Novel biallelic loss-of-function mutations in CFAP43 cause multiple morphological abnormalities of the sperm flagellum in Pakistani families.

Multiple morphological abnormalities of the sperm flagella (MMAF) is a specific type of asthenoteratozoospermia, presenting with multiple morphological anomalies in spermatozoa, such as absent, bent, coiled, short, or irregular caliber flagella. Previous genetic studies revealed pathogenic mutations in genes encoding cilia and flagella-associated proteins (CFAPs; e.g., CFAP43, CFAP44, CFAP65, CFAP69, CFAP70, and CFAP251) responsible for the MMAF phenotype in infertile men from different ethnic groups. However, none of them have been identified in infertile Pakistani males with MMAF. In the current study, two Pakistani families with MMAF patients were recruited. Whole-exome sequencing (WES) of patients and their parents was performed. WES analysis reflected novel biallelic loss-of-function mutations in CFAP43 in both families (Family 1: ENST00000357060.3, p.Arg300Lysfs*22 and p.Thr526Serfs*43 in a compound heterozygous state; Family 2: ENST00000357060.3, p.Thr526Serfs*43 in a homozygous state). Sanger sequencing further confirmed that these mutations were segregated recessively in the families with the MMAF phenotype. Semiquantitative reverse-transcriptase polymerase chain reaction (qRT-PCR) was carried out to detect the effect of the mutation on mRNA of the affected gene. Previous research demonstrated that biallelic loss-of-function mutations in CFAP43 accounted for the majority of all CFAP43-mutant MMAF patients. To the best of our knowledge, this is the first study to report CFAP43 biallelic loss-of-function mutations in a Pakistani population with the MMAF phenotype. This study will help researchers and clinicians to understand the genetic etiology of MMAF better.

INTRODUCTION

Multiple morphological abnormalities of the sperm flagellum (MMAF) is one of the more severe forms of sperm defect,1 characterized by bent, coiled, irregular, short, or absent sperm flagella.23456 The sperm flagellum in MMAF patients often shows ultrastructural abnormalities associated with the “9 + 0” arrangement of dynein microtubules, such as lacking the central pair of microtubules, disorganized axoneme, and mitochondrial sheath, which in turn affects sperm motility and leads to male infertility.4789

In the past few years, the development of next-generation sequencing technology has led to identification of a genetic cause in MMAF patients. Various pathogenic mutations have been found in genes encoding cilia and flagella-associated proteins (CFAPs), such as CFAP43, CFAP44, CFAP65, CFAP69, CFAP70, and CFAP251.2510111213141516171819 It has been noted that all these CFAP-associated genes have diverse functions and location. For example, CFAP43, CFAP44, and CFAP65 are associated with the inner dynein arm (IDA) complex tether/tether head (T/TH); CFAP69 is associated with intraflagellar transport (IFT); CFAP70 is related to the outer dynein arm (ODA)-associated complex; and CFAP251 is identified in the calmodulin and spoke-associated complex (CSC).1 In 2017, Tang et al.2 identified biallelic loss-of-function mutations of CFAP43 in Chinese MMAF patients and further confirmed the pathogenicity in knockout mouse models of the Cfap43 ortholog gene. Later, in 2018, Coutton et al.10 also identified CFAP43 biallelic mutations in MMAF patients from different ethnic groups. Biallelic mutations of CFAP43 and CFAP44 have been reported to be account for approximately 8%–31% of studied MMAF cohorts.21011 However, the genetic causes of MMAF among Pakistani patients remain unexplored. Given the existence of a traditional and close-knit society in Pakistan, approximately 65% of the population have consanguineous marriages.20 A high proportion of consanguineous marriage increases the risk of autosomal recessive disorders in offspring. Such kinds of autosomal recessive disease with identified genetic causes have been reported in the Pakistani population including primary microcephaly,21 deafness,22 retinitis pigmentosa,23 and infertility.2425 Therefore, we wondered, whether CFAP43 mutations could be one of the genetic causes for Pakistani MMAF patients.

CFAP43 (also known as WDR96, ENST00000357060.3) is localized on chromosome 10 and contains 38 exons encoding a predicted 1665-amino-acid protein (Q8NDM7), specifically expressed in the human testis,11 and plays a vital role in the organization of the sperm flagellar axoneme. Animal model studies (knock out of CFAP43 and CFAP44 homologs in mice and Trypanosoma brucei) have produced evidence that mutations in these genes destabilize the entire complex, leading to both periaxonemal and axonemal defects and resulting in aborted flagella.10 However, owing to the absence of a specific antibody for CFAP43, the specific role and localization of the CFAP43 protein in the mouse testis and their molecular and cellular mechanisms are yet to be elucidated.26

We recruited two Pakistani families with three infertile men suffering from MMAF. Through whole-exome sequencing (WES) and Sanger sequencing, we identified novel biallelic loss-of-function mutations in CFAP43 in both families (Family 1: ENST00000357060.3, c.899_900del and c.1577_1578del in a compound heterozygous state; Family 2: ENST00000357060.3, c.1577_1578del in a homozygous state). Mutation (c.1577_1578del) was identified in both families and caused mRNA degradation in spermatozoa of the Family 2 patient.

To our knowledge, this is the first report that CFAP43 biallelic loss-of-function mutations cause MMAF in Pakistani populations. This study will help researchers and clinicians to better understand the genetic etiology of MMAF and would be of high interest for genetic counseling and diagnosis of MMAF.

PARTICIPANTS AND METHODS

Study participants

Two Pakistani families with three interfile men were recruited. Written informed consent was obtained from all the affected and control family members. This study was approved by the Institutional Ethical Committee of University of Science and Technology of China (USTC; Hefei, China) with the approval number of USTCEC202000003.

Semen analysis

All three patients had routine semen analysis performed twice according to the World Health Organization guidelines (2010).27 Sperm morphology was assessed as previously described by Zhang et al.24 The fixed smear slides were sequentially immersed for 30 s in ethanol of 80% and 50% concentration and washed with purified water and then placed in hematoxylin stain (Solarbio, Beijing, China) for 4 min followed by serially immersed for 30 s in purified water, acidic ethanol, running cold tap water, and ethanol of 50%, 80%, and 95% concentration, respectively. These slides were then dipped in Orange-G-6 stain (Solarbio) for 1 min and washed three times with 95% of ethanol. Finally, the slides were forward to Eosin Azure Stain (Solarbio) for 1 min and then washed with 95% and 100% ethanol in each two times for 30 s. These slides were then dipped in xylene:ethanol (1:1 ratio) for 1 min in a fume hood. At least 200 stained spermatozoa per sample were examined by optical microscopy (Nikon Eclipse 80i, Nikon, Tokyo, Japan). According to their characteristic defects, the morphological abnormalities of sperm flagella were divided into five categories: short, coiled, absent, bent, and irregular/caliber.

WES, sequencing data analysis, and Sanger sequencing

Genomic DNA was extracted from the peripheral blood of all available family members by using FlexiGene DNA Kit (QIAGEN, Hilden, Germany) as per the manufacturer’s instructions. For WES, AIExome Enrichment Kit V1 (iGeneTech, Beijing, China)-captured libraries were constructed for family members of Family 1 (I:1, I:2, II:1, and II:2) and Family 2 (III:1, III:2, IV:3, and IV:4) as instructed by the manufacturer. Sequencing was carried out on a Hiseq2000 platform (Illumina, San Diego, CA, USA). Clean reads were mapped to the human reference genome (hg19) by Burrows–Wheeler Alignment tool.28 Variants were discovered and annotated by the Genome Analysis Toolkit (GATK)29 and ANNOVAR.30 After that, specific filtration pipelines for each family are described in and detailed in and . Sanger sequencing was performed to verify the selected variants in all the available family members. The primers for PCR are listed in .

Transmission electron microscopic (TEM) analysis of spermatozoa

TEM analysis was performed according to Zhang et al.31 in 2019. Spermatozoa from the patient and a fertile control individual were taken and fixed in 0.1 mol l−1 phosphate buffer (PB; pH 7.4), comprising 0.2% picric acid, 8% glutaraldehyde, and 4% paraformaldehyde and stored at 4°C overnight. Samples were washed with 0.1 mol l−1 PB, postfixed with 1% osmium tetroxide. Spermatozoa cells were dehydrated through graded alcohol (30%, 60%, 90%, 100%, 100%, and 100%; 10 min for each bath) followed by infiltration of an epon resin and acetone mixture. Ultrathin (70 nm) sections were cut from the samples followed by staining with lead citrate and uranyl acetate. Tecnai 10 or 12 Microscopes (Philips CM10, Philips Electronics, Eindhoven, The Netherlands) at 120 kV or 100 kV were used to capture and examine the ultrastructure of the samples.

RNA extraction and semiquantitative reverse-transcriptase polymerase chain reaction (qRT-PCR)

Total sperm RNA from patient (Family 2-IV:3) and a fertile male was extracted with RNAiso Plus (TAKARA, Beijing, China) and reverse-transcribed into cDNA by PrimeScript RT Reagent Kit (TAKARA) as per the manufacturer’s instructions. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (forward: 5’-GTCAAGGCTGAGAACGGGAA-3’; reverse: 5’-AAATGAGCCCCAGCCTTCTC-3’) was used as an internal control and CFAP43 (Ensembl transcript ID: ENST00000357060.3) primers used were as follows, forward: 5’-AGCACGTCGTTTATGATCAG-3’; reverse: 5’-TGTGGCAGTAATGTAGGCAG-3’.

RESULTS

Clinical features of patients

This study was performed on two Pakistani families with three infertile men. Family 1-II:1 (57 years), Family 1-II:2 (55 years), and Family 2-IV:3 (39 years) had been married for 31 years, 26 years, and 14 years, respectively, but all were infertile. Detailed information was collected from each patient to exclude the possibility of associated infertility-related disease. All the individuals were healthy, with no previous history of any testicular injury or obstruction, no symptoms of Primary Ciliary Dyskinesia (PCD; disease ID: #MIM 244400). Detailed pedigree charts were constructed on the basis of information provided by their parents (). All the physical characteristics and semen parameter values of the patients are presented in . The semen volumes, pH, and viscosity fell within the normal ranges according to the World Health Organization guidelines (2010).27 However, sperm concentrations were lower than the normal range (). Sperm morphological analysis reflected severe abnormalities of flagella including bent, short, coiled, irregular, and absent that are typical characteristics of MMAF ().

Pedigree of (a) Family 1 and (b) Family 2. Two Pakistani families with three infertile patients were recruited. I, II, III, and IV represent generation 1, 2, 3, and 4, respectively. Squares represent males, circles represent females, diamonds indicate offspring, and the inside numerals indicate the number of offspring. The slashes denote deceased family members. Solid squares indicate patients. Parallel slash lines indicate consanguineous marriage. Red arrows indicate the members selected for WES. WES: whole-exome sequencing.

Morphology and transmission electron microscopic analysis of spermatozoa from normal control and infertile patients. (a) Most spermatozoa of patients (middle and right panels) presented abnormal sperm flagella (*), compared with control spermatozoa (left panel). Scale bars = 10 μm. (b) Cross-section of fertile male spermatozoa (left panel). An axoneme of a fertile male’s spermatozoa comprised DMTs circularly arranged around a CPC of microtubules (9 + 2 organization), surrounded by ODFs and FS. Cross-section of the patient II:1 of Family 1 (CFAP43-deficient), see right panel. Spermatozoa display totally disorganized axoneme; outer dense fibers and peripheral microtubules are misarranged. The central pair is displaced. Scale bars = 500 nm. DMTs: doublets of microtubules; CPC: central pair complex; ODF: outer dense fiber; FS: fibrous sheath; CFAP: cilia and flagella-associated protein.

Novel biallelic loss-of-function mutations in CFAP43 are candidate pathogenic variants in the families

To identify the genetic cause of MMAF, WES was performed for all available family members as shown in . WES data were filtered according to the detailed pipeline in . As stated in a previous study, MMAF is an autosomal recessive inheritance,17 so as from the family history of Family 1, and the parents in Family 2 were in a consanguineous marriage, we focused on homozygous/compound heterozygous mutations shared by patients. Finally, the filtration pipeline identified novel biallelic loss-of-function mutations in CFAP43 in both families (Family 1: ENST00000357060.3, c.899_900del and c.1577_1578del in a compound heterozygous state; Family 2: ENST00000357060.3, c.1577_1578del in a homozygous state). It is noteworthy that the frameshift mutation (c.1577_1578del) was identified in both families.

CFAP43 mutation induced severe axonemal disorganization

TEM was performed to observe the ultrastructure defects of patient II:1’s spermatozoa of Family 1, as well as normal sperm ultrastructure from a fertile control individual. For TEM, a typical microtubule structure was presented in the spermatozoa of the fertile control that contains a “9 + 2” axonemal arrangement of nine doublets of microtubules (DMTs) and two central pairs (CP), surrounded by a fibrous sheath (FS) and outer dense fibers (ODF) as shown in . In contrast to the fertile male spermatozoa, CFAP43-defecient sperm cross-sections showed axonemal and periaxonemal defects and approximately 82% of the cross-sections were abnormal (). The main defect was severe disorganization of the FS, ODF, and axonemal disassembly, and in some cross-sections the absence of central pair complex (CPC) (9 + 0 conformation).

CFAP43 mutations cosegregated with MMAF phenotype in the families and induced CFAP43 mRNA decay

Sanger sequencing confirmed that the WES-identified CFAP43 mutations cosegregated with MMAF phenotype in both families (Figure and ). To determine the effects of the frameshift mutation (c.1577_1578del) on CFAP43 expression, we measured CFAP43 mRNA in spermatozoa of the patient from Family 2, using the sperm sample from a fertile male as control. As shown in , CFAP43 mRNA was detected in the control sample, but not in the patient IV:3. Owing to the unavailability of Family 1 patients’ fresh semen samples for mutant CFAP43 protein/mRNA detection, we compared the mutation c.899_900del with reported CFAP43 mutations that had been confirmed in mRNA or protein level. Our mutation, c.899_900del (predicted truncate protein, p.Arg300Lysfs*22), was close to p.Asn380Lysfs*3, which was previously identified by Wu et al.11 and has been confirmed to cause mRNA decay by quantitative polymerase chain reaction (qPCR), as well as the lack of CFAP43 protein by immunofluorescent staining in patients’ semen samples.

Sanger sequencing results of CFAP43 mutations in DNA and mRNA levels. Chromatograms of the CFAP43 mutations from (a) Family 1 and (b) Family 2. Red/Blue arrows show the genomic position of CFAP43 mutations. (c) SqRT-PCR analysis of CFAP43 mRNA levels in male control and Family 2-IV:3 sperm samples. SqRT-PCR: semiquantitative reverse-transcriptase polymerase chain reaction; CFAP: cilia and flagella-associated protein; bp: base pair; Ref: reference; Het: heterozygous; chr10: chromosome 10; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; del: deletion.

DISCUSSION

In the current study, we recruited two Pakistani families with MMAF patients. After WES of all available family members, novel biallelic loss-of-function mutations in CFAP43 were identified in both families (Family 1: ENST00000357060.3, c.899_900del and c.1577_1578del in a compound heterozygous state; Family 2: ENST00000357060.3, c.1577_1578del in a homozygous state), as shown in . Sanger sequencing further confirmed that these mutations were segregated recessively in the families with MMAF phenotype. Furthermore, the mutation c.1577_1578del has been confirmed to cause mRNA degradation in patient’s spermatozoa from the Family 2. TEM results of the patient II:1’s spermatozoa of Family 1 showed severe disorganization of the axoneme. This is the first report of novel biallelic loss-of-function mutations in CFAP43 causing MMAF in the Pakistani population.

The identified mutations in CFAP43 gene and predicted mutant proteins. CFAP43 gene structure (Ensembl transcript ID: ENST00000357060) is shown with mutations identified in both families. Vertical bars indicate exons and slashed lines represent introns. CFAP43 (1665 AA) comprises two domains: WD (tryptophan-aspartic acid (W-D) repeat domain and SMC_N coil domain. CFAP: cilia and flagella-associated protein; AA: amino acid; SMC_N: N-terminus of structural maintenance of chromosome; del: deletion.

Of all identified CFAP43 mutations, 80% are loss-of-function mutations, which include frameshift, nonsense, and splice-site mutations ( and Ref2101132). These loss-of-function mutations (frameshift and nonsense) might cause mRNA degradation or produce truncate protein. Detailed sperm analyses indicated an increased number of immotile spermatozoa (98%–100%), and all patients’ spermatozoa had typical MMAF characteristics. Furthermore, no significant differences were observed among the semen parameters of the patients harboring CFAP43 mutations in the current study compared with the previously reported patients with other CFAP43 mutations (). Wu et al.11 first examined two CFAP43 mutations’ effects (p.Asn380Lysfs*3 and p.Gln492Arg) on mRNA and protein level in patients’ spermatozoa and found that both mutations cause CFAP43 mRNA degradation. In the current study, we could not obtain fresh semen samples from patients of Family 1 to verify the CFAP43 mutation effects on mRNA and protein level. However, since the mutation (p.Arg300Lysfs*22) is close to the mutations verified by Wu et al.11 (p.Asn380Lysfs*3 and p.Gln492Arg), we speculate that CFAP43 mutations identified in our study have a similar effect on CFAP43 expression, resulting in complete loss of CFAP43 ().

Summary of all reported CFAP43 mutations in MMAF patients. (a) All compound heterozygous mutations are listed above the gene map; horizontal connections represent two mutations identified in one patient. All homozygous mutations are listed below the gene map. Red ones indicate the mutations identified in current study. (b) Statistic of all CFAP43 mutations. CFAP: cilia and flagella-associated protein; MMAF: multiple morphological abnormalities of the sperm flagella; del: deletion; WD: tryptophan-aspartic acid (W-D).

CFAP43 and CFAP44 mutations account for 7.5%–30.8% of MMAF patients from a different study cohort, specified in a recent review.1 Tang et al.2 identified patients harboring CFAP44 or CFAP43 mutations, explaining 7.5% (4/30) of all patients with MMAF. However, Yan et al.32 identified 22.2% of 27 patients carrying CFAP44 or CFAP43 mutations. The most recent study by Wu et al.11 reported 30.8% of all patients Ref271112151832–35 summarized the percentages of involvement of CFAP43 and CFAP44, as well as other MMAF reported genes in different cohorts. Until now, only CFAP43 mutations have been identified in Pakistani MMAF patients in the current study.

According to previous information, good intracytoplasmic sperm injection (ICSI) outcomes are reported for MMAF patients with CFAP43 and CFAP44 mutations. The recorded rates of transferable embryo, implantation, and clinical pregnancy were 80%, 50%, and 100%, respectively, in CFAP43.5 Hence, it is worth mentioning that it would be more interesting for researchers and clinicians to apply ICSI for CFAP43-mutant MMAF patients and improving the prediction of ICSI outcomes for MMAF patients in Pakistan. However, it is very important to know the genetic screening of the wives of male patients carrying CFAP43 mutation before the couple asks for ICSI, to reduce the chances of genetic diseases in the offspring.

In conclusion, our study identified novel loss-of-function mutations in CFAP43 in Pakistani MMAF patients. These findings highlight the significance for genetic counseling and diagnosis for MMAF patients in the Pakistani population, while CFAP43 could be routinely genetic diagnosed. Further studies are needed to identify other pathogenic genes to characterize better MMAF in the Pakistani population.

AUTHOR CONTRIBUTIONS

IK and BS wrote the manuscript and performed semen analysis; SD, NU, AK, HA, XHJ, WS, MZ, and RK collected patients’ samples. JTZ, DRZ, and YWZ performed the WES sequencing and WES data analysis. QHS and HZ conceived and supervised the study, designed and analyzed data, and wrote the manuscript. All authors read and approved the final manuscript.

COMPETING INTERESTS

All authors declared no competing interests.

Whole-exome sequencing (WES) analysis pipeline for (a) Family 1 and (b) Family 2.

Supplementary Table 1

Primers for polymerase chain reaction and Sanger sequencing of CFAP43 variants

CFAP43 variants	Product size (bp)	Forward primer	Reverse primer
c.1577_1578del, p.Thr526Serfs*43	442	ATCAGGAGAATCCCTCATCC	TTACCTCTTCACATGCCAAG
c.899_900del, p.Arg300LysfsTer22	395	GCTCCTCTCTCTAATCTAGC	ATGTGACAGATCTGACATCC

Supplementary Table 2

Details of filtered variants from whole-exome sequencing analysis pipeline for family 1

Gene name	Mutation type	cDNA change	Phenotypes of mutant mice from MGI or literature, or expression in testes
ANKRD36C	Nonsynonymous SNV	C98T	Mutant mice have a mottled retina with photoreceptor degeneration and male infertility associated with oligozoospermia and asthenozoospermia
ANKRD36C	Frameshift substitution	1577_1579G	The same as above
CELA3B	Nonsynonymous SNV	G358A	The expression of this gene is not detectable in human testis
CELA3B	Frameshift substitution	2752_2753T	The same as above
CFAP43	Frameshift substitution	1577_1578G	Mice homozygous for a knock-out allele exhibit complete male sterility, asthenozoospermia, and teratozoospermia characterized by short, thick, and coiled flagella and sperm axonemal defects
CFAP43	Frameshift substitution	899_901A	The same as above
NBPF1	Nonsynonymous SNV	G1714A	Mice homozygous for a null allele exhibit partial (in utero or perinatal) lethality, hyperactivity, and increased vertical activity
NBPF1	Nonsynonymous SNV	T35G	Mice homozygous for a knock-out allele display delayed mammary tumor progression, impaired intestinal absorption of cholesterol, decreased gastric mucus accumulation, reduced secretion and accumulation of gallbladder mucin, and decreased susceptibility to cholesterol gallstone formation
PABPC3	Frameshift substitution	232_236T	Homozygotes for a null allele show high brain AEA levels, reduced pain sensation, altered behavioral responses to AEA, and sex-specific changes in ethanol intake and sensitivity. Homozygotes for the C385A variant show enhanced cued fear extinction and reduced anxiety-like behavior
PABPC3	Nonframeshift substitution		The same as above
PABPC3	Frameshift substitution	301_309G	Homozygotes for a null allele show high brain AEA levels, reduced pain sensation, altered behavioral responses to AEA, and sex-specific changes in ethanol intake and sensitivity. Homozygotes for the C385A variant show enhanced cued fear extinction and reduced anxiety-like behavior
PABPC3	Nonsynonymous SNV	C17T	The same as above
PIK3C2G	Frameshift substitution	595_596G	Homozygous null mice display hypoplasia of gut-associated lymph tissue due to defects in lymphocyte migration
PIK3C2G	Frameshift substitution	24_25T	The same as above
PRIM2	Frameshift substitution	899_901A	Mice homozygous for a null allele are viable and fertile with no gross abnormalities
PRIM2	Frameshift substitution	497_498A	The same as above
RRP12	Splicing	1657+3A>C	Homozygotes for targeted null mutations exhibit a 1 h shorter circadian period under constant darkness and reduced expression of another circadian gene in the suprachiasmatic nucleus in response to acute light exposure
RRP12	Nonsynonymous SNV	A1178T	The same as above
SPTA1	Splicing	565-3C>T	Mice homozygous or heterozygous for alleles of this gene exhibit varying degrees of hematopoietic defects
SPTA1	Frameshift substitution	51_52A	The same as above

MGI: mouse genome informatic; AEA: anandamide; SNV: single-nucleotide variant

Supplementary Table 3

Details of filtered variants from whole-exome sequencing analysis pipeline for family 2

Gene name	Mutation type	cDNA change	Phenotypes of mutant mice from MGI or literature
CFAP43	Frameshift	1577_1578G	Mice homozygous for a knock-out allele exhibit complete male sterility, asthenozoospermia, and teratozoospermia characterized by short, thick, and coiled flagella and sperm axonemal defects
MYO15A	Nonsynonymous SNV	C10393T	Mutations in this gene result in profound deafness and neurological behavior
KRTAP9-9	Nonsynonymous SNV	G422A	In the hair cortex, hair keratin intermediate filaments are embedded in an interfilamentous matrix, consisting of hair KRTAP, which are essential for the formation of a rigid and resistant hair shaft through their extensive disulfide bond cross-linking with abundant cysteine residues of hair keratins. The matrix proteins include the high-sulfur and high-glycine-tyrosine keratins
HTT	Nonsynonymous SNV	A107C	Null mutants gastrulate abnormally and die in utero. Conditional mutants are small with progressive neurodegeneration. Knock-ins of 20–150 CAG repeat units variably mimic Huntington’s with late-onset motor defects, reactive gliosis, and neuronal inclusions
KRT25	Nonsynonymous	A716C	Mutations in this gene have a defect in hair formation resulting in a wavy coat and curly vibrissae
DONSON	Nonsynonymous	A752G	Homozygous knockout is early embryonic lethal. Heterozygous knockout causes no observable phenotype

MGI: mouse genome informatic; SNV: single-nucleotide variant; KRTAP: keratin-associated protein

Table 1

Characteristics and sperm morphology in the patients

Characteristic	Reference valuea	Family 1–II:1	Family 1–II:2	Family 2–IV:3
Genotype	–	c.899_900del/c.1577_1578del	c.899_900del/c.1577_1578del	c.1577_1578del/c.1577_1578del
Age (year)b	–	57	55	39
Years of marriagec	–	31	26	14
BMI (kg m−2)	–	37.1	31.3	23.5
Semen parameters
Semen volume (ml)	>1.5	2.0	3.0	3.3
Semen pH	Alkaline	Alkaline	Alkaline	Alkaline
Sperm concentration (× 106 ml−1)	>15	9	6	7
Motility (%)	>40	0	0	0
Progressively motility (%)	>32	0	0	0
Sperm morphology
Normal flagella (%)	>4.0	3.2	–	0.8
Abnormal flagella (%)	–	96.7	–	99.1
Short flagella (%)	–	70.9	–	44.5
Absent flagella (%)	–	17.2	–	18.3
Bent flagella (%)	–	5.4	–	14.9
Coiled flagella (%)	–	5.0	–	12.6
Irregular/caliber (%)	–	0	–	8.8
Head defects
Normal head (%)	–	6.8	–	4.9
Abnormal head (%)	–	93.1	–	95.2
Tapered head (%)	–	45.9	–	71.1
Pyriform head (%)	–	25.0	–	14.7
Double head (%)	–	1.4	–	0.9
Large/amorphous head (%)	–	0	–	0.9
Round head (%)	–	10.9	–	5.5
Small head (%)	–	6.5	–	0.9
Absent head (%)	–	3.4	–	1.2

aReference values were published in WHO (2010). bThe current ages. cThe current years of marriage. –: not available; BMI: body mass index; WHO: World Health Organization; del: deletion

Supplementary Table 4

Semen characteristics in the subjects carrying CFAP43 mutations

Patient identified in the study	cDNA change	Effect on protein, or protein alteration	Semen volume (ml)	Sperm count (106 ml)	Motility (%)	Immotile (%)	MMAF phenotype	Reference
P003	c.2802T>A	p.Cys934*	2.2–3.8	16.1–39.4	0	100	Yes	2
P028	c.253C>T	p.Arg85Trp	1.5–2.5	16.1–39.4	2	98	Yes
P029	c.386C>A	p.Ser129Tyr	2.5–4.0	12.2–18.9	1	99	Yes	32
P6	c.3661-2A>	NA	3.0	15.8	0	100	Yes
P1	c.1140_1143del	p.Asn380Lysfs*3	2.3	7.6	0	100	Yes	11
P8	c.739A>T	p.Lys247*	2.4	25.8	0	100	Yes
P9	c.1474G>C	p.Gln492Arg	3.5	32.1	0	100	Yes
P10	c.4600C>G	p.Leu1534Val	4.1	19.2	0	100	Yes
P5	c.4963C>T	p.Arg1655*	2.9	20.1	0	100	Yes
P=10	c.3541−2A>C c.1240_1241delGT c.2658G>A c.2680C>T c.3882delA c.3352C>T c.1302dupT c.1040T>C c.2141+5G>A	p.Ser1181Lysfs*4 p.Val414LeufsTer46 p.Trp886Ter p.Arg894Ter p.Glu1294AspfsTer47 p.Arg1118Ter p.Leu435SerfsTer26 p.Val347Ala p.Lys714Val*11	3.5±1.4 (n=8)	27.2±23.4	0±0 (n=9)	100	Yes	10
P=2	c.899_900del c.1577_1578del	p.Arg300Lysfs*22 p.Thr526Serfs*43	3.3	07	0	100	Yes	Current study
P1	c.1577_1578del	p.Thr526Serfs*43	2–3	6–9	0	100	Yes	Current study

Supplementary Table 5

Percentages of involvement of the different sperm flagellum reported genes in the different cohorts

Gene	Protein features	Percentage of involvement (%)	Reference
DNAH1	Dynein heavy chain	28	7
CFAP65	Coiled-coil domain-containing protein	6.8	12
CFAP43 and CFAP44	WD repeat domains	7.5	2
		22.22	32
		30.8	11
FSIP2	AKAP4 interacting domain	5.1	33
AK7	ADK domain, coiled coil domain, DPY30 domain	1.2	34
WDR66 (CFAP251)	calcium regulating EF-hand domain	9	15
CFAP69	Armadillo-type α-helical repeats	2.6	18
ARMC2	Armadillo repeat-containing protein 2	2.4	35