Characteristic and expression of Hsp70 and Hsp90 genes from Tyrophagus putrescentiae and their response to thermal stress.

The development of insects is critically affected by temperature, which therefore plays an important role in the control of stored grain pests. Extreme temperature stress conditions lead to biological responses in mites, such as the synthesis of heat shock proteins. Tyrophagus putrescentiae (Tp) is a pest mite in stored grain that has negative effects on both economy and health. Since T. putrescentiae population dynamics are strongly influenced by temperature, in the present study we have cloned the cDNA of HSP70 and HSP90 (referred to as TpHSP70-1, TpHSP70-2 and TpHSP90) and determined their expression by fluorescence real time quantitative PCR. TpHSP70 and TpHSP90 showed high homology with similar genes in other species and the open reading frames of TpHSP70-1, TpHSP70-2 and TpHSP90 encoded proteins of 665, 661 and 718 amino acid residues, respectively. Under thermal stress, expression of TpHsp70-1 and TpHsp90 was up-regulated at higher temperatures, suggesting their role in the defense against thermal stress.

Introduction

Storage mites are aeroallergens that can cause asthma and rhinitis in sensitised individuals[1,2]. In some cases, they may lead to anaphylaxis caused by the ingestion of contaminated food[3,4]. Tyrophagus putrescentiae is a mite that can be found worldwide in farms, laboratories, urban environments and food industries[5,6] from where they have been successfully isolated[7,8]. T. putrescentiae is also associated to host bacterial communities or symbionts in the gut, fat body or other tissues[9-11].

Normal growth and development in insects requires appropriate temperature, otherwise they stagnate and even die[12]. Their body temperature is close to that of their habitat, making them vulnerable to extreme temperatures[13]. High temperatures can cause developmental abnormalities or defects[12,14]. Since immature mites and other poikilotherms cannot efficiently regulate body temperature, the latter is usually the most important environmental factor that impacts in their development rate[12,15].

In T. putrescentiae, the full normal pattern of development of early immature stages, egg, larva and protonymph, has been suggested to be seriously impaired under temperature stress and reproductive parameters and temperature are closely related[16,17].

Heat shock proteins (Hsps) are molecular chaperones with crucial roles in protein folding and unfolding, aggregation, degradation and transport[18]. They are also important for the insect survival under thermal stress[17,19]. Indeed, when Drosophila was treated at 30–39 ℃, heat resistance correlated with Hsp70 gene expression at different stages[20]. When Hsp70 gene expression was inhibited by RNAi in Bemisia tabaci female, survival was lower than in the control group[21]. The literature reports the study of Hsp90 and Hsp70 genes of a few mites in the Tetranychidae. In Panonychus citri, although the three Hsp70 proteins were expressed under cold shock, only Hsp70-2 was up-regulated under heat shock, whereas Hsp90 gene was expressed under high temperature stress, suggesting that both Hsp90 and Hsp70-2 proteins play an important role in the adaptation to high temperatures[22,23]. Also, in Tetranychus cinnabarinus, Hsp70-1 and Hsp70-3 play a vital role in cold and heat stress[24]. Overall, these results suggest that Hsps play an important role in improving heat resistance of mites.

Herein, to understand the adaptation of T. putrescentiae to temperature stress we have cloned its full-length Hsp70 and Hsp90 cDNAs and measured their mRNA expression at different temperatures using real-time quantitative polymerase chain reaction (RT-qPCR).

Materials and methods

Mites

T. putrescentiae adults were collected from the storages at Nanchang suburb, Jiangxi Province, China. The mites were fed with wheat bran (Shangdong, China) in specially made plastic containers (18 × 11 × 8 cm) covered with a lid to prevent escape. A 3 cm diameter hole was shorn on the lid for ventilation[25] T. putrescentiae of different ages were identified by our laboratory teachers using the Manual of Acarology 3rd Edition as a reference[25]. Climate-controlled incubators (RXZ-260B) were used to keep the rearing units for several generations at 25 ± 0.5 ℃ and 75 ± 5% relative humidity (controlled by a YADU ultrasonic humidifier) in the dark.

Total RNA extraction and cDNA synthesis

300 female adults of T. putrescentiae were taken from the experimental population. Total RNA was extracted using the TRIzol method (Invitrogen, San Diego, CA, USA) and then treated with DNase I (Tiangen, Beijing, China)[23,26]. Concentration and purity of RNA was assessed with a NanoDrop2000 spectrometer (Thermo, USA) at 260 nm and 280 nm. Finally, the integrity of total RNA was tested using 1% agarose gel electrophoresis. The first strand cDNAs were obtained using the Reverse Transcription M-MLV Kit (TaKaRa, Tokyo, Japan): 1 µL of random 6-mers, 1 µL of dNTP mixture and 8 µL of total RNA were mixed and incubated at 65 ℃ for 5 min to improve reverse transcription efficiency. Then, 4 µL of 5 × PrimeScript II Buffer, 0.5 µL of RNase Inhibitor and 1 µL Primer Script II RTase were mixed with RNase-free water up to a final volume of 20 µL. Finally, the mixture was incubated at 45 ℃ for 50 min and at 70 ℃ for 15 min. The cDNA was stored at − 20 ℃ for subsequent experiments. Each sample was processed with three biological replicates.

Degenerate primers and amplification of cDNA

To amplify partial cDNA fragments of Hsp70 and Hsp90, degenerate primers were designed (Table 1) and used in PCR as described previously[23,27]. PCR reactions used 0.1 μg cDNA as template, 0.3 μM of each primer, 12.5 μL 2 × Taq polymerase Mix (Tiangen, Beijing, China) and ddH2O was added to a total volume of 25 μL.

Table 1

Primers used in this study.

Experiments	Primer name	Primer sequences(5′–3′)	Primer size (bp)	Tm (℃)	GC%	Amplicon size (bp)
Full length PCR amplification	TpHSP70-1F	CAAGCTACCAAACGCGACTAACC	23	55	52	766
	TpHSP70-1R	AAAGGAGCCGCAATGTTGAATG	22	57	45.5
	TpHSP70-2F	AAAGGAAGAGGTTGGCAAGGAA	22	56	45.5	768
	TpHSP70-2R	CAGTTGAAGGAAGGGTAGAGTGGA	24	55	50
	TpHSP90F	TACTCTACGCTTTACATCCGAACAC	25	49	44	750
	TpHSP90R	GAACAACTTAATCAACCTCCTCCAT	25	49.5	40
Hsp70-3'-RACE	3TpHSP70-1F1	CACCAAGATGAAGGAGACCGCCGAG	25	60	60	1741
	3TpHSP70-1F2	CAAGAAGACCCAGGGCGAGAAGAAC	25	59	56
	3TpHSP70-2F1	ACAAGAAGGAGGGCGAGAAGAAC	23	57	52.2	1140
	3TpHSP70-2F2	GATCGACAATGAAGCCCGTGCAG	23	59	56.5
Hsp70-5'-RACE	5TpHSP70-1R1	GATCGACTTGTTGAGCTCCTTGCC	24	58	54.2	1095
	5TpHSP70-1R2	GGCACGGGTGATCGAGGAGTAGAA	24	60	58.3
	5TpHSP70-2R1	GCTGCGAATGTCCTTGCCGGTCT	23	61	60.9	890
	5TpHSP70-2R2	CCACCGCCCAGATCGAACACCAG	23	63	65.2
Hsp90-3'-RACE	3TpHSP90F1	CGTCAAGAAGTGCCTGGAGCTGT	23	58.5	56.5	747
	3TpHSP90F2	TGAGGAGAAGAAGAAGCGCGAGG	23	58.5	56.5
Hsp90-5'-RACE	5TpHSP90R1	CATGTAGACGACCTCGAAGCCAC	23	58.5	56.5	1402
	5TpHSP90R2	CGTCAAACAGCTCCAGGCACTTC	23	58.5	56.5
Real-time PCR	qTpHSP90F	TTCCAGTGGCGACGAGATGT	20	60.8	55	180
	qTpHSP90R	TCCTCAGGCAGCTCCAGACC	20	62	65
	qTpHSP70-1F	CACTAACGACAGGCGATTCTACG	23	59.4	52.2	150
	qTpHSP70-1R	TCAACCGAACAACCACTCAAGC	22	58.5	50
	qTpHSP70-2F	GAACTGGTCCTGCTCGATGTGAAC	24	60.5	54.2	120
	qTpHSP70-2R	ACCCTCGAAGACTTGAATTGTGACG	25	57	48
	qTpTubulinF	TATCCTCGCATTCACTTTCCTCTGG	25	57	48	100
	qTpTubulinR	CGAAGCAGGTGTTGGTAATCTCAGC	25	59	52

The PCR programs were operated with the following cycling conditions: initial denaturation step of 3 min at 94 ℃ followed by 35 cycles of 94 ℃ (30 s), 49 ℃ (30 s), 72 ℃ (60 s) and 72 ℃ (10 min). PCR products were detected with 1% agarose gel. Bands with expected size were purified with a universal DNA purification kit. Purified DNA fragments were cloned into a pGEM-T Easy vector and transfected into Escherichia coli DH5α (Promega, Madison, WI, USA). DNA inserts of the recombinant clones were confirmed by PCR with the same degenerate primers used previously and by sequencing in both directions.

Rapid amplification of cDNA ends

The rapid amplification of cDNA ends (RACE) method was applied to obtain full-length cDNAs. Gene specific primers were designed (Table 1) using the identified Hsp70 and Hsp90 cDNA fragments, and 5′ and 3′-Full RACE Kits (TaKaRa, Tokyo, Japan) were used to amplify the 5′ and 3′-ends of the two genes. The first-round PCR program was pre-denaturation at 94 ℃(180 s) followed by 35 cycles of 94 ℃ (30 s), 60 ℃(30 s) and 72 ℃ (90 s) with a final extension at 72 ℃ (6 min). The second-round PCR program was the same as the first-round.

The PCR products from the 5′- and 3′-RACE reactions were cloned into the pGEM-T Easy vector and transfected into Escherichia coli DH5α cells (Promega, Madison, WI, USA). Six recombinant clones were identified by PCR amplification and sequenced (Sangon, Shanghai, China).

Confirmation of full-length cDNA sequences

After the 5′- and 3′-ends sequences were obtained, contigs were assembled with the Seqman software[28] to produce the putative full length sequences of HSP70 and HSP90. Full length cDNAs were verified by amplification of the ORFs using the primers listed in Table 1. PCR products were cloned into a pGEM-T Easy vector and sequenced. PCR conditions and cloning methods were as described above.

Bioinformatics analysis

The sequences of TpHSP70 and TpHSP90 were blasted at the National Center for Biotechnology Information website (http://www.ncbi.nlm.nih.gov/BLAST/) at both nucleotide and amino acid levels. Amino acid sequences were analyzed with the Expert Protein Analysis System (http://www.expasy.org/). Multiple alignments of TpHSP70 and TpHSP90 were analyzed in the DNAstar software (7.1 version). Neighbor-joining phylogenic trees were constructed with ClustalX 2.0 and MEGA 5.0 using the gene sequences of HSP70 and HSP90 (sequences shown in Table 2). The confidence of the branches was obtained using 1000 replicates’ Bootstrap analysis.

Table 2

HSP70 and HSP90 sequences used in phylogenetic analysis.

Accession Number	Organism	Hsp70 or Hsp90
NP_001036837	Bombyx mori	BmHSP70-1
NP_727563	Drosophila melanogaster	DmHSP70-3
AIS39468	Haemaphysalis lava	HlHsp70
NP_005338	Homo sapiens	HsHSP70
XP_002407132	Ixodes scapularis	IsHsp70-2
XP_002433656	Ixodes scapularis	IsHsp70-1
ABK76338	Marsupenaeus japonicus	MjHsp70
BAE39187	Mus musculus	MmHsp70-1
BAE41082	Mus musculus	MmHsp70-2
AGQ50609	Neoseiulus cucumeri	NcHsp70
ADE34170	Nilaparvata lugens	NlHsp70
XP_001510947	Ornithorhynchus anatinus	OaHsp70
ADM83423.1	Panonychus citri	PcHsp70-1
ADM83424.1	Panonychus citri	PcHsp70-2
ADM83425.1	Panonychus citri	PcHsp70-3
NP_077327	Rattus norvegicus	RnHsp70
ACG60423	Tetranychus cinnabarinus	TcHsp70-2
ACG60424	Tetranychus cinnabarinus	TcHsp70-3
ABC33921	Tetranychus urticae	TuHSP70
AAB97092	Xenopus laevis	XlHsp70
KR479867	Tyrophagus putrescentiae	TpHSP70-1
KR479868	Tyrophagus putrescentiae	TpHSP70-2
AJQ31840.1	Tyrophagus putrescentiae	TpHSP90
NP_001036876.1	Bombyx mori	BmHSP90
ADP37710.1	Helicoverpa armigera	HaHSP90
BAE44307.1	Chilo suppressalis	CsHSP90
AAA96259.1	Xenopus laeviens	XlHSP90
CAA30276.1	Drosophila melanogaster	DmHSP90
ACO83357.1	Penaeus monodon	PmHSP90
EEC05121.1	Ixodes scapularis	IsHSP90
XP_003745497.1	Metaseiulus occidentalis	MoHSP90
AAB23369.1	Rattus sp.	RaHSP90
AAI21063.1	Homo sapiens	HsHSP90
BAK08840.1	Chara braunii	CbHSP90
AGQ50610.1	Neoseiulus cucumeris	NcHSP90
ACF75907.1	Tetranychus cinnabarinus	TcHSP90
ADM83426.1	Panonychus citri	PcHSP90

mRNA expression of TpHSP70 and TpHSP90 under thermal stress

Sample collection at different stages

The eggs of T. putrescentiae were separated with a 140 mesh sieve. These eggs continued to grow and develop and were observed every 12 h. After many generations, about 400 eggs, 400 larvae, 200 nymphs and 200 female adults were taken for total RNA extraction. Each experiment was repeated three times.

Thermal stress treatment

Two hundred female adult mites were transferred to 1.5 mL centrifuge tubes sealed with a 0.45 µm filter membrane (BBI, China) for ventilation. In total, ten tubes with 200 mites each were exposed to 0, 5, 10, 15, 20, 30, 33, 36, 39, and 42 ℃, respectively for 1 h, where mites kept at 25 ℃ were used as control group. Three replicates were used for each group.

qPCR of TpHSPs

qPCR assays were performed on Fx960 Real-time Quantitative PCR (BIO-RAD, USA) with alpha-tubulin gene from T. putrescentiae (GenBank accession number: AY986760) as endogenous reference. Each PCR reaction was mixed with 10 µL TB green, 7.8 µL ddH2O, 1.0 µL cDNA, 0.4 µL Rox dye and 0.4 µL of each primer. The thermal cycling profile consisted of an initial denaturation at 95 ℃ (5 min) and 40 cycles at 95 ℃ (10 s) and 60 ℃ (20 s). For each gene specific primer, three independent replicates were performed, each repeated three times. The expression levels of TpHSP70 and TpHSP90 were calculated with the 2−ΔΔCt method[29].

Data analysis

Data was represented as the mean ± SE (standard error) for all data sets. The data were then subjected to a one-way analysis of variance (ANOVA) using SPSS 26.0 (Chicago, IL, USA). Differences between means were tested using the Duncan’s test for multiple comparisons. Differences were considered statistically significant at the 5% level (p < 0.05).

Results

Sequence analysis of TpHSP70 and TpHSP90 genes

The complete cDNA sequences of TpHSP70-1 (GenBank accession number: KR479867) and TpHSP70-2 (GenBank accession number: KR479868) were 2494 (ORF of 1,998) and 2354 bp (ORF 1984 bp) long, respectively (Fig. 1A, B). The TpHSP70-1 cDNA included a 186 bp 5′ untranslated region (UTR) and a 310 bp 3′ UTR. TpHSP70-1 encodes a 665 amino acid protein with a calculated molecular weight of 72.72 kDa and an isoelectric point of 5.21. The TpHSP70-2 cDNA included a 168 bp 5′ untranslated region and a 173 bp 3′ UTR. TpHSP70-2 encodes a 661 amino acid protein with a calculated molecular weight of 72.75 kDa and an isoelectric point of 5.29. For both proteins, a possible consensus signal sequence for polyadenylation (AATAAA) was located 45 bp upstream of the poly (A) tail and both have three motifs typical of the Hsp70 proteins family.

Figure 1

Nucleotide and deduced amino acid encoding region of TpHSP70-1 (A), TpHSP70-2 (B) and TpHSP90 (C). Signature sequences of TpHSP genes are marked with underline.

The complete cDNA of the TpHSP90 gene was deposited in GenBank with accession number KJ820823 and consisted of 2538 bp with an ORF of 2157 bp, which encoded a 718 amino acid protein (Fig. 1C). The TpHSP90 cDNA included a 165 bp 5′ untranslated region located upstream of the putative start codon (ATG) and a 216 bp 3′ UTR located downstream of the stop codon. The mature protein had a calculated molecular weight of 82.79 kDa with an isoelectric point of 4.92. A possible consensus signal sequence for polyadenylation (AATTAAA) was located 15 bp upstream of the poly (A) tail. The typical histidine kinase-like ATPase domain, ubiquitous in all Hsp90 family members, was located at the position of 37–181. TpHSP90 contained the five typical motifs observed in Hsp90 proteins: NKEIFLRELISNASDALDKIR, LGTIAKSGT, IGVFGVGFYSAYLIAD, IKLYVRRVFI and GVVDSEDLPLNISRE. The C-terminal "MEEVD" motif, which is specific to the of Hsp90 family (cytoplasmic type). Comparative analysis showed that the amino acids of HSP90 in T. putrescentiae presented high similarity of 79–81% with Hsp90 in other species.

Homology analysis of TpHSP70 and TpHSP90

A BLASTP (http://blast.ncbi.nlm.nih.gov/Blast.cgi) search of GenBank revealed that TpHSP70-1 and TpHSP70-2 belong to the HSP70 family and that TpHSP90 belongs to the Hsp90 family. Multiple sequence alignments showed that the deduced amino acid sequences of TpHSP70-1 and TpHSP70-2 share high similarity with three HSP70s from Tetranychus cinnabarinus, Ixodes scapularis, Bombyx mori, Drosophila melanogaster and Homo sapiens (Fig. 2A). Phylogenetic analyses showed that TpHSP70-1 and TpHSP70-2 belong to the cytoplasmic and the endoplasmic reticulum types of the phylogenetic tree, respectively (Fig. 3A).

Figure 2

Comparison of the amino acid sequences of HSP70 protein family (A) and HSP90 protein family (B).

Figure 3

Phylogenetic tree of HSP70 (A) and HSP90 (B) from T. putrescentiae and other species. Constructed by the neighbor joining method based on amino acid sequences. Numbers at each branch indicate the percentage of times, and a node is supported in 1,000 bootstraps pseudo-replication by neighbor joining.

The deduced amino acid sequence of TpHSP90 shared high similarity with five HSP90s from T. cinnabarinus, I. scapularis, B. mori, D. melanogaster and H. sapiens (Fig. 2B). Among these, TpHSP90 showed the highest similarity to Hsp90 from I. scapularis (81% identity), and lowest similarity with HSP90 from D.melanogaster (77% identity). HSP90 homology was high within the arthropods, especially in the signature regions of the Hsp90 family. The relationships between HSP90s displayed in the phylogenic tree are consistent with the traditional taxonomy of these species (Fig. 3B). HSP90 from T. putrescentiae and T. cinnabarinus cluster together earlier than I. scapularis, M. occidentalis and N. cucumeris (Fig. 3B).

Expression of TpHSP70 and TpHSP90 in different stages of development

Tubulin was used as a reference gene to measure the mRNA expression level of TpHSP90, TpHSP70-1 and TpHSP70-2 in different developmental stages of T. putrescentiae: egg, larva, protonymph, tritonymph and adult. The mRNA expression levels of all three genes increased with the development of the mites, but their genes’ expression levels varied greatly (Fig. 4). Although the expression levels of the TpHSP70-2 gene changed with developmental stage, no significant differences were observed in the expression levels of TpHSP70-1 gene and TpHSP90 genes across developmental stages. The expression level of TpHSP70-1, TpHSP70-2 and TpHSP90 genes was highest in the protonymph, tritonymph and in the larva, respectively. Thus overall expression of three TpHSPs was highest in the immature stages, and lower in the egg and adult stage. Interestingly, expression of heat shock protein genes was higher in female mites than in male mites.

Figure 4

Stage-specific TpHSP70-1, TpHSP70-2 and TpHSP90 expression in T.putrescentiae. The mRNA expression level of TpHSP70-1, TpHSP70-2 and TpHSP90 genes in different developmental stages including egg, protonymph, deutonymph, tritonymph and adult stages of T.putrescentiae was measured by fluorescent real-time quantitative PCR. Values are the mean ± SD (n = 200). The different letters above the bars (a–f) indicate a significant difference in the means as assessed using Duncan’s multiple comparison tests (P < 0.05).

Dependency of TpHSP90 and TpHSP70 expression on temperature

The expression patterns of TpHSP90 and TpHSP70 mRNA were examined at low temperatures. Expression of TpHSP70-1 gene peaked at 10℃, where it was 6.05 times higher than in the control group. The TpHSP70-2 gene peaked at 20℃. Finally, TpHSP90 gene peaked at 0 ℃, but no differences were observed between 5, 10, 15 and 25 ℃ (Fig. 5A). At high temperatures, expression of TpHSP70-1 gene peaked at 39 ℃ (Fig. 5B) where expression was 19.73 times higher than in the control. The expression of TpHSP70-2 gene peaked at 30 ℃, whereas at other temperatures expression was the same as in the control. Finally, TpHSP90 gene expression peaked at 42 ℃ (4.17 times higher than in the control group).

Figure 5

(A) Comparative quantitative RT-PCR analyzed of the relative expression of TpHSP70-1, TpHSP70-2 and TpHSP90 at low temperatures. Control: 25 ℃; Low heat shock temperature: 0, 5, 10, 15, 20 ℃. (B) Comparative quantitative RT-PCR analyzed of the relative expression of TpHSP70-1, TpHSP70-2 and TpHSP90 at high temperatures. Control: 25 ℃; High heat shock temperature: 30, 33, 36, 39, 42 ℃. Each temperature treatment was three replicates. Data were represented as the mean ± SD (n = 200). Letters above columns indicate levels of difference significance at P < 0.05. The same letters are not significantly different, P > 0.05.

Discussion

In the present study, we cloned the three full-length cDNAs of HSP70-1, HSP70-2 and HSP90 genes and evaluated their expression in response to thermal stress, in the hope to understand how they help withstand extreme temperatures. Our results show that TpHsp70-1 plays the most important role at low temperatures, whereas at high temperatures (heat stress), both TpHsp70-1 and TpHsp90 are important. Expression of HSPs helps organisms to adapt to high temperatures as shown by many studies, e.g., in D. melanogaster[19], S. exigua[30], T. cinnabarinus[24,28,31] and P. citri[23,32].

Under cold stress conditions, we found that TpHSP70-1 and TpHSP70-2 failed to express, consistent with Hsp70 expression results in T. cinnabarinus[24,28], P. citri[24] and D. melanogaster[19]. This suggests other mechanisms in T. putrescentiae to help resist low temperatures, such as the synthesis of trehalose, polyols and other small molecules, antioxidant reactions and production of other heat shock proteins[24].

The expression of T. putrescentiae TpHSP70-1 and TpHSP90 genes was up-regulated at higher temperatures and improved heat resistance. In particular, the relative mRNA expression level of TpHSP70-1 at 39 ℃ was 19.03 times higher than the control group. The survival of Bactrocera tryoni’s eggs and larvae at 46 ℃ is significantly lower than the control[33] and it has been suggested that exposure of Ceratitis capitata to sublethal temperatures of 42 ℃ for 1 h enhanced heat resistance[34]. The heat resistance of Anastrepha suspensa raised at 30 ℃ was higher than in those raised at 20 ℃[35]. Lastly, after a short period of high temperature stress, survival time was prolonged in Cydia pomonella exposed at lethal temperatures[36]. The synthesis of heat shock protein begins to decline after a certain threshold[32]. We found that TpHSP70-1 expression was highest at 39 ℃ and decreased at 42 ℃, which may reflect proximity to that threshold[23,37]. Therefore, heat shock proteins can protect biological cells only to a certain extent[37]: induced high expression of heat shock proteins can improve insect heat resistance, but this expression affects the synthesis of other proteins in the insect body, which results in shortened life span and reduced fertility[27,38]. Indeed, our results show that the number of eggs laid by T. putrescentiae decreased significantly after exposure to temperatures above 39 ℃.

Heat shock protein genes are also involved in normal physiological activities and in fertility. These include the folding of new peptide chains to form mature proteins, the formation of gametes and cell differentiation[39]. We show that the transcription and expression level of the HSP90 gene of T. putrescentiae depends on the developmental stage, being higher in the larval stage. This indicates that this gene is also involved in the regulation of growth and development. Expression of Hsp70 fluctuated with the development period, suggesting its involvement in normal physiological activities and reproductive development.

Finally, the mRNA expression level of heat shock protein genes in the female adult was higher than in the male, consistent with Grapholita molesta results[27], and hinting that the ability to cope with environmental temperature stress is higher in females.

In conclusion, new TpHSP90, TpHSP70-1and TpHSP70-2 genes sequences were isolated from T. putrescentiae, and their phylogeny with other mites was inferred. Their expression levels varied with the developmental stages and the highest expression observed was in the immature mite, suggesting that TpHSPs genes are involved in the regulation of growth and development. These three TpHSPs genes are important for T. putrescentiae to defend against temperature and are closely related to mortality. Our study helps to understand the resistance of mites and other insects to environmental stress, and guides T. putrescentiae management by using different temperatures in crops.