Junfei Ma1, Qianyu Ji1, Shuying Wang1, Jingxuan Qiu1, Qing Liu2,3. 1. School of Medical Instrument and Food Engineering, University of Shanghai for Science and Technology, Shanghai, 200093, China. 2. School of Medical Instrument and Food Engineering, University of Shanghai for Science and Technology, Shanghai, 200093, China. liuq@usst.edu.cn. 3. Laboratory for Marine Fisheries Science and Food Production Processes, Qingdao National Laboratory for Marine Science and Technology, Qingdao, 266071, China. liuq@usst.edu.cn.
Abstract
Attenuated Listeria monocytogenes could be a potential vaccine vector for the immunotherapy of tumors or pathogens. However, the lack of reliable promoters has limited its ability to express foreign antigens. In the present study, 21 promoters were identified from Listeria monocytogenes through RNA-seq analysis under two pH conditions of pH 7.4 and pH 5.5. Based on the constructed fluorescence report system, 7 constitutive promoters exhibited higher strength than Phelp (1.8-fold to 5.4-fold), a previously reported strong promoter. Furthermore, the selected 5 constitutive promoters exhibited higher UreB production activity than Phelp (1.1-fold to 8.3-fold). Notably, a well-characterized constitutive promoter P18 was found with the highest activity of fluorescence intensity and UreB production. In summary, the study provides a panel of strong constitutive promoters for Listeria monocytogenes and offers a theoretical basis for mining constitutive promoters in other organisms. KEY POINTS: • Twenty-one promoters were identified from L. monocytogenes through RNA-seq. • Fluorescent tracer of L. monocytogenes (P18) was performed in vitro and in vivo. • A well-characterized constitutive promoter P18 could improve the expression level of a foreign antigen UreB in L. monocytogenes.
Attenuated Listeria monocytogenes could be a potential vaccine vector for the immunotherapy of tumors or pathogens. However, the lack of reliable promoters has limited its ability to express foreign antigens. In the present study, 21 promoters were identified from Listeria monocytogenes through RNA-seq analysis under two pH conditions of pH 7.4 and pH 5.5. Based on the constructed fluorescence report system, 7 constitutive promoters exhibited higher strength than Phelp (1.8-fold to 5.4-fold), a previously reported strong promoter. Furthermore, the selected 5 constitutive promoters exhibited higher UreB production activity than Phelp (1.1-fold to 8.3-fold). Notably, a well-characterized constitutive promoter P18 was found with the highest activity of fluorescence intensity and UreB production. In summary, the study provides a panel of strong constitutive promoters for Listeria monocytogenes and offers a theoretical basis for mining constitutive promoters in other organisms. KEY POINTS: • Twenty-one promoters were identified from L. monocytogenes through RNA-seq. • Fluorescent tracer of L. monocytogenes (P18) was performed in vitro and in vivo. • A well-characterized constitutive promoter P18 could improve the expression level of a foreign antigen UreB in L. monocytogenes.
Entities:
Keywords:
Acid stress; Constitutive promoter; L. monocytogenes; RNA-seq
Listeria monocytogenes is a gram-positive bacterium that could stimulate innate response and cellular immune responses including CD4+ T cells and CD8+ T cells (Guleria and Pollard 2001; Mittrucker et al. 2000). The L. monocytogenes ΔactA/inlB strain, an attenuated L. monocytogenes, has been widely applied as a vaccine vector in microbial immunotherapy for controlling tumor and infectious diseases due to its endogenous pathway of antigen processing (Le et al. 2012; Paterson and Johnson 2004; Stark et al. 2009; Yoshimura et al. 2007). The promoter of hly gene (P) has been used to elicit the expression of foreign antigens during the construction of vaccine strains of attenuated L. monocytogenes (Chen et al. 2012; Yang et al. 2014). In the previous study, P was found inadequate to meet the expression levels of foreign antigens and further provoked a specific immune response (Ding et al. 2019). Although Phelp modified from P has higher promoter strength, it still needs further improvement (Riedel et al. 2007). In the previous studies, the live vaccine based on L. monocytogenes vector was forced to bear the acidic environments like the macrophage phagosome and tumor microenvironment (Beauregard et al. 1997; Gallagher et al. 2008). In another study, the oral L. monocytogenes vector vaccine was forced to encounter the stomach acid environment (Spears et al. 2011). However, this action requires the promoters to be stable enough to adapt to the acidic environments. Thus, one of the key limitations is the lack of a panel of well-characterized promoters to regulate the expression of foreign antigens in L. monocytogenes.Constitutive promoters have been widely adopted for fine-tuning the expression levels of key genes in metabolic engineering and synthetic biology (Li et al. 2015; Sun et al. 2012). Usually, constitutive promoters are screened from the promoters of essential genes due to their constant transcript levels (Partow et al. 2010). In this regard, developing a method based on RNA-seq analysis could be helpful to obtain native promoters according to different transcriptional strengths. In recent years, this method has attracted much attention in the field of synthetic biology to construct the native promoter libraries of various industrial microorganisms, such as Streptomyces albus, Streptococcus thermophilus, and Pseudomonas (Jin et al. 2020; Kong et al. 2019; Luo et al. 2015). A panel of strong constitutive promoters could be obtained by selecting the potential promoters through RNA-seq analysis and fluorescent reporter genes.With the emerging interest in L. monocytogenes, the development of transcriptome sequencing technology offers an opportunity to mine reliable constitutive promoters. The present study identified a panel of constitutive promoters based on the systematic analysis of transcriptome data of L. monocytogenes cultivated in different pH conditions. The green fluorescent protein (GFP) reporter was used for identifying the characterization of these promoters, and the activity of a well-characterized promoter was evaluated in vitro and in vivo. Based on our further needs, several promoters with different strengths were selected for experimentally evaluating UreB production, a widely used antigen against Helicobacter pylori. These constitutive promoters enriched the promoter library of L. monocytogenes, which might add value to metabolic engineering and synthetic biology in this genus.
Materials and methods
Strains, plasmids, cells, and medium
The bacterial strains and plasmids used in this study are listed in Supplemental Table S1. Escherichia coli DH5α was cultured on Luria-Bertani broth (LB) medium at 37 °C. It was applied for plasmid construction and propagation. L. monocytogenes wild-type EGD-e (ATCC BAA-679) and EGD-eΔactA/inlB were cultured in brain heart infusion medium (BHI, Land bridge, Beijing, China) at 37 °C. Macrophage cell line Raw264.7 was purchased from Shanghai Cell Bank (Shanghai, China), and cultured in RPMI-1640 medium (Sigma, Saint Louis, USA).
Growths of L. monocytogenes under different pH conditions
The overnight-grown wild-type EGD-e strain was collected by centrifugation at 5000×g at 4 °C, washed with PBS (10 mM, pH 7.4), and then adjusted to 1.0 at OD600 nm. The cultures were then diluted 1:100 in fresh BHI broth (pre-adjusted to pH 4.5, 5.0, 5.5, 6.0, or 7.4 using hydrochloric acid, respectively) to obtain 0.2 at OD600 nm (3.6×108 CFU/mL, CFU: colony-forming units). The growth curve was assessed for 12 h at 37 °C with shaking. Afterward, the bacterial solution was taken for optical density determination at OD600 nm and 1-h interval using a SpectraMax M2 microplate reader (Molecular Devices, San Jose CA, USA). Three independent experiments were performed and the results were reported as average.
Acid resistance determination of pre-acid-treated L. monocytogenes
Based on the growth of wild-type EGD-e under different pH conditions, eight types of acid pretreatments (pH 4.5, 30 min; pH 4.5, 1 h; pH 5.0, 30 min; pH 5.0, 1 h; pH 5.5, 3 h; pH 5.5, 6 h; pH 6.0, 3 h; and pH 6.0, 6 h) were performed to explore acid resistance of EGD-e to screen the optimal treatment. Since the bacteria were barely growing at pH 4.5 and 5.0, the initial inoculum at these pH conditions was 1.0×109 CFU/mL (OD600 = 0.4), while it decreased to 3.6×108 CFU/mL (OD600 = 0.2) at pH 5.5 and 6.0. The acid-treated cells were collected by centrifugation at 5000×g for 10 min at 4 °C, washed with PBS, and adjusted to 0.4 at OD600 nm. After appropriate dilutions, the cultures were then plated onto BHI agar to count the surviving bacteria. Meanwhile, 1 mL of culture (OD600=0.4) was harvested, washed once with PBS, resuspended in isometric BHI broth (pre-adjusted to pH 3.0, lethal acidity of L. monocytogenes), and cultured at 37 °C for 20 min. Afterward, the cultures were collected, resuspended in isometric BHI broth (pH 7.4), and plated onto BHI agar. The bacterial acid resistance was characterized by survival rate, defined as the ratio of survival number after lethal acid treatment to survival number after acid pretreatment. Survival rates were reported as the mean of three independent experiments, each performed in duplicate.
RNA-seq
The wild-type EGD-e strain was cultured in BHI medium under pH 7.4 and 5.5 for 3 h at 37 °C with shaking. The initial inoculum was 3.6×108 CFU/mL. The cultures were collected by centrifugation at 5000×g at 4 °C, and washed with diethyl pyrocarbonate (DEPC) water. Total RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, USA), and then, ribosomal RNA was removed by a Ribo-Zero Magnetic kit (Epicentre Biotechnologies, Madison, USA). RNA quality was checked by NanoDrop (Thermo Fisher Scientific, Waltham, USA) followed by RNA degradation and contamination verification on 1% agarose gel. The cDNA libraries were prepared using the TruSeq RNA Library Preparation kit (Illumina, San Diego, USA) and sequenced on Illumina HiSeq 4000 platform (Illumina, San Diego, USA) by Sangon Biotechnology Co. Ltd (Shanghai, China). Clustering and sequencing were performed by Sangon (Shanghai, China) using spliced reads to determine the connectivity.Raw FASTQ data were trimmed for sequencing adapters and low-quality bases using Trimmomatic v. 030 (Bolger et al. 2014) in double-end mode, retaining reads with a minimum Phred quality score of 20 and a minimum length of 35. The specific parameters used were “SE-phred33 ILLUMINACLIP: LEADING: 20 TRAILING: 20 MINLEN: 35.” The adapter sequence used was AGATCGGAAGAGCACACGTCTGAAC (forward) and AGATCGGAAGAGCGTCGTGTAGGGA (reverse). FASTQC v. 0.10.1 (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/) was run on the trimmed and the raw FASTQ data to verify that trimming improved sequence quality. Bowtie2 v. 2.1.0 (Langmead and Salzberg 2012) was used to align the trimmed data against the L. monocytogenes EGD-e reference genome (GenBank accession AL591824.1) using −k 1 and −N 1 options (report 1 alignment per read and allow only 1 mismatch in a seed alignment during multiseed alignment, respectively). Raw read counts were generated using RSeQC (Wang et al. 2012) with the NCBI GFF gene model file for GenBank accession AL591824.1. FPKM (fragments per kilobase of gene model per million mapped reads), considering the effect of sequencing depth and gene length on reads counts, is a commonly used method for evaluating gene expression levels (Trapnell et al. 2010). FPKM was calculated using featureCounts (Liao et al. 2014). Furthermore, FPKM could reflect the promoter strength.
Construction of plasmids and strains
Firstly, the green fluorescent protein (GFP) gene from plasmid pUC57-GFP was amplified and the promoters of 25 highly expressed genes from wild-type EGD-e genome were cloned. Each cloned promoter and amplified gfp sequence was inserted into plasmid pERL3 using ClonExpress® MultiS One Step Cloning Kit (Vazyme, Nanjing, China) to create a series of pERL3 derivatives, pERL3-P1-GFP to pERL3-P25-GFP. The widely used promoters P and Phelp were applied as controls to generate pERL3-P-GFP and pERL3-Phelp-GFP using the same method. All primers used in this study are listed in Supplemental Table S2. The promoter sequences are listed in Supplemental Table S3. The constructed plasmids with different promoters were proliferated in E. coli DH5α, identified by sequencing, and transformed into wild-type EGD-e using electroporation.
Measurement of fluorescence intensity of GFP
The constructed strains were cultured in BHI medium at pH 7.4 or 5.5 at 37 °C for 12 h, 24 h, 36 h, and 48 h, respectively. The cultures were collected by centrifugation, washed twice with 20 mM Tris-HCl, and resuspended. After adjusting to appropriate absorption at 600 nm (OD600), the fluorescence intensity of GFP (excitation at 485 nm and emission at 525 nm) was measured in microtiter plates (Assay Plate, 96 wells, Black Polystyrene; Corning, New York, USA) using a SpectraMax M2 microplate reader (Molecular Devices, San Jose, CA, USA).
Fluorescent tracer of L. monocytogenes in macrophage RAW264.7
EGD-e and EGD-eΔactA/inlB carrying the plasmid pERL3-P18-GFP were chosen for fluorescent tracer of L. monocytogenes in macrophage RAW264.7. Approximately 2×105 RAW264.7 cells were seeded on cover glass (Thermo Fisher Scientific, Waltham, USA) in a 12-well plate per well overnight. The cells were infected with bacteria at the multiplicity of infection (MOI) of 100 for 2 h. After washing thrice, gentamicin was added for 30 min to eliminate the extracellular bacteria. Then, the cells were fixed with 4% paraformaldehyde in PBS at room temperature for 30 min, and permeabilized in 0.1% TritonX-100 in PBS for 5 min. Actin-stain 488 (red, Cytoskeleton Inc., Yeasen, Shanghai, China) and DAPI (4′,6-diamidino-2-phenylindole, blue, H-1200, Vector Lab., Yeasen, Shanghai, China) were utilized to stain actin and label the cell nucleus, respectively. The images were captured and observed on a Leica DM 2500 fluorescence microscope (Leica, Solms, Germany).
Fluorescent tracer of L. monocytogenes in vivo
In vivo imaging of EGD-eΔactA/inlB carrying fluorescent reporting plasmid was tested in traditional C57BL/6 mice. P18, as the strongest promoter, was selected to observe its activity in vivo. EGD-eΔactA/inlB carrying the plasmid pERL3-P18-GFP was cultured in BHI medium at 37 °C overnight, washed, and resuspended using PBS. Mice were inoculated with EGD-eΔactA/inlB (5×107 CFU/mouse) by intravenous injection. Three days post-inoculation, the mice were anesthetized with isoflurane and imaged in a PerkinElmer IVIS Lumina II system (PerkinElmer, Waltham, USA).
Measurement of urease B subunit (UreB) production
The promoters with different strengths of P18, P7, P12, P9, P24, Phelp, and P were selected for determining their abilities to express foreign antigen UreB. The plasmids pERL3-P18/P7/P12/P9/P24/Phelp/P-UreB were constructed and transformed into EGD-eΔactA/inlB. The constructed strains were cultured in BHI medium at 37 °C overnight, and the total soluble proteins were extracted by an ultrasonic crushing apparatus. The expression levels of UreB under different promoters in EGD-eΔactA/inlB were evaluated by western blotting probed with a mouse anti-UreB polyclonal antibody. Meanwhile, the purified UreB proteins with gradient dilution as standards were set for quantitative analysis of UreB in EGD-eΔactA/inlB by gray scan using ImageJ. In this regard, the quantitation of UreB was based on total protein normalization and the proteinic concentration was assayed by BCA Kit (Solarbio, Beijing, China).
Statistical analyses
All data were analyzed with the GraphPad Prism 5 software (GraphPad Software Inc., San Diego, USA) and expressed as mean ± standard deviation (SD). Statistical significance was analyzed using one-way ANOVA. P < .05 was considered statistically significant (*P < .05, **P < .01, ***P < .001, ****P < .0001; ns: not significant).
Results
Acid stress could defer or terminate the growth of L. monocytogenes. As depicted in Fig. 1a, the growth rate of wild-type EGD-e was inhibited by acid stress compared with the normal condition (pH 7.4). At pH 6.0, the growth was slightly inhibited, which delayed its stationary phase by 4 h, and the bacterial concentration of the stable period was about 0.68 at OD600 nm, which was still close to the growth at pH 7.4 (0.71). The growth at pH 5.5 was moderately inhibited, while the growth at pH 5.0 or 4.5 was severely inhibited.
Fig. 1
The screening of acid stress treatments for L. monocytogenes RNA-seq analysis. a The growth characteristics of L. monocytogenes at different pH conditions. The initial inoculation amount of L. monocytogenes was 3.6×108 CFU/mL. b Acid resistance determination of L. monocytogenes with different acid stress treatments. The viable bacteria number under eight kinds of different acid stress (pH 4.5, 30 min; pH 4.5, 1 h; pH 5.0, 30 min; pH 5.0, 1 h; pH 5.5, 3 h; pH 5.5, 6 h; pH 6.0, 3 h; and pH 6.0, 6 h) and survival rate after further acid lethal treatment (pH 3.0, 20min) were measured. Bacteria were adjusted to OD600 nm of 0.4 for counting. The error bars indicate the standard deviations from three independent replicates. Statistical significance was compared to the group of pH 5.5, 3 h: ns, no significant, ****, P ˂ 0.0001
The screening of acid stress treatments for L. monocytogenes RNA-seq analysis. a The growth characteristics of L. monocytogenes at different pH conditions. The initial inoculation amount of L. monocytogenes was 3.6×108 CFU/mL. b Acid resistance determination of L. monocytogenes with different acid stress treatments. The viable bacteria number under eight kinds of different acid stress (pH 4.5, 30 min; pH 4.5, 1 h; pH 5.0, 30 min; pH 5.0, 1 h; pH 5.5, 3 h; pH 5.5, 6 h; pH 6.0, 3 h; and pH 6.0, 6 h) and survival rate after further acid lethal treatment (pH 3.0, 20min) were measured. Bacteria were adjusted to OD600 nm of 0.4 for counting. The error bars indicate the standard deviations from three independent replicates. Statistical significance was compared to the group of pH 5.5, 3 h: ns, no significant, ****, P ˂ 0.0001
The optimal acid stress treatments for L. monocytogenes RNA-seq analysis
Acid-inducing tolerance response at sublethal conditions could improve the survival rate of L. monocytogenes at lethal acid conditions (Cheng et al. 2015; Stack et al. 2007). In this study, the survival rate was to characterize bacterial acid resistance. As depicted in Fig. 1b, the surviving bacteria after acid pretreatments (pH 5.5, 3 h; pH 6.0 3 h) were 9.13±0.02×108 and 9.33±0.01×108 CFU/mL, respectively, which were close to that under the normal condition (1.0×109 CFU/mL). The lethality of bacteria after these two acid stress pretreatments was extremely low. When the acid induction (pH 5.5 and 6.0) time was extended to 6 h, the surviving bacteria were reduced to 4.70±0.01×108 and 4.43±0.02×108 CFU/mL, respectively. The surviving bacteria of the other acid pretreatments (pH 4.5, 30 min; pH 4.5, 1 h; pH 5.0, 30 min; pH 5.0, 1 h) were 4.90±0.03×107, 2.5±0.06×106, 3.33±0.02×108, and 6.60±0.01×107 CFU/mL, respectively, which indicated that the strong-acid treatments have higher lethality even for a shorter time.Furthermore, the survival rates of acid pretreatments (pH 5.5, 3 h; pH 5.5, 6 h) were 8.98±0.12% and 9.01±0.24% after lethal acid treatment, indicating the top 2 of all acid pretreatments. Moreover, there was no significant difference between 3 h and 6 h at pH 5.5. A similar trend was observed at pH 6.0, in which the survival rates of acid pretreatments (pH 6.0, 3 h; pH6.0, 6 h) were 3.0±0.16% and 3.0±0.06%. Besides, the survival rates of acid pretreatment (pH 5.0, 1 h) could reach 6.8±0.18%, while the other acid pretreatments (pH 4.5, 30 min; pH 4.5, 1 h; and pH 5.0, 30 min) were 0.12±0.01%, 0.97±0.05%, and 1.22±0.06%. Overall, the acid pretreatment pH 5.5, 3 h, which did well in both bacterial activity and acid resistance, was selected for L. monocytogenes RNA-seq analysis under acid stress.
Characterization of constitutive promoters by RNA-seq
The transcriptional profiling of all 2952 genes in the wild-type EGD-e genome was performed by RNA-seq. Firstly, RNA quality, sequencing saturation, and redundant sequence distribution frequency were analyzed for quality control of transcriptome data (Fig. S1, Supporting Information). For two conditions of pH 7.4 and 5.5, each sample was sorted from highly expressed to low expressed according to the FPKM value. Compared with the normal condition of pH 7.4, 333 genes were up-regulated and 339 genes were down-regulated under the acid stress condition of pH 5.5 (Fig. 2a). The top 2.0% of highly expressed genes under each condition were selected for gene overlap analysis. Of the 59 selected genes, 34 genes were co-expressed under two conditions (Fig. 2b). Since 15 genes were collectively distributed under 6 different operons, 25 genes were selected for cloning their promoters, as listed in Table 1. Additionally, the promoter sequences are listed in Supplemental Table S3.
Fig. 2
Characterization of constitutive promoters via RNA-seq. a Scatter-plot of gene expression level at pH 5.5 and 7.4 via RNA-seq. The red spots indicate significantly up-regulated genes; the green spots indicate significantly down-regulated genes; black spots indicate nonsignificant genes. b Venn diagram of the number of the top 2.0% of the most highly expressed genes under two conditions by RNA-seq. c Schematic diagram of the promoter-GFP cassette for promoter screening. The sequence of the promoter-GFP cassette is highlighted in red color. Fluorescence intensity of GFP by different constitutive promoters in wild-type EGD-e at pH 7.4 (d) and 5.5 (e), respectively. The error bars indicate the standard deviations from three independent replicates
Table 1
The information of 25 promoters from wild-type EGD-e selected by RNA-seq
Number
Gene
Length
CDS product
FPKM
pH 5.5
pH 7.4
1
lmo1634
501
Aldehyde-alcohol dehydrogenase
13,392.83
52,369.24
2
lmo2653
108
Elongation factor Tu
41,554.43
23,758.48
3
lmo2637
447
Hypothetical protein
5134.74
48,137.68
4
lmo2459
441
Glyceraldehyde-3-phosphate dehydrogenase
23,215.88
18,740.49
5
lmo0045
278
Single-strand binding protein
21,808.48
17,971.34
6
lmo1468
197
Hypothetical protein
17,174.67
22,337.2
7
lmo2654
192
Elongation factor G
24,542.36
10,582.53
8
lmo1439
300
Superoxide dismutase
27,940.96
4269.49
9
lmo2556
168
Fructose-1,6-bisphosphate aldolase
8363.89
17,402.44
10
lmo1541
156
Hypothetical protein
11,821.15
11,596.22
11
lmo1364
198
Cold-shock protein
10,301.34
7921.58
12
lmo1003
306
Phosphotransferase system enzyme I
6824.64
10,706.6
13
lmo2612
495
Preprotein translocase subunit
10,711.67
6707.29
14
lmo2615
426
30S ribosomal protein S5
10,020.13
5383.06
15
lmo2610
386
Translation initiation factor IF-1
9943.54
5379.53
16
lmo2455
135
Enolase
6747.16
7920.58
17
lmo2625
648
50S ribosomal protein L16
10,782.57
3878.09
18
lmo0248
126
50S ribosomal protein L11
6298.52
7050.71
19
lmo1847
842
Metal ABC transporter
8066.96
4621.05
20
lmo1787
207
50S ribosomal protein L19
6125.42
6160.1
21
lmo2621
426
50S ribosomal protein L24
8505.77
3758.96
22
lmo2016
288
Cold-shock protein
4096.5
8136.36
23
lmo0210
293
L-lactate dehydrogenase
4121.04
7400.75
24
lmo2411
1223
Hypothetical protein
6852.28
4470.22
25
lmo0250
247
50S ribosomal protein L10
4045.77
5270.73
Characterization of constitutive promoters via RNA-seq. a Scatter-plot of gene expression level at pH 5.5 and 7.4 via RNA-seq. The red spots indicate significantly up-regulated genes; the green spots indicate significantly down-regulated genes; black spots indicate nonsignificant genes. b Venn diagram of the number of the top 2.0% of the most highly expressed genes under two conditions by RNA-seq. c Schematic diagram of the promoter-GFP cassette for promoter screening. The sequence of the promoter-GFP cassette is highlighted in red color. Fluorescence intensity of GFP by different constitutive promoters in wild-type EGD-e at pH 7.4 (d) and 5.5 (e), respectively. The error bars indicate the standard deviations from three independent replicatesThe information of 25 promoters from wild-type EGD-e selected by RNA-seqThe fluorescence intensities of GFP under different promoters in L. monocytogenes were measured to evaluate the promoter activities with constitutive promoters Phelp and P as references. According to the schematic diagram of plasmid construction (Fig. 2c), 21 fluorescent reporting plasmids with different promoters were successfully constructed and transformed into wild-type EGD-e. The strength of each promoter was similar at 12 h, 24 h, 36 h, and 48 h under the condition of pH 7.4 (Fig. 2d), confirming them to be the constitutive promoters. Seven promoters (P7, P8, P9, P12, P18, P23, and P24) exhibited high activities from 1.8-fold to 5.4-fold than Phelp in EGD-e. Compared with pH 7.4, the fluorescence intensity of each well-characterized promoter had varying degrees of decline under pH 5.5 (Fig. 2e). Nonetheless, promoter P18 still showed higher activity of 5.3-fold than Phelp.
Fluorescent tracer of L. monocytogenes in vitro and in vivo
To assess the application potential of the well-characterized promoter, L. monocytogenes carrying fluorescent report plasmid with the strongest constitutive promoter P18 was selected for the tracer of bacteria in vitro and in vivo. Figure 3 a depicts the invasion of EGD-e and EGD-eΔactA/inlB (pERL3-P18-GFP) in macrophage RAW264.7. Furthermore, the fluorescence signal of EGD-eΔactA/inlB (pERL3-P18-GFP) was observed, which could be assigned to livers (Fig. 3b), the major sites of listerial infections in mice (Radoshevich and Cossart 2018) after dissection. This result confirmed the high activity of promoter P18 also in vivo.
Fig. 3
Fluorescent tracer of L. monocytogenes in vitro and in vivo. a Fluorescent tracer of L. monocytogenes in macrophage RAW264.7. b Fluorescent tracer of L. monocytogenes in vivo
Fluorescent tracer of L. monocytogenes in vitro and in vivo. a Fluorescent tracer of L. monocytogenes in macrophage RAW264.7. b Fluorescent tracer of L. monocytogenes in vivo
Measurement of UreB production
Attenuated L. monocytogenes could improve the expression of foreign antigens by a strong promoter. For this purpose, promoters P18, P7, P12, P9, and P24 were selected to verify the expressing ability of the antigen UreB, a typical antigen of H. pylori with promoters Phelp, P, and PNone (no promoter) as controls. As depicted in Fig. 4a, the expression of UreB in EGD-eΔactA/inlB under different promoters could be determined by anti-UreB polyclonal antibody using western blotting. This result indicated that promoter P18 still had the highest ability to express UreB. With the gray-scale analysis of purified UreB, a quantitative analysis of UreB production was performed under different promoters in EGD-eΔactA/inlB (Fig. 4b). Compared with promoter Phelp, promoters P18, P7, P12, P9, and P24 showed high UreB production from 1.1-fold to 8.3-fold. This result indicated that promoter P18 still performed noticeably well in the expression of the UreB antigen.
Fig. 4
Measurement of UreB production. a Measurement of UreB production in EGD-eΔactA/inlB by western blotting. b Quantitative determination of UreB production based on the gray scan. The error bars indicate the standard deviations from three independent replicates. Statistical significance was compared to the group of P: ns, no significant; *, P ˂ 0.05; **, P ˂ 0.01; ****, P ˂ 0.0001
Measurement of UreB production. a Measurement of UreB production in EGD-eΔactA/inlB by western blotting. b Quantitative determination of UreB production based on the gray scan. The error bars indicate the standard deviations from three independent replicates. Statistical significance was compared to the group of P: ns, no significant; *, P ˂ 0.05; **, P ˂ 0.01; ****, P ˂ 0.0001
Discussion
Attenuated L. monocytogenes, as a vaccine vector, exerts excellent application prospects in microbial immunotherapy. However, the low expression level of foreign antigen could not induce a strong specific immune response in the previous study (Ding et al. 2019). In another study, a strong promoter was used to improve the expression levels of foreign antigens to enhance the efficacy of the modified vaccinia virus Ankara (Becker et al. 2014). Therefore, mining the strong promoters from L. monocytogenes might be the key to enhance the efficacy of vaccines based on an attenuated L. monocytogenes vector.The constitutive promoters play significant roles in fine-tuning the gene expression in metabolic engineering and synthetic biology. The promoter with a proper strength could maximize the target production and also maintain the biological activity of the host engineering bacteria, suggesting that a mature engineering bacteria system needs a constitutive promoter library (Gilman and Love 2016). Since L. monocytogenes is not an ordinary engineered bacterium, the lack of availability of constitutive promoters in L. monocytogenes urges to enrich this toolbox.The effect of acidic environments on the activities of some promoters of engineering bacteria results in the excitation of the pH-induced promoters, such as base-responsive promoter P-atp2 from Corynebacterium glutamicum (Barriuso-Iglesias et al. 2013) or acid-responsive promoter P-asr from E. coli (Seputiene et al. 2003). When L. monocytogenes, as a vaccine vector, encounters the acid environment in the host, the promoter will maintain certain activity under acid stress conditions. Different acidity and processing time could develop different acid resistance in L. monocytogenes (Cheng et al. 2015). In this study, the treatment of pH 5.5 for 3 h was selected as the acid stress condition of RNA-seq from all eight acid stress treatments. Under this treatment, L. monocytogenes with the strongest acid resistance could filter out the down-regulated genes as much as possible, thereby preventing the inactivity or low activity of screened promoters in the acid environment.Recently, RNA-seq analysis has been widely adopted to construct the promoter library for engineered microorganisms, such as Pseudomonas mendocina, Streptomyces albus, and Saccharomyces cerevisiae (Gao et al. 2020; Luo et al. 2015; Zhao et al. 2019). Based on the RNA-seq and co-expression analysis under two conditions of pH 7.4 and pH 5.5, the characteristics of 21 promoters were identified by GFP reporter. Under the normal condition of pH 7.4, the activities of 7 promoters P7, P8, P9, P12, P18, P23, and P24 were higher than of Phelp. Additionally, under the acid stress of pH 5.5, the fluorescence intensity of all promoters showed a decreasing trend compared with pH 7.4. However, 2 promoters P12 and P18 exhibited higher fluorescence intensity than Phelp. To the best of our knowledge, this is the first well-characterized genome constitutive promoter study in L. monocytogenes, which provides a genetic tool for L. monocytogenes.Furthermore, the well-characterized promoter P18 was evaluated in vitro and in vivo using L. monocytogenes strains with the fluorescent reporter plasmid. Interestingly, the bacterial invasion in macrophage RAW264.7 and the bacterial enrichment in the liver of mice were observed, which confirmed the potential application of constitutive promoter P18. Compared with the other fluorescence reporter L. monocytogenes strains in the previous studies (Fortineau et al. 2000; Freitag and Jacobs 1999), the fluorescence reporter L. monocytogenes strain based on P18 exhibited better functionality in vivo. During vaccine development based on microbial carrier, selecting an appropriate promoter is the key to optimize the expressions of foreign antigens (Chapman and Rybicki 2019; Galvin et al. 2000; Stojanov et al. 2020). In this study, the selected constitutive promoters P18, P7, P12, P9, and P24 with different strengths exhibited high activities during the production of the specific antigen UreB. Due to the dependency of antigen dose and antibody response, a higher antigen dose imposes a stronger immune response of specific antibodies (Li et al. 2020). Therefore, it is worth noting that the performance of constitutive promoter P18 is still far ahead in antigen production in L. monocytogenes. Compared with the previous studies that used P as the promoter (Chen et al. 2014; Gunn et al. 2001; Singh et al. 2005), this study is significant for improving the efficiency of vaccines based on a L. monocytogenes vector.In conclusion, 21 promoters were identified from L. monocytogenes by RNA-seq analysis under two conditions of pH 7.4 and pH 5.5. Based on the constructed fluorescent reporter system, 7 constitutive promoters showed higher activity than Phelp. Additionally, 5 well-characterized constitutive promoters were used to activate a foreign UreB biosynthetic pathway successfully. In particular, the activity of a promoter in practical applications and the unprecedented antigen production of P18 were verified by the tracer of fluorescent reporter strains and UreB production, which could significantly enhance the effectiveness of live vector vaccines. This study provides a useful toolkit for L. monocytogenes and a theoretical basis for mining constitutive promoters in other organisms.(PDF 333 kb)
Authors: Kiyoshi Yoshimura; Lindsay S Laird; Christina Y Chia; Kristen F Meckel; Jill E Slansky; John M Thompson; Ajay Jain; Drew M Pardoll; Richard D Schulick Journal: Cancer Res Date: 2007-10-15 Impact factor: 12.701
Authors: Ferdia A Gallagher; Mikko I Kettunen; Sam E Day; De-En Hu; Jan Henrik Ardenkjaer-Larsen; René in 't Zandt; Pernille R Jensen; Magnus Karlsson; Klaes Golman; Mathilde H Lerche; Kevin M Brindle Journal: Nature Date: 2008-05-28 Impact factor: 49.962
Authors: Pablo D Becker; Miriam Nörder; Sebastian Weissmann; Ronny Ljapoci; Volker Erfle; Ingo Drexler; Carlos A Guzmán Journal: Vaccines (Basel) Date: 2014-07-22