| Literature DB >> 34105103 |
Roman Kotłowski1, Alicja Nowak-Zaleska2, Grzegorz Węgrzyn3.
Abstract
An optimized method for bacterial strain differentiation, based on combination of Repeated Sequences and Whole Genome Alignment Differential Analysis (RS&WGADA), is presented in this report. In this analysis, 51 Acinetobacter baumannii multidrug-resistance strains from one hospital environment and patients from 14 hospital wards were classified on the basis of polymorphisms of repeated sequences located in CRISPR region, variation in the gene encoding the EmrA-homologue of E. coli, and antibiotic resistance patterns, in combination with three newly identified polymorphic regions in the genomes of A. baumannii clinical isolates. Differential analysis of two similarity matrices between different genotypes and resistance patterns allowed to distinguish three significant correlations (p < 0.05) between 172 bp DNA insertion combined with resistance to chloramphenicol and gentamycin. Interestingly, 45 and 55 bp DNA insertions within the CRISPR region were identified, and combined during analyses with resistance/susceptibility to trimethoprim/sulfamethoxazole. Moreover, 184 or 1374 bp DNA length polymorphisms in the genomic region located upstream of the GTP cyclohydrolase I gene, associated mainly with imipenem susceptibility, was identified. In addition, considerable nucleotide polymorphism of the gene encoding the gamma/tau subunit of DNA polymerase III, an enzyme crucial for bacterial DNA replication, was discovered. The differentiation analysis performed using the above described approach allowed us to monitor the distribution of A. baumannii isolates in different wards of the hospital in the time frame of several years, indicating that the optimized method may be useful in hospital epidemiological studies, particularly in identification of the source of primary infections.Entities:
Keywords: Acinetobacter baumannii; Antibiotics; Assembled matrix data; DNA polymerase III gene DNA polymerase III subunit gamma/tau; Genetic polymorphisms; Hospital infections
Mesh:
Substances:
Year: 2021 PMID: 34105103 PMCID: PMC8357709 DOI: 10.1007/s13353-021-00640-5
Source DB: PubMed Journal: J Appl Genet ISSN: 1234-1983 Impact factor: 3.240
Characteristics of multidrug-resistant Acinetobacter baumannii clinical isolates
| No | Isolates* | Antibiograma | Genotype patternb | Combined analysis clusterc | Source of isolates# |
|---|---|---|---|---|---|
| 1 | 2005VI.70.ICU | I | 1 | 1 | Ulceration wound |
| 2 | 2006III.107.NS | II | 8 | 2 | Respiratory secretion |
| 3 | 2006I.96.ICU | II | 8 | 2 | BAL |
| 4 | 2006I.95.ICU | II | 8 | 2 | BAL |
| 5 | 2006I.93.R | II | 8 | 2 | Urine |
| 6 | 2006I.92.ICU | II | 8 | 2 | BAL |
| 7 | 2006II.105.E | II | 7 | 3 | Respiratory secretion |
| 8 | 2006IV.108.NS | II | 7 | 3 | CSF |
| 9 | 2005XI.85.ICU | II | 8 | 2 | BAL |
| 10 | 2005XII.91.ICU | II | 8 | 2 | BAL |
| 11 | 2005XI.88.R | II | 8 | 2 | Urine |
| 12 | 2005XI.87.PS | II | 8 | 2 | Bedsores |
| 13 | 2006II.98.R | II | 8 | 2 | Respiratory secretion |
| 14 | 2005VI.71.R | II | 10 | 4 | Respiratory secretion |
| 15 | 2006II.100.G | II | 10 | 4 | Urine |
| 16 | 2006II.101.ICU | II | 10 | 4 | Blood |
| 17 | 2005X.79.NS | II | 10 | 4 | Urine |
| 18 | 2006II.102.ICU | II | 9 | 5 | BAL |
| 19 | 2005IV.68.R | II | 13 | 6 | Drain swab |
| 20 | 2003VI.43.G&ES | II | 6 | 7 | Ulceration wound |
| 21 | 2003VIII.45.O | II | 6 | 7 | Drain swab |
| 22 | 2003IX.48.N | II | 6 | 7 | Tracheostomy tube swab |
| 23 | 2004XI.61.O | II | 15 | 8 | Ulceration wound |
| 24 | 2004X.59.OC | III | 4 | 9 | Bedsores |
| 25 | 2006I.94.NS | IV | 8 | 10 | Respiratory secretion |
| 26 | 2006II.104.NS | IV | 7 | 11 | Respiratory secretion |
| 27 | 2004VIII.55.OC | V | 2 | 12 | Bedsores |
| 28 | 2003XI.50.O | V | 6 | 13 | Bedsores |
| 29 | 2005I.65.O | V | 4 | 14 | Drain |
| 30 | 2003IX.47.ICU | VI | 6 | 15 | BAL |
| 31 | 2005VIII.72.G&ES | VI | 15 | 16 | Ulceration wound |
| 32 | 2003VIII.44.ICU | VII | 6 | 17 | Ulceration wound |
| 33 | 2003IX.46.G&ES | VII | 6 | 17 | Ulceration wound |
| 34 | 2003III.42.ICU | VII | 12 | 18 | Tracheostomy tube swab |
| 35 | 2003IX.49.D | VIII | 14 | 19 | Ulceration wound |
| 36 | 2005IV.67.ICU | IX | 15 | 20 | Ulceration wound |
| 37 | 2004IV.52.E | X | 15 | 21 | Bedsores |
| 38 | 2006II.103.ICU | X | 15 | 21 | BAL |
| 39 | 2004X.58.R | X | 15 | 21 | Tube swab |
| 40 | 2005III.66.O | XI | 4 | 22 | Drain |
| 41 | 2004X.56.NS | XII | 11 | 23 | Blood |
| 42 | 2004X.57.NS | XII | 15 | 24 | Bedsores |
| 43 | 2004XI.63.R | XIII | 3 | 25 | Pus |
| 44 | 2004VIII.54.ICU | XIII | 5 | 26 | BAL |
| 45 | 2004XI.62.G | XIII | 4 | 27 | Bedsores |
| 46 | 2005 V.69.SC | XIII | 15 | 28 | Ulceration wound |
| 47 | 2004VI.53.N | XIV | 16 | 29 | Bedsores |
| 48 | 2006II.106.NS | XV | 8 | 30 | Respiratory secretion |
| 49 | 2005XII.90.Nef | XV | 8 | 30 | Respiratory secretion |
| 50 | 2005IX.76.ICU | XV | 10 | 31 | BAL |
| 51 | 2005IX.78.G&VS | XV | 10 | 31 | Needle tip |
| HGDI index | 0.8 | 0.8816 | 0.9718 | ||
aFor details of particular antibiogram patterns, see Table 5
bFor details of particular genotype patterns, see Table 4
cNumbers arisen from combination of antibiogram and genotype patterns
*Abbreviations for isolates (the last letter(s) in the name): D—Dermatology, E—Endocrinology, G—Geriatrics, G&ES—General and Endocrine Surgery, G&VS—General and Vascular Surgery, ICU—Intensive Care Unit, N—Neurology, Nef—Nephrology, NS—Neurosurgery, O—Orthopedic, OC—Orthopedic Outpatient Clinic, PS—Plastic Surgery, R—Rehabilitation, SC—Surgical Outpatient Clinic
#Abbreviations for source of isolates: BAL—bronchoalveolar lavage; CSF—cerebrospinal fluid
Set of different antibiotic resistance patterns determined for 51 MDR Acinetobacter baumannii strains
| Resistance pattern | Antibiotic resistance/susceptibility | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| IPM | NET | NN | CAZ | CIP | CTX | CFP | TIC | ATM | SXT | C/GM | GM/C | AN | |
| I | R | S | R | S | R | R | R | R | R | R | R | R | R |
| II | S | R | R | R | R | R | R | R | R | R | R | R | R |
| III | S | R | S | R | R | R | R | R | R | R | R | R | R |
| IV | S | R | R | R | R | R | R | R | R | R | R | R | S |
| V | S | R | R | R | S | R | R | R | R | R | R | R | R |
| VI | S | S | R | R | R | R | R | R | R | R | R | R | R |
| VII | S | S | S | R | R | R | R | R | R | R | R | R | R |
| VIII | S | S | S | S | S | S | S | S | S | S | R | R | R |
| IX | S | S | R | R | R | R | R | I | R | R | R | R | R |
| X | S | S | I | R | R | R | R | I | R | R | R | R | R |
| XI | S | R | R | R | I | R | R | R | I | R | R | R | R |
| XII | S | I | R | R | R | R | R | R | R | R | R | R | R |
| XIII | S | R | R | R | R | R | R | I | R | R | R | R | R |
| XIV | S | R | I | R | R | R | R | I | R | R | R | R | R |
| XV | S | R | R | R | R | R | R | R | R | R | R | R | I |
Meaning of symbols: R, resistance; S, susceptibility; I, intermediate phenotype
Antibiotics abbreviations: AN, amikacin; ATM, aztreonam; C, chloramphenicol; CAZ, ceftazidime; CFP, cefoperazone; CIP, ciprofloxacin; CTX, cefotaxime; GM, gentamycin; IPM, imipenem; NN, tobramycin; NET, netilmicin; SXT, trimethoprim/sulfamethoxazole; TIC, ticarcillin
Identical results for GM and C for different restriction patterns SsiI_1 and SsiI_2 are named C/GM and GM/C
Set of different genotypes shown as PCR length polymorphisms in nucleotide base pairs for 51 MDR Acinetobacter baumannii isolates
| Genotypes | Three new PCR regions (length in bp) | PCR-DR/RFLP region (length in bp) | EmrA*—homologue gene fragment | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Genomic region 1 | Genomic region 2 | Genomic region 3 | |||||||||||||||||
| #1 | #2 | #3 | #4 | #5 | #6 | #7 | #1 | #2 | #3 | #4 | 5 | #6 | #7 | #8 | |||||
| 1 | 156 | 184 | 600 | 106 | 0 | 63 | 60 | 57 | 54 | 45 | 0 | 137 | 109 | 88 | 76 | 63 | 43 | 38 | 138 |
| 2 | 234 | 184 | 405 | 107 | 83 | 78 | 64 | 60 | 59 | 55 | 0 | 0 | 111 | 0 | 74 | 61 | 43 | 38 | 126 |
| 3 | 204 | 184 | 405 | 106 | 82 | 63 | 60 | 57 | 54 | 45 | 0 | 137 | 109 | 88 | 76 | 63 | 43 | 38 | 126 |
| 4 | 210 | 184 | 405 | 106 | 82 | 63 | 60 | 57 | 54 | 45 | 0 | 137 | 109 | 88 | 76 | 63 | 43 | 38 | 126 |
| 5 | 234 | 184 | 405 | 106 | 82 | 63 | 60 | 57 | 54 | 45 | 0 | 137 | 109 | 88 | 76 | 63 | 43 | 38 | 126 |
| 6 | 222 | 184 | 405 | 106 | 82 | 63 | 60 | 57 | 54 | 45 | 0 | 137 | 109 | 88 | 76 | 63 | 43 | 38 | 126 |
| 7 | 234 | 1374 | 508 | 106 | 82 | 63 | 60 | 57 | 54 | 45 | 172 | 134 | 110 | 89 | 76 | 63 | 42 | 37 | 126 |
| 8 | 222 | 1374 | 508 | 106 | 82 | 63 | 60 | 57 | 54 | 45 | 172 | 134 | 110 | 89 | 76 | 63 | 42 | 37 | 126 |
| 9 | 210 | 1374 | 508 | 106 | 82 | 63 | 60 | 57 | 54 | 45 | 172 | 134 | 110 | 89 | 76 | 63 | 42 | 37 | 132 |
| 10 | 210 | 1374 | 508 | 106 | 82 | 63 | 60 | 57 | 54 | 45 | 172 | 134 | 110 | 89 | 76 | 63 | 42 | 37 | 126 |
| 11 | 180 | 1374 | 508 | 106 | 82 | 63 | 60 | 57 | 54 | 45 | 172 | 134 | 110 | 89 | 76 | 63 | 42 | 37 | 120 |
| 12 | 144 | 1374 | 306 | 109 | 77 | 71 | 64 | 58 | 55 | 0 | 0 | 137 | 109 | 88 | 76 | 63 | 43 | 38 | 132 |
| 13 | 210 | 1374 | 405 | 106 | 82 | 63 | 60 | 57 | 54 | 45 | 0 | 137 | 109 | 88 | 76 | 63 | 43 | 38 | 126 |
| 14 | 210 | 1374 | 405 | 106 | 82 | 63 | 60 | 57 | 54 | 45 | 0 | 137 | 109 | 88 | 76 | 63 | 43 | 38 | 132 |
| 15 | 156 | 1374 | 306 | 109 | 77 | 71 | 64 | 58 | 55 | 0 | 0 | 137 | 109 | 88 | 76 | 63 | 43 | 38 | 132 |
| 16 | 162 | 1374 | 306 | 109 | 77 | 71 | 64 | 58 | 55 | 0 | 0 | 137 | 109 | 88 | 76 | 63 | 43 | 38 | 132 |
*EmrA—an enzyme from Escherichia coli
#—restriction pattern number
The sizes of PCR products for designed pairs of primers calculated for selected Acinetobacter baumannii genomes
| Genome NCBI accession numbers* of | PCR product length (bp) | ||
|---|---|---|---|
| Genomic region 1 | Genomic region 2 | Genomic region 3 | |
| Primer pairs: | Primer pairs: | Primer pairs: | |
CP001172.2 | 204 | 184 | 404 |
NC_011586.2 | 162 | 184 | 405 |
CP002522.2 | 180 | 236 | 508 |
NC_010611.1 | 144 | 1274 | 508 |
CP001937.2 | 222 | 1374 | 500 |
CP003500.1 | 222 | 1374 | 508 |
CP003847.1 | 156 | 186 | 406 |
NZ_CP018664.1 | 210 | 185 | 306 |
NC_010410.1 | 234 | 1373 | 405 |
*NCBI—National Center for Biotechnology Information
Identification of proteins within amplified genomic regions of Acinetobacter baumannii MDR-TJ strain
| No. of genomic regions | Location of PCR product | Location of PCR product within | |||
|---|---|---|---|---|---|
| 1 | Aci7 and Aci8 1,558,399–1,558,566 bp | ACI7 5′GTGCTGTTCAGCCTGTTGAAGTTATTAG ACI8 5′CAACTGCTGACTCAAGTCCAATCAACTC | |||
Locus_tag = "ABTJ_01493" Product = "DNA polymerase III, subunit gamma/tau" Protein_id = "AFI95102.1" 1,557,159..1559279 bp | |||||
| 2 | Aci13 and Aci14 1,197,192–1,198,491 bp | ACI13 5′GAGGTACTAAAAATAAAAAGCGGGGATAAAAGTAGACAAG ACI14 5′GTTGGGCTTTTTTTATAGCTGAACGCGATAAACTTC | |||
Locus_tag = "ABTJ_01149" "Signal predicted by SignalP 3.0 HMM; IMG reference gene:2510836153_SP" Product = "hypothetical protein" Protein_id = "AFI94769.1" 1,196,033..1197184 bp | Locus_tag = "ABTJ_01151" Product = "hypothetical protein" Protein_id = "AFI94772.1" 1,197,921..1198355 bp | Locus_tag = "ABTJ_01152" Product = "GTP cyclohydrolase I" 1,198,535..1199089 bp | |||
| 3 | Aci17 and Aci18 1,707,347–1,707,791 bp | ACI17 5′CAGTTTAAACAGGTGTCAAATCGTAAACAAATATTGATG ACI18 5′GGCAGAAACTAGCCACGATGCAAGCA | |||
Locus_tag = "ABTJ_01661" Product = "Protein of unknown function (DUF2750)" 1,706,849..1707274 bp | Locus_tag = "ABTJ_01662" Product = "hypothetical protein" Protein_id = "AFI95267.1" 1,707,761..1707994 bp | ||||
Set of two joined-similarity matrices obtained for 19 different genotypes indicated by underlined values, and for 19 different antibiotic resistance patterns. All values are from the range between 1 and 100%. Abbreviations "_s" and "_r" indicate intermediate resistance patterns considered two times as susceptible or resistant, respectively. The "0" value was replaced by "1E-06" for diagonal correlation calculation purposes. Significant (p < 0.05) combinations of genetic and resistance/susceptibility features are highlighted in black
Fig. 1Phylogenetic trees for different pairs of genetic polymorphisms and resistance/susceptibility features. Branches order obtained based on nearest neighbor method and length–distance calculation based on χ2 method. Significant (p < 0.05) differences indicated in black boxes were identified based on cut-off χ2 value = 4
Presence of A. baumannii genotypes over a period of 4 years
| Year of isolation of the strain (number of genotypes determined) | Ward | Genotype |
|---|---|---|
| 2006(5) | ICU | 8 (3), 10, 9, 15 |
| NS | 8 (3), 7 (2) | |
| R | 8 (2) | |
| E | 7 | |
| G | 10 | |
| 2005(6) | ICU | 1, 8 (2), 15, 10 |
| R | 8, 10, 13 | |
| PS | 8 | |
| NS | 10 | |
| O | 4 (2) | |
| G&ES | 15 | |
| SC | 15 | |
| Nef | 8 | |
| G&VS | 10 | |
| 2004(7) | ICU | 5 |
| O | 15 | |
| OC | 4, 2 | |
| E | 15 | |
| R | 15, 3 | |
| NS | 11, 15 | |
| G | 4 | |
| N | 16 | |
| 2003(3) | ICU | 6 (2), 12 |
| G&ES | 6 (2) | |
| O | 6 (2) | |
| N | 6 | |
| D | 14 |
Abbreviations for wards: D—Dermatology, E—Endocrinology, G—Geriatrics, G&ES—General and Endocrine Surgery, G&VS—General and Vascular Surgery, ICU—Intensive Care Unit, N—Neurology, Nef—Nephrology, NS—Neurosurgery, O—Orthopedic, OC—Orthopedic Outpatient Clinic, PS—Plastic Surgery, R—Rehabilitation, SC—Surgical Outpatient Clinic
Location of determined genotypes over a 4-year period in hospital wards
| Genotype | Year(number of genotypes) | Hospital ward(s) |
|---|---|---|
| 15 | 2006(1) | ICU |
| 2005(3) | ICU, G&ES, SC | |
| 2004(4) | O, E, R, NS | |
| 8 | 2006(8) | ICU, NS, R |
| 2005(5) | ICU, R, Nef | |
| 10 | 2006(2) | ICU, G |
| 2005(4) | ICU, R, NS, G&VS | |
| 4 | 2005(2) | O |
| 2004(2) | OC, G | |
| 6 | 2003(7) | ICU, G&ES, O, N |
| 7 | 2006(3) | E |
| 1 | 2005(1) | ICU |
| 2 | 2004(1) | ICU |
| 3 | 2004(1) | R |
| 5 | 2004(1) | ICU |
| 9 | 2006(1) | ICU |
| 11 | 2004(1) | NS |
| 12 | 2003(1) | ICU |
| 13 | 2005(1) | R |
| 14 | 2003(1) | D |
| 16 | 2004(1) | N |
Abbreviations for wards: D—Dermatology, E—Endocrinology, G—Geriatrics, G&ES—General and Endocrine Surgery, G&VS—General and Vascular Surgery, ICU—Intensive Care Unit, N—Neurology, Nef—Nephrology, NS—Neurosurgery, O—Orthopedic, OC—Orthopedic Outpatient Clinic, PS—Plastic Surgery, R—Rehabilitation, SC—Surgical Outpatient Clinic