been developed; however, they take into account only their diversifying power of evolutionary changes of the Acinetobacter genus (Touchon et al. 2014). Thus, their features responsible for drug resistance or pseudo-immunological bacterial responses, encoded in the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) system, which evolved to protect the cells from exogenous phage and plasmid DNA invasion, are ignored in such analyses. On the other hand, as suggested by Touchon et al. (2014), the next step in the process of strains’ classification should be focused on confrontation of the genetic and phenotypic features related to pathogenicity of bacterial species. To address some of the above features, an optimized method for A. baumannii differential analysis is proposed in this report. It is based on combination of the previously described method based on analysis of repeated sequences (Nowak-Zaleska et al. 2008, 2016) and whole genome alignment.

Materials and methods

Bacterial strains

We used 51 A. baumannii isolates from diagnostic materials of the hospital environments of Antoni Jurasz University Hospital in Bydgoszcz. These isolates were derived from 11 hospital wards (Dermatology, Endocrinology, Geriatrics, General and Endocrine Surgery, General and Vascular Surgery, Intensive Care Units, Neurology, Nephrology, Neurosurgery, Orthopedic, Plastic Surgery), 2 clinics (Orthopedic Outpatient Clinic, Surgical Outpatient Clinic), and Rehabilitation Department. The isolates were collected during the period of 2003–2006 (Table 1). The following strains were isolated from different diagnostic materials: 10 from bronchoalveolar lavages, 8 from bedsores, 2 from blood, 1 from cerebrospinal fluid, 2 from drains, 2 from drain swabs, 1 from needle tip, 1 from pus, 8 from respiratory secretions, 2 from tracheostomy tube swabs, 1 from tube swab, 9 from ulceration wounds, and 4 from urine. Strains were identified based on ID GN phenotypic identification system, including drug sensitivity. This identification was conducted using Kirby–Bauer method, according to CLSI instructions (for details, see Nowak-Zaleska et al. 2008, 2016).
Table 1

Characteristics of multidrug-resistant Acinetobacter baumannii clinical isolates

NoIsolates*AntibiogramaGenotype patternbCombined analysis clustercSource of isolates#
12005VI.70.ICUI11Ulceration wound
22006III.107.NSII82Respiratory secretion
32006I.96.ICUII82BAL
42006I.95.ICUII82BAL
52006I.93.RII82Urine
62006I.92.ICUII82BAL
72006II.105.EII73Respiratory secretion
82006IV.108.NSII73CSF
92005XI.85.ICUII82BAL
102005XII.91.ICUII82BAL
112005XI.88.RII82Urine
122005XI.87.PSII82Bedsores
132006II.98.RII82Respiratory secretion
142005VI.71.RII104Respiratory secretion
152006II.100.GII104Urine
162006II.101.ICUII104Blood
172005X.79.NSII104Urine
182006II.102.ICUII95BAL
192005IV.68.RII136Drain swab
202003VI.43.G&ESII67Ulceration wound
212003VIII.45.OII67Drain swab
222003IX.48.NII67Tracheostomy tube swab
232004XI.61.OII158Ulceration wound
242004X.59.OCIII49Bedsores
252006I.94.NSIV810Respiratory secretion
262006II.104.NSIV711Respiratory secretion
272004VIII.55.OCV212Bedsores
282003XI.50.OV613Bedsores
292005I.65.OV414Drain
302003IX.47.ICUVI615BAL
312005VIII.72.G&ESVI1516Ulceration wound
322003VIII.44.ICUVII617Ulceration wound
332003IX.46.G&ESVII617Ulceration wound
342003III.42.ICUVII1218Tracheostomy tube swab
352003IX.49.DVIII1419Ulceration wound
362005IV.67.ICUIX1520Ulceration wound
372004IV.52.EX1521Bedsores
382006II.103.ICUX1521BAL
392004X.58.RX1521Tube swab
402005III.66.OXI422Drain
412004X.56.NSXII1123Blood
422004X.57.NSXII1524Bedsores
432004XI.63.RXIII325Pus
442004VIII.54.ICUXIII526BAL
452004XI.62.GXIII427Bedsores
462005 V.69.SCXIII1528Ulceration wound
472004VI.53.NXIV1629Bedsores
482006II.106.NSXV830Respiratory secretion
492005XII.90.NefXV830Respiratory secretion
502005IX.76.ICUXV1031BAL
512005IX.78.G&VSXV1031Needle tip
HGDI index0.80.88160.9718

aFor details of particular antibiogram patterns, see Table 5

bFor details of particular genotype patterns, see Table 4

cNumbers arisen from combination of antibiogram and genotype patterns

*Abbreviations for isolates (the last letter(s) in the name): D—Dermatology, E—Endocrinology, G—Geriatrics, G&ES—General and Endocrine Surgery, G&VS—General and Vascular Surgery, ICU—Intensive Care Unit, N—Neurology, Nef—Nephrology, NS—Neurosurgery, O—Orthopedic, OC—Orthopedic Outpatient Clinic, PS—Plastic Surgery, R—Rehabilitation, SC—Surgical Outpatient Clinic

#Abbreviations for source of isolates: BAL—bronchoalveolar lavage; CSF—cerebrospinal fluid

Characteristics of multidrug-resistant Acinetobacter baumannii clinical isolates aFor details of particular antibiogram patterns, see Table 5
Table 5

Set of different antibiotic resistance patterns determined for 51 MDR Acinetobacter baumannii strains

Resistance patternAntibiotic resistance/susceptibility
IPMNETNNCAZCIPCTXCFPTICATMSXTC/GMGM/CAN
IRSRSRRRRRRRRR
IISRRRRRRRRRRRR
IIISRSRRRRRRRRRR
IVSRRRRRRRRRRRS
VSRRRSRRRRRRRR
VISSRRRRRRRRRRR
VIISSSRRRRRRRRRR
VIIISSSSSSSSSSRRR
IXSSRRRRRIRRRRR
XSSIRRRRIRRRRR
XISRRRIRRRIRRRR
XIISIRRRRRRRRRRR
XIIISRRRRRRIRRRRR
XIVSRIRRRRIRRRRR
XVSRRRRRRRRRRRI

Meaning of symbols: R, resistance; S, susceptibility; I, intermediate phenotype

Antibiotics abbreviations: AN, amikacin; ATM, aztreonam; C, chloramphenicol; CAZ, ceftazidime; CFP, cefoperazone; CIP, ciprofloxacin; CTX, cefotaxime; GM, gentamycin; IPM, imipenem; NN, tobramycin; NET, netilmicin; SXT, trimethoprim/sulfamethoxazole; TIC, ticarcillin

Identical results for GM and C for different restriction patterns SsiI_1 and SsiI_2 are named C/GM and GM/C

bFor details of particular genotype patterns, see Table 4
Table 4

Set of different genotypes shown as PCR length polymorphisms in nucleotide base pairs for 51 MDR Acinetobacter baumannii isolates

GenotypesThree new PCR regions (length in bp)PCR-DR/RFLP region (length in bp)EmrA*—homologue gene fragment(length in bp)
Genomic region 1Aci7 and Aci8Genomic region 2Aci13 and Aci14Genomic region 3Aci17 and Aci18HaeIII patternSsiI pattern
#1#2#3#4#5#6#7#1#2#3#45#6#7#8
11561846001060636057544501371098876634338138
223418440510783786460595500111074614338126
320418440510682636057544501371098876634338126
421018440510682636057544501371098876634338126
523418440510682636057544501371098876634338126
622218440510682636057544501371098876634338126
723413745081068263605754451721341108976634237126
822213745081068263605754451721341108976634237126
921013745081068263605754451721341108976634237132
1021013745081068263605754451721341108976634237126
1118013745081068263605754451721341108976634237120
1214413743061097771645855001371098876634338132
13210137440510682636057544501371098876634338126
14210137440510682636057544501371098876634338132
1515613743061097771645855001371098876634338132
1616213743061097771645855001371098876634338132

*EmrA—an enzyme from Escherichia coli

#—restriction pattern number

cNumbers arisen from combination of antibiogram and genotype patterns *Abbreviations for isolates (the last letter(s) in the name): D—Dermatology, E—Endocrinology, G—Geriatrics, G&ES—General and Endocrine Surgery, G&VS—General and Vascular Surgery, ICU—Intensive Care Unit, N—Neurology, Nef—Nephrology, NS—Neurosurgery, O—Orthopedic, OC—Orthopedic Outpatient Clinic, PS—Plastic Surgery, R—Rehabilitation, SC—Surgical Outpatient Clinic #Abbreviations for source of isolates: BAL—bronchoalveolar lavage; CSF—cerebrospinal fluid

Locus identification with repeated sequences

The isolates of A. baumannii were differentiated on the basis of previously published polymorphisms of repeated sequences located in the CRISPR region (Touchon et al. 2014), variation in the gene encoding the EmrA homologue of E. coli (Nowak-Zaleska et al. 2016), and three newly identified (in this study) polymorphic regions (Tables 2 and 3).
Table 2

The sizes of PCR products for designed pairs of primers calculated for selected Acinetobacter baumannii genomes

Genome NCBI accession numbers* of Acinetobacter baumannii strainsPCR product length (bp)
Genomic region 1Genomic region 2Genomic region 3
Primer pairs:Aci7 and Aci8Primer pairs:Aci13 and Aci14Primer pairs:Aci17 and Aci18

CP001172.2

Acinetobacter baumannii AB307-0294

204184404

NC_011586.2

Acinetobacter baumannii AB0057

162184405

CP002522.2

Acinetobacter baumannii TCDC-AB0715

180236508

NC_010611.1

Acinetobacter baumannii ACICU

1441274508

CP001937.2

Acinetobacter baumannii MDR-ZJ06

2221374500

CP003500.1

Acinetobacter baumannii MDR-TJ

2221374508

CP003847.1

Acinetobacter baumannii BJAB0715

156186406

NZ_CP018664.1

Acinetobacter baumannii ATCC 17,978

210185306

NC_010410.1

Acinetobacter baumannii AYE

2341373405

*NCBI—National Center for Biotechnology Information

Table 3

Identification of proteins within amplified genomic regions of Acinetobacter baumannii MDR-TJ strain

No. of genomic regionsLocation of PCR productLocation of PCR product within Acinetobacter baumannii MDR-TJ genome, GenBank: CP003500.1
1

Aci7 and Aci8 1,558,399–1,558,566

bp

ACI7

5′GTGCTGTTCAGCCTGTTGAAGTTATTAG

ACI8

5′CAACTGCTGACTCAAGTCCAATCAACTC

Locus_tag = "ABTJ_01493" Product = "DNA polymerase III, subunit gamma/tau"

Protein_id = "AFI95102.1" 1,557,159..1559279 bp

2

Aci13 and Aci14 1,197,192–1,198,491

bp

ACI13

5′GAGGTACTAAAAATAAAAAGCGGGGATAAAAGTAGACAAG

ACI14

5′GTTGGGCTTTTTTTATAGCTGAACGCGATAAACTTC

Locus_tag = "ABTJ_01149" "Signal predicted by SignalP 3.0 HMM;

IMG reference gene:2510836153_SP"

Product = "hypothetical protein" Protein_id = "AFI94769.1" 1,196,033..1197184 bp

Locus_tag = "ABTJ_01151" Product = "hypothetical protein" Protein_id = "AFI94772.1" 1,197,921..1198355 bpLocus_tag = "ABTJ_01152" Product = "GTP cyclohydrolase I" 1,198,535..1199089 bp
3

Aci17 and Aci18 1,707,347–1,707,791

bp

ACI17

5′CAGTTTAAACAGGTGTCAAATCGTAAACAAATATTGATG

ACI18

5′GGCAGAAACTAGCCACGATGCAAGCA

Locus_tag = "ABTJ_01661" Product = "Protein of unknown function (DUF2750)"

1,706,849..1707274 bp

Locus_tag = "ABTJ_01662" Product = "hypothetical protein" Protein_id = "AFI95267.1"

1,707,761..1707994 bp

The sizes of PCR products for designed pairs of primers calculated for selected Acinetobacter baumannii genomes CP001172.2 Acinetobacter baumannii AB307-0294 NC_011586.2 Acinetobacter baumannii AB0057 CP002522.2 Acinetobacter baumannii TCDC-AB0715 NC_010611.1 Acinetobacter baumannii ACICU CP001937.2 Acinetobacter baumannii MDR-ZJ06 CP003500.1 Acinetobacter baumannii MDR-TJ CP003847.1 Acinetobacter baumannii BJAB0715 NZ_CP018664.1 Acinetobacter baumannii ATCC 17,978 NC_010410.1 Acinetobacter baumannii AYE *NCBI—National Center for Biotechnology Information Identification of proteins within amplified genomic regions of Acinetobacter baumannii MDR-TJ strain Aci7 and Aci8 1,558,399–1,558,566 bp ACI7 5′GTGCTGTTCAGCCTGTTGAAGTTATTAG ACI8 5′CAACTGCTGACTCAAGTCCAATCAACTC Locus_tag = "ABTJ_01493" Product = "DNA polymerase III, subunit gamma/tau" Protein_id = "AFI95102.1" 1,557,159..1559279 bp Aci13 and Aci14 1,197,192–1,198,491 bp ACI13 5′GAGGTACTAAAAATAAAAAGCGGGGATAAAAGTAGACAAG ACI14 5′GTTGGGCTTTTTTTATAGCTGAACGCGATAAACTTC Locus_tag = "ABTJ_01149" "Signal predicted by SignalP 3.0 HMM; IMG reference gene:2510836153_SP" Product = "hypothetical protein" Protein_id = "AFI94769.1" 1,196,033..1197184 bp Aci17 and Aci18 1,707,347–1,707,791 bp ACI17 5′CAGTTTAAACAGGTGTCAAATCGTAAACAAATATTGATG ACI18 5′GGCAGAAACTAGCCACGATGCAAGCA Locus_tag = "ABTJ_01661" Product = "Protein of unknown function (DUF2750)" 1,706,849..1707274 bp Locus_tag = "ABTJ_01662" Product = "hypothetical protein" Protein_id = "AFI95267.1" 1,707,761..1707994 bp

DNA-technology methods

The genetic material from the isolates was obtained using Genomic Mini Set, purchased from A&A Biotechnology (Gdynia, Poland), following the manufacturer’s instruction. For the DR-PCR/RFLP genotyping method, sequences of primers, the PCR reaction conditions, and enzymatic digestion of PCR products were previously described (Nowak-Zaleska et al. 2008). Briefly, the amplification reactions were conducted according to the following time–temperature profile: 94 °C for 2 min, during the initial denaturation step, 35 cycles consisting of the DNA denaturation at 94 °C for 1 min, hybridization at 68 °C for 1 min, and extension at 72 °C for 2 min. The amplification products were subjected to the restriction fragment length polymorphism (RFLP) analysis using HaeIII and SsiI restriction enzymes. Separation of restriction fragments was performed electrophoretically, in 12% polyacrylamide gels, and results were documented using Versa Doc Imaging System, ver. 1000. The homologous region of the emrA resistance-related gene, containing 6-nt repeats, was analyzed as described previously (Nowak-Zaleska et al. 2016). Identification of three newly discovered polymorphic regions was possible after multiple alignment of nine A. baumannii genomes (see Table 2), using the MAFFT 7.271 software (Katoh et al. 2002). Subsequently, three pairs of primers, shown in Table 3, were used in the PCR analysis. The PCR reactions were conducted in 25 μl reaction mixtures, using the Eppendorf AG 22,331 thermal cycler. The PCR mixtures were as follows: 1.5 U of RUN DNA polymerase (purchased from A&A Biotechnology), PCR reaction buffer containing 10 mM KCl, 10 mM (NH4)2SO4, 0.1% Triton X-100, 20 mM Tris, pH 8.5, 2 mM of Mg2Cl, 2 mM of each deoxynucleoside triphosphates, 25 pM of suitable pairs of primers, and 50 ng/μl of template DNA. Amplified PCR products were separated using 2% agarose gel electrophoresis and standard ethidium bromide staining procedure (Sambrook et al. 1989). Images of the gels were obtained using Versa Doc Imaging System, ver. 1000.

Statistical analysis

Statistical analysis was performed using Epi Info 7.2.3.1 software using two-tailed Fisher exact test analysis. The values “1” and “0” were representing resistant and susceptible strains for different antibiotics used in our study. Similarity matrices of different genotypes and resistance features and phylogenetic trees were constructed using package MVSP ver. 3.22.

Results and discussion

To enhance the currently available methods of differentiation of A. baumannii strains, we were searching for previously unknown PCR-derived fragment length polymorphism variations in randomly identified regions of selected genomic sequences. The theoretical values of PCR fragment lengths of the newly discovered polymorphic regions for nine A. baumannii genomes are presented in Table 2. Among three identified polymorphic regions, only one was characterized by the highest length polymorphism. It was recognized as a gene fragment coding for DNA polymerase III subunit gamma/tau, with the Protein_id = AFI95102.1 in the MDR-TJ A. baumannii genome (GenBank accession no. CP003500.1) (Table 3). In order to increase variation of analyzed A. baumannii isolates, two other previously described variable regions in the genomes of A. baumannii were included in our study (Nowak-Zaleska et al. 2008, 2016). The combined application of the three genetic aforementioned genotypic methods, DR-PCR/RFLP, different number of P-A dipeptide repeats encoded in the N-terminal part of EmrA-homologue gene, as well as three new variables, namely, Aci7 and Aci8, Aci13 and Aci14, and Aci17 and Aci18 (Table 4), combined with known information about resistance patterns for each isolate (Table 5), allowed for recognition of 31 different clusters shown in Table 1. Set of different genotypes shown as PCR length polymorphisms in nucleotide base pairs for 51 MDR Acinetobacter baumannii isolates *EmrA—an enzyme from Escherichia coli #—restriction pattern number Set of different antibiotic resistance patterns determined for 51 MDR Acinetobacter baumannii strains Meaning of symbols: R, resistance; S, susceptibility; I, intermediate phenotype Antibiotics abbreviations: AN, amikacin; ATM, aztreonam; C, chloramphenicol; CAZ, ceftazidime; CFP, cefoperazone; CIP, ciprofloxacin; CTX, cefotaxime; GM, gentamycin; IPM, imipenem; NN, tobramycin; NET, netilmicin; SXT, trimethoprim/sulfamethoxazole; TIC, ticarcillin Identical results for GM and C for different restriction patterns SsiI_1 and SsiI_2 are named C/GM and GM/C Detailed analysis of bacterial isolates and diagnostic material revealed significant differences between A. baumannii isolates from bronchoalveolar lavage (BAL) and other clinical samples (p < 0.0001), as well as significant correlation between resistance pattern II and genotype 8th (p < 0.01), presented in Table 1. In addition, significant correlation (p < 0.05) between the frequency of occurrence of 8th A. baumannii genotype in the first trimester of 2006 year in comparison to other periods of isolation time was also evident. Higher Hunter–Gaston Discriminatory Index (HGDI), presented in Table 1, was determined using the method developed in this study, in comparison to previously published genotyping methods (Nowak-Zaleska et al. 2008, 2016). Furthermore, in the course of statistical data analysis, we observed that strains representing clusters 2 and 4 from combined genetic–phenotypic analysis, shown in Table 1, were isolated in two consecutive years 2005 and 2006 (p < 0.0001). These strains represent the 15th genotype pattern, which was present in 2004 and 2005, but with different resistance patterns II, VI, IX, X, XII, and XIII (p = 0.01). In addition, three strains representing 21st cluster with the resistance pattern X appeared in years 2004 and 2006. Moreover, strains with genotypes 6, 12, and 14 were only present in 2003 (p < 0.0001), in comparison to other genotypes, and what is interesting, the resistance pattern II appeared each year, while patterns V, VI, VII, and VIII appeared only between 2003 and 2005 (p = 0.01). Combined analysis of similarity matrices, obtained using data from Tables 4 and 5, revealed that out of 19 combinations of genetic and resistance markers, only three were significantly different (p < 0.05) (Table 6), as indicated by χ2 value higher than 4, obtained from two phylogenetic trees presented in Fig. 1. Among significantly different mixed parameters identified, there were (1) 172 bp DNA insertion, located in the CRISPR locus, identified using the SsiI enzyme for genotypes 7 to 11, in combination with resistance to chloramphenicol and gentamycin; (2) 45 and 55 bp DNA insertions in the same locus, identified using the HaeIII enzyme, combined with trimethoprim/sulfamethoxazole resistance or susceptibility patterns; and (3) 184 or 1374 bps DNA length polymorphisms in the second genomic region (see tree new PCR region, Table 4), identified in our study for genotypes 1 to 6 and 7 to 16, in combination with imipenem resistance, characteristic for pattern I or susceptibility features, characteristic for other patterns (Table 6).
Table 6

Set of two joined-similarity matrices obtained for 19 different genotypes indicated by underlined values, and for 19 different antibiotic resistance patterns. All values are from the range between 1 and 100%. Abbreviations "_s" and "_r" indicate intermediate resistance patterns considered two times as susceptible or resistant, respectively. The "0" value was replaced by "1E-06" for diagonal correlation calculation purposes. Significant (p < 0.05) combinations of genetic and resistance/susceptibility features are highlighted in black

Fig. 1

Phylogenetic trees for different pairs of genetic polymorphisms and resistance/susceptibility features. Branches order obtained based on nearest neighbor method and length–distance calculation based on χ2 method. Significant (p < 0.05) differences indicated in black boxes were identified based on cut-off χ2 value = 4

Set of two joined-similarity matrices obtained for 19 different genotypes indicated by underlined values, and for 19 different antibiotic resistance patterns. All values are from the range between 1 and 100%. Abbreviations "_s" and "_r" indicate intermediate resistance patterns considered two times as susceptible or resistant, respectively. The "0" value was replaced by "1E-06" for diagonal correlation calculation purposes. Significant (p < 0.05) combinations of genetic and resistance/susceptibility features are highlighted in black Phylogenetic trees for different pairs of genetic polymorphisms and resistance/susceptibility features. Branches order obtained based on nearest neighbor method and length–distance calculation based on χ2 method. Significant (p < 0.05) differences indicated in black boxes were identified based on cut-off χ2 value = 4 The presence of A. baumannii genotypes over a period of 4 years in the hospital wards (Table 7), and location of determined genotypes over a 4-year period in hospital wards (Table 8), was also assessed. This analysis provides a possibility to identify the presence of specific isolates in various wards over the period of several years. We suggest that such analyses may be useful in epidemiological studies on the origin and migration of particular bacterial strains between different wards of an investigated hospital. It also gives the possibility to analyze the strains regardless of the time period in which they were collected.
Table 7

Presence of A. baumannii genotypes over a period of 4 years

Year of isolation of the strain (number of genotypes determined)WardGenotype(number of isolates)
2006(5)ICU8 (3), 10, 9, 15
NS8 (3), 7 (2)
R8 (2)
E7
G10
2005(6)ICU1, 8 (2), 15, 10
R8, 10, 13
PS8
NS10
O4 (2)
G&ES15
SC15
Nef8
G&VS10
2004(7)ICU5
O15
OC4, 2
E15
R15, 3
NS11, 15
G4
N16
2003(3)ICU6 (2), 12
G&ES6 (2)
O6 (2)
N6
D14

Abbreviations for wards: D—Dermatology, E—Endocrinology, G—Geriatrics, G&ES—General and Endocrine Surgery, G&VS—General and Vascular Surgery, ICU—Intensive Care Unit, N—Neurology, Nef—Nephrology, NS—Neurosurgery, O—Orthopedic, OC—Orthopedic Outpatient Clinic, PS—Plastic Surgery, R—Rehabilitation, SC—Surgical Outpatient Clinic

Table 8

Location of determined genotypes over a 4-year period in hospital wards

GenotypeYear(number of genotypes)Hospital ward(s)
152006(1)ICU
2005(3)ICU, G&ES, SC
2004(4)O, E, R, NS
82006(8)ICU, NS, R
2005(5)ICU, R, Nef
102006(2)ICU, G
2005(4)ICU, R, NS, G&VS
42005(2)O
2004(2)OC, G
62003(7)ICU, G&ES, O, N
72006(3)E
12005(1)ICU
22004(1)ICU
32004(1)R
52004(1)ICU
92006(1)ICU
112004(1)NS
122003(1)ICU
132005(1)R
142003(1)D
162004(1)N

Abbreviations for wards: D—Dermatology, E—Endocrinology, G—Geriatrics, G&ES—General and Endocrine Surgery, G&VS—General and Vascular Surgery, ICU—Intensive Care Unit, N—Neurology, Nef—Nephrology, NS—Neurosurgery, O—Orthopedic, OC—Orthopedic Outpatient Clinic, PS—Plastic Surgery, R—Rehabilitation, SC—Surgical Outpatient Clinic

Presence of A. baumannii genotypes over a period of 4 years Abbreviations for wards: D—Dermatology, E—Endocrinology, G—Geriatrics, G&ES—General and Endocrine Surgery, G&VS—General and Vascular Surgery, ICU—Intensive Care Unit, N—Neurology, Nef—Nephrology, NS—Neurosurgery, O—Orthopedic, OC—Orthopedic Outpatient Clinic, PS—Plastic Surgery, R—Rehabilitation, SC—Surgical Outpatient Clinic Location of determined genotypes over a 4-year period in hospital wards Abbreviations for wards: D—Dermatology, E—Endocrinology, G—Geriatrics, G&ES—General and Endocrine Surgery, G&VS—General and Vascular Surgery, ICU—Intensive Care Unit, N—Neurology, Nef—Nephrology, NS—Neurosurgery, O—Orthopedic, OC—Orthopedic Outpatient Clinic, PS—Plastic Surgery, R—Rehabilitation, SC—Surgical Outpatient Clinic

Conclusions

In conclusion, 16 different genotypes out of 51 MDR A. baumannii clinical isolates were identified in our study. Based on combined comparative analysis of genetic and resistance patterns, two significantly different patterns of DNA polymorphisms in the CRISPR coding region, resistance to chloramphenicol and gentamycin features, and resistance or susceptibility to trimethoprim/sulfamethoxazole, specific groups of isolates were identified. Out of 19 genetic markers and antibiotic resistance features, three of them were shown to be statistically significantly different using two statistical tools (Table 6, Fig. 1). In addition, 184 or 1374 bp DNA length polymorphisms in genomic region no. 2, located upstream of the GTP cyclohydrolase I gene, with the Locus_tag = "ABTJ_01152", associated in 94% with susceptibility to imipenem, was identified. Finally, the highest genetic diversity, determined within the DNA polymerase III subunit gamma/tau gene, can be recommended for future genotyping of multidrug-resistant A. baumannii strains. We suggest that the optimized methods, proposed in this report and based on combination of Repeated Sequences and Whole Genome Alignment Differential Analysis (RS&WGADA), can be useful in epidemiological studies concerning specific strains of pathogenic bacteria present in investigated hospitals.
  21 in total

Review 1.  Clinical and Pathophysiological Overview of Acinetobacter Infections: a Century of Challenges.

Authors:  Darren Wong; Travis B Nielsen; Robert A Bonomo; Paul Pantapalangkoor; Brian Luna; Brad Spellberg
Journal:  Clin Microbiol Rev       Date:  2017-01       Impact factor: 26.132

2.  Molecular characterization of oxacillinases and genotyping of invasive Acinetobacter baumannii isolates using repetitive extragenic palindromic sequence-based polymerase chain reaction in Ankara between 2004 and 2010.

Authors:  Alper Ergin; Gülsen Hascelik; Ozgen Koseoglu Eser
Journal:  Scand J Infect Dis       Date:  2012-09-15

3.  Correlation between the number of Pro-Ala repeats in the EmrA homologue of Acinetobacter baumannii and resistance to netilmicin, tobramycin, imipenem and ceftazidime.

Authors:  Alicja Nowak-Zaleska; Miłosz Wieczór; Jacek Czub; Łukasz Nierzwicki; Roman Kotłowski; Agnieszka Mikucka; Eugenia Gospodarek
Journal:  J Glob Antimicrob Resist       Date:  2016-10-21       Impact factor: 4.035

4.  Comparison of a repetitive extragenic palindromic sequence-based PCR method and clinical and microbiological methods for determining strain sources in cases of nosocomial Acinetobacter baumannii bacteremia.

Authors:  David Martín-Lozano; José Miguel Cisneros; Berta Becerril; Lucila Cuberos; Trinidad Prados; Carlos Ortíz-Leyba; Elías Cañas; Jerónimo Pachón
Journal:  J Clin Microbiol       Date:  2002-12       Impact factor: 5.948

Review 5.  Genotyping methods for monitoring the epidemic evolution of A. baumannii strains.

Authors:  Salman Shaheer Ahmed; Emine Alp
Journal:  J Infect Dev Ctries       Date:  2015-04-15       Impact factor: 0.968

6.  Unique features revealed by the genome sequence of Acinetobacter sp. ADP1, a versatile and naturally transformation competent bacterium.

Authors:  Valérie Barbe; David Vallenet; Nuria Fonknechten; Annett Kreimeyer; Sophie Oztas; Laurent Labarre; Stéphane Cruveiller; Catherine Robert; Simone Duprat; Patrick Wincker; L Nicholas Ornston; Jean Weissenbach; Philippe Marlière; Georges N Cohen; Claudine Médigue
Journal:  Nucleic Acids Res       Date:  2004-10-28       Impact factor: 16.971

7.  Comparative genome sequence analysis of multidrug-resistant Acinetobacter baumannii.

Authors:  Mark D Adams; Karrie Goglin; Neil Molyneaux; Kristine M Hujer; Heather Lavender; Jennifer J Jamison; Ian J MacDonald; Kristienna M Martin; Thomas Russo; Anthony A Campagnari; Andrea M Hujer; Robert A Bonomo; Steven R Gill
Journal:  J Bacteriol       Date:  2008-10-17       Impact factor: 3.490

Review 8.  Acinetobacter baumannii: evolution of a global pathogen.

Authors:  Luísa C S Antunes; Paolo Visca; Kevin J Towner
Journal:  Pathog Dis       Date:  2014-01-27       Impact factor: 3.166

9.  New insights into Acinetobacter baumannii pathogenesis revealed by high-density pyrosequencing and transposon mutagenesis.

Authors:  Michael G Smith; Tara A Gianoulis; Stefan Pukatzki; John J Mekalanos; L Nicholas Ornston; Mark Gerstein; Michael Snyder
Journal:  Genes Dev       Date:  2007-03-01       Impact factor: 11.361

10.  Endemic and epidemic Acinetobacter baumannii clones: a twelve-year study in a tertiary care hospital.

Authors:  Pilar Villalón; Sylvia Valdezate; Teresa Cabezas; Montserrat Ortega; Noelia Garrido; Ana Vindel; María J Medina-Pascual; Juan A Saez-Nieto
Journal:  BMC Microbiol       Date:  2015-02-25       Impact factor: 3.605

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.