| Literature DB >> 34100389 |
Hai-Xia Zhang1, Yu-Lin Zhou1, Wen-Yan Xu1, Xiao-Lu Chen1, Jia-Yang Jiang2, Xiao-Man Zhou1, Zeng-Ge Wang3, Rong-Qin Ke2, Qi-Wei Guo1.
Abstract
Klinefelter syndrome (KS) is one of the most frequent genetic abnormalities and the leading genetic cause of nonobstructive azoospermia. The breeding and study of KS mouse models are essential to advancing our knowledge of the underlying pathological mechanism. Karyotyping and fluorescence in situ hybridization are reliable methods for identifying chromosomal contents. However, technical issues associated with these methods can decrease the efficiency of breeding KS mouse models and limit studies that require rapid identification of target mice. To overcome these limitations, we developed three polymerase chain reaction-based assays to measure specific genetic information, including presence or absence of the sex determining region of chromosome Y (Sry), copy number of amelogenin, X-linked (Amelx), and inactive X specific transcripts (Xist) levels. Through a combined analysis of the assay results, we can infer the karyotype of target mice. We confirmed the utility of our assays with the successful generation of KS mouse models. Our assays are rapid, inexpensive, high capacity, easy to perform, and only require small sample amounts. Therefore, they facilitate the breeding and study of KS mouse models and help advance our knowledge of the pathological mechanism underlying KS.Entities:
Keywords: 40; XXY mouse; Klinefelter syndrome; mouse model; XXY*mouse; 41
Mesh:
Year: 2022 PMID: 34100389 PMCID: PMC8788596 DOI: 10.4103/aja.aja_38_21
Source DB: PubMed Journal: Asian J Androl ISSN: 1008-682X Impact factor: 3.285
Primer information for the polymerase chain reaction-based assays
|
|
|
|
|---|---|---|
|
| F: GCAGCTTACCTACTTACTAACA | chrY: 2662499-2662564 |
| R: CTGAGGTGCTCCTGGTA | ||
|
| F: CCTTCAGCCTCATCACCA | chrX: 167965017-167965122 |
| R: TTGGGTTGGAGTCATGGA | ||
|
| F: CATCCTACCATCATCTGCTTT | chrX: 102504207-102504284 |
| R: GGGAAGATGACTCCAGTCT | ||
|
| F: CCATGAAACTACATTCAATTCCAT | chr5:142889915-142889984 |
| R: TGTGTTGGCATAGAGGTCTT |
Sry: sex determining region of chromosome Y; Amelx: amelogenin, X-linked; Xist: inactive X specific transcripts; Actb: actin, beta; chr: chromosome; F: forward; R: reverse