Literature DB >> 34092831

Synthesis of dual-phase Ti3O5/Ti4O7 nanofibers for efficient adsorption of SARS-CoV-2.

Zhanlin Ding1,2, Hong Wang1, Zhe Feng1, Meiqing Sun1.   

Abstract

In this study, we synthesized the dual-phase Ti3O5/Ti4O7 nanofibers for efficient adsorption of the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), a life-threatening virus being taking millions of people lives. The Ti3O5/Ti4O7 nanofibers were synthesized by preparation of H2Ti3O7 precursor, polydopamine coating and furnace calcination. Protein and phospholipid adsorption assays showed that the dual-phase nanofibers had much higher affinity to both the model molecules bovine serum album (BSA) and phosphatidylethanolamine (PE) than the control single-phase Ti6O11 nanofibers. Consistently, the dual-phase nanofibers exhibited much stronger adsorption ability to SARS-CoV-2 pseudovirus than Ti6O11. This study sheds a light on titanium oxide nanomaterials to adsorb SARS-CoV-2 for avoiding its infection and for enriching it during rapid virus detection.
© 2021 Published by Elsevier B.V.

Entities:  

Keywords:  SARS-CoV-2; adhesion; nanomaterials; nanoparticles

Year:  2021        PMID: 34092831      PMCID: PMC8169221          DOI: 10.1016/j.matlet.2021.130167

Source DB:  PubMed          Journal:  Mater Lett            Impact factor:   3.423


Introduction

The severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), which causes worldwide COVID-19 pandamic, is a great threat that has taken millions of the people lives [1], [2], [3]. This virus, similar to other kinds of coronaviruses (e.g., SARS-CoV-1, MERS), is a respiratory RNA virus spreading in population by abundant mediators, such as air, water, food, touched things, and so on [4], [5], [6]. It is very important to develop efficient strategies to remove this virus and to capture it for detection from these mediators, especially from air and water. Nanomaterials exhibited high surface areas and adjustable surface affinity to viruses. Adsorption of viruses by nanomaterials is an exciting topic to remove viruses for protecting human bodies from life-threatening infections, and to enrich them for sensitive detection [7], [8]. A series of nanomaterials, such as polymer-based nanomaterials, natural nanofibers, graphene nanofilms, and so on [9], [10], [11]. However, it remains a great challenge to develop inorganic nanomaterials for efficient adsorption of viruses, especially SARS-CoV-2. In this study, we synthesized a series of titanium oxide nanofibers, including dual-phase Ti3O5/Ti4O7 nanofibers and single-phase Ti6O11 nanofibers, by using hydrothermal methods and electrospinning-hydrogen reduction method. Protein and phospholipid adsorption assays were performed to evaluate the affinity of the nanofibers to model biomolecules. Adsorption of the nanofibers to SARS-CoV-2 pseudovirus was further detected to investigate the virus adsorption ability of the nanofibers. This study revealed that the dual-phase Ti3O5/Ti4O7 nanofibers are promising nanoplatforms capturing the dangerous SARS-CoV-2 to avoid its infection and to capture it for virus detection.

Materials and methods

Synthesis and characterization of the nanofibers

The Ti3O5/Ti4O7 nanofibers were synthesized using the Shi’s hydrothermal method with modification [12]. Briefly, 20 mL NaOH solution (containing 12 g NaOH in dH2O) and 8 mL Ti(SO4)2 solution (containing 1.07 g Ti(SO4)2 in dH2O) were mixed by magnetic stirring. The mixture was added in a 50-mL Teflon-lined stainless-steel reactor, followed by heated at 180 °C for 48 h, obtaining the Na2Ti3O7 nanofibers. The nanofibers were then treated by 1 mol/L HCl for 1 h, obtaining the H2Ti3O7 precursor. 100 mg of the precursor were mixed with 100 mg of polydopamine at Tris buffer (pH = 8.5) by magnetic stirring for 24 h. The coated precursor was then harvested by centrifugation and calcinated at 1000 °C for 1 h at a tube furnace, obtaining the final Ti3O5/Ti4O7 nanofibers. The Ti6O11 single-phase nanofibers were synthesized by electrospinning-hydrogen reduction method [13]. The synthesized nanofibers were characterized by transmission electron microscopy (TEM, Tecnai G2 F-20, FEI, USA), X-ray diffraction (XRD, D/max-2500, JAPANSCIENCE, Japan), Brunauer-Emmett-Teller (BET) analyzer (Micromeritics Automatic Surface Area Analyzer Gemini 2360, Shimadzu, Japan), Fourier transformed infrared spectra (FT-IR, FTS6000, Bio-rad, USA), and X-ray photo-electron spectroscopy (XPS, Kratos Analytical Ltd., Axis Ultra DLD, UK).

Protein and phospholipid adsorption assays of the nanofibers

The adsorption ability of the nanofibers to BSA and PE was evaluated according to our previous methods [14]. BSA adsorption was performed in 10 mL of distilled water, with the initial nanofiber concentration and BSA concentration of 500 mg/L in 40-mL vials. The vials were gently shaken at 37 °C for 24 h, followed by centrifugation to remove the nanofibers. BSA concentration of the supernatants were measured by a Coomassie brilliant blue assay. PE adsorption was performed in 10 mL of 1:1 chloroform/methanol, with the initial nanofiber and PE concentration of 500 mg/L in 40-mL vials. After 24 h of shaking at 37 °C, the suspensions were centrifuged, and PE concentration of the supernatants were measured using a LC–MS system (LCMS-2020, Shimadzu, Japan).

Virus adsorption assays of the nanofibers

To evaluate the adsorption ability of the nanofibers to SARS-CoV-2 pseudovirus, 100 μL of SARS-CoV-2 pseudovirus solution (FUBIO, China) were diluted in 10 mL dH2O, and then 100 mg of the nanofibers were added. The mixture was shaken for 30 min and filtered. The filtered solids were stained by the antibody of the SARS-CoV-2 spike protein, followed by confocal microscope observation. The filtered liquid was further used for RNA extraction in a nucleotide extractor (QIAcube HT, USA). The concentration of SARS-CoV-2 pseudovirus was also detected by the QX200 Droplet Digital PCR (ddPCR) System (Bio-Rad, USA), using the SARS-CoV-2 detecting primers COVID19-F (CAATGCTGCAATCGTGCTAC) and COVID19-R (GTTGCGACTACGTGATGAGG) [15].

Results

Characterization of as-synthesized nanofibers

The Ti3O5/Ti4O7 titanium oxides were synthesized by calcination of the polydopamine-coated H2Ti3O7 precursor. Both SEM and TEM observation showed that the products had regular nanofiber morphology, with the diameter of 50 ~ 100 nm, and the length of 3–10 μm (Fig. 1 a, b). High-resolution TEM further showed an interplanar spacing of 175.6 pm in the nanofibers (Fig. 1b). XRD analysis showed that the nanofibers had mixed peaks of Ti3O5 (JCSPD# 82-1138) and Ti4O7 (JCSPD# 77-1390) (Fig. 1c), confirming the dual phase of the obtained nanofibers. XPS analysis revealed the main element compositions of the nanofibers, i.e., Ti and O, together with trace amounts of C, N, and Na (Fig. 1d, Fig. S1). Moreover, FT-IR analysis confirmed the presence of Ti-O (stretching vibration peak at 1636 cm−1) and –OH (asymmetry and symmetrical stretching binding, 3179.56 cm−1 (Fig. 1e). These results revealed the successful preparation of the dual-phase Ti3O5/Ti4O7 nanofibers. Brunauer‐Emmett‐Teller (BET) analysis further showed that the Ti3O5/Ti4O7 nanofibers had a BET surface of 14.5 m2/g (Table S1).
Fig. 1

Characterization of the Ti3O5/Ti4O7 nanofibers. (a) SEM images. (b) TEM images. (c) XRD spectrum. (d) XPS spectrum. (e) FT-IR spectrum.

Characterization of the Ti3O5/Ti4O7 nanofibers. (a) SEM images. (b) TEM images. (c) XRD spectrum. (d) XPS spectrum. (e) FT-IR spectrum. As the control nanofibers, two kinds of Ti6O11 single-phase nanofibers (i.e., Ti6O11-1 and Ti6O11-2) were prepared by the electrospinning method. TEM observation, XRD and XPS characterization indicated that both kinds of the control titanium oxides had the similar nanofiber morphology (Fig. S2a), the XRD pattern of Ti6O11 (JCSPD# 85-1058, Fig. S2b), and the main composition of Ti and O (Fig. S2c). BET) analysis further revealed that Ti6O11-1 and Ti6O11-2 had a BET surface of 235.9 m2/g and 36.0 m2/g (Table S1), respectively.

High affinity of the Ti3O5/Ti4O7 nanofibers to model biomolecules

Proteins and phospholipids are two main components on the surface of SARS-CoV-2. To compare the affinity between the nanofibers and biomolecules, two model molecules, i.e., the model protein BSA and the model phospholipids were chosen for adsorption assays. After co-incubation of the nanofibers and BSA, the Ti3O5/Ti4O7 nanofibers adsorbed much higher levels of BSA than the two kinds of control Ti6O11 nanofibers (155 mg/g versus 44 ~ 81 mg/g, Fig. 2 a). Similarly, the Ti3O5/Ti4O7 nanofibers also adsorbed much PE than the two kinds of Ti6O11 nanofibers (420 mg/g versus 128 ~ 255 mg/L, Fig. 2b). These results indicated that the dual-phase nanofibers had high affinity to both proteins and phospholipids, which may facilitate their adsorption to virus particles. The high affinity of the dual-phase nanofibers may be attributed to their surface vacancies that facilitate the nanofiber surfaces strongly binding the biomolecules.
Fig. 2

Adsorption ability of the nanofibers to BSA and PE. (a) BSA adsorption by the nanofibers. (b) PE adsorption by the nanofibers. * indicates significant difference between the groups (P < 0.05).

Adsorption ability of the nanofibers to BSA and PE. (a) BSA adsorption by the nanofibers. (b) PE adsorption by the nanofibers. * indicates significant difference between the groups (P < 0.05).

Efficient adsorption of the SARS-CoV-2 pseudovirus by the Ti3O5/Ti4O7 nanofibers

The high affinity of the dual-phase nanofibers suggested its high adsorption ability to the SARS-CoV-2 virus. To confirm this, a SARS-CoV-2 pseudovirus, which exposes the critical spike protein (S protein) on the virus surface and has similar surface properties of the real SARS-CoV-2, was used to assess the capacity of the nanofibers to adsorb SARS-CoV-2. After co-incubation of the nanofibers with the SARS-CoV-2 pseudovirus, the nanofibers were filtered and stained by FITC-tagged anti-S protein antibodies. Confocal microscopy revealed that the Ti3O5/Ti4O7 nanofibers displayed strong FITC fluorescence on the surface (Fig. 3 a). In contrast, the two kinds of control Ti6O11 nanofibers had only weak FITC fluorescence (Fig. 3a).
Fig. 3

Adsorption ability of the nanofibers to the SARS-CoV-2 pseudovirus. (a) Confocal microscope images of the nanofibers after pseudovirus adsorption and staining by FITC-tagged anti-S protein antibody, which specifically binds S protein and therefore indicates pseudovirus distribution. (b) Amplification curve of the SARS-CoV-2 pseudovirus gene marker in filtered liquid samples after adsorption by the nanofibers. (c) Droplet digital PCR results of the filtered liquid samples. The numbers indicate the left virus in the filtered liquids.

Adsorption ability of the nanofibers to the SARS-CoV-2 pseudovirus. (a) Confocal microscope images of the nanofibers after pseudovirus adsorption and staining by FITC-tagged anti-S protein antibody, which specifically binds S protein and therefore indicates pseudovirus distribution. (b) Amplification curve of the SARS-CoV-2 pseudovirus gene marker in filtered liquid samples after adsorption by the nanofibers. (c) Droplet digital PCR results of the filtered liquid samples. The numbers indicate the left virus in the filtered liquids. To confirm the strongest virus adsorption capacity of the dual-phase nanofibers among the three kinds of nanofibers, droplet digital PCR analysis of the virus in the filtered liquid were further performed. The results demonstrated that the filtered liquid after adsorption by Ti3O5/Ti4O7 nanofibers had much lower levels of virus concentrations than that after adsorption by Ti6O11 (25% versus 55–91%, Fig. 3b, c). These results revealed that the Ti3O5/Ti4O7 nanofibers had much higher virus-adsorption capacity than Ti6O11. Besides, since abundant viruses had similar protein and lipid compositions to SARS-CoV-2, the Ti3O5/Ti4O7 nanofibers may also have high adsorption capacity to other kinds of viruses. In conclusion, this study synthesized the dual-phase Ti3O5/Ti4O7 nanofibers by precursor preparation, polydopamine coating and furnace calcination for efficient adsorption of the SARS-CoV-2 virus. The obtained dual-phase nanofibers exhibited much higher affinity to both the model molecules BSA and PE, and to the SARS-CoV-2 pseudovirus than the single-phase Ti6O11 nanofibers. This study provided a novel strategy of SARS-CoV-2 adsorption by inorganic titanium oxide nanomaterials for avoiding its infection and for capturing it during rapid detection.

CRediT authorship contribution statement

Zhanlin Ding: Methodology, Software, Writing - original draft, Writing - review & editing. Hong Wang: Data curation, Investigation. Zhe Feng: Software, Validation. Meiqing Sun: Conceptualization, Investigation, Supervision.

Declaration of Competing Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
  10 in total

1.  Reducing transmission of SARS-CoV-2.

Authors:  Kimberly A Prather; Chia C Wang; Robert T Schooley
Journal:  Science       Date:  2020-05-27       Impact factor: 47.728

2.  Structure of replicating SARS-CoV-2 polymerase.

Authors:  Hauke S Hillen; Goran Kokic; Lucas Farnung; Christian Dienemann; Dimitry Tegunov; Patrick Cramer
Journal:  Nature       Date:  2020-05-21       Impact factor: 49.962

3.  Different toxicity of anatase and rutile TiO2 nanoparticles on macrophages: Involvement of difference in affinity to proteins and phospholipids.

Authors:  Qilin Yu; Honggang Wang; Qi Peng; Ye Li; Zhe Liu; Mingchun Li
Journal:  J Hazard Mater       Date:  2017-04-09       Impact factor: 10.588

4.  Virus capture and destruction by label-free graphene oxide for detection and disinfection applications.

Authors:  Zhiyong Song; Xiaoyu Wang; Genxing Zhu; Qinggong Nian; Hangyu Zhou; Dong Yang; Chengfeng Qin; Ruikang Tang
Journal:  Small       Date:  2014-10-06       Impact factor: 13.281

Review 5.  Application of nanomaterials in treatment, anti-infection and detection of coronaviruses.

Authors:  Ghazal Nikaeen; Sepideh Abbaszadeh; Saeed Yousefinejad
Journal:  Nanomedicine (Lond)       Date:  2020-05-07       Impact factor: 5.307

6.  Natural History of Asymptomatic SARS-CoV-2 Infection.

Authors:  Aki Sakurai; Toshiharu Sasaki; Shigeo Kato; Masamichi Hayashi; Sei-Ichiro Tsuzuki; Takuma Ishihara; Mitsunaga Iwata; Zenichi Morise; Yohei Doi
Journal:  N Engl J Med       Date:  2020-06-12       Impact factor: 91.245

7.  Structural basis of receptor recognition by SARS-CoV-2.

Authors:  Jian Shang; Gang Ye; Ke Shi; Yushun Wan; Chuming Luo; Hideki Aihara; Qibin Geng; Ashley Auerbach; Fang Li
Journal:  Nature       Date:  2020-03-30       Impact factor: 49.962

8.  Cell entry mechanisms of SARS-CoV-2.

Authors:  Jian Shang; Yushun Wan; Chuming Luo; Gang Ye; Qibin Geng; Ashley Auerbach; Fang Li
Journal:  Proc Natl Acad Sci U S A       Date:  2020-05-06       Impact factor: 11.205

9.  Structure, Function, and Antigenicity of the SARS-CoV-2 Spike Glycoprotein.

Authors:  Alexandra C Walls; Young-Jun Park; M Alejandra Tortorici; Abigail Wall; Andrew T McGuire; David Veesler
Journal:  Cell       Date:  2020-03-09       Impact factor: 41.582

10.  Optimization of primer sets and detection protocols for SARS-CoV-2 of coronavirus disease 2019 (COVID-19) using PCR and real-time PCR.

Authors:  Myungsun Park; Joungha Won; Byung Yoon Choi; C Justin Lee
Journal:  Exp Mol Med       Date:  2020-06-16       Impact factor: 8.718

  10 in total
  1 in total

Review 1.  State-of-the-art review of advanced electrospun nanofiber yarn-based textiles for biomedical applications.

Authors:  Shaohua Wu; Ting Dong; Yiran Li; Mingchao Sun; Ye Qi; Jiao Liu; Mitchell A Kuss; Shaojuan Chen; Bin Duan
Journal:  Appl Mater Today       Date:  2022-04-10
  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.