Literature DB >> 34064696

Development of CAPS Markers for Evaluation of Genetic Diversity and Population Structure in the Germplasm of Button Mushroom (Agaricus bisporus).

Hyejin An1, Hwa-Yong Lee2, Donghwan Shim3, Seong Ho Choi4, Hyunwoo Cho1, Tae Kyung Hyun1, Ick-Hyun Jo5, Jong-Wook Chung1.   

Abstract

Agaricus bisporus is a globally cultivated mushroom with high economic value. Despite its widespread cultivation, commercial button mushroom strains have little genetic diversity and discrimination of strains for identification and breeding purposes is challenging. Molecular markers suitable for diversity analyses of germplasms with similar genotypes and discrimination between accessions are needed to support the development of new varieties. To develop cleaved amplified polymorphic sequences (CAPs) markers, single nucleotide polymorphism (SNP) mining was performed based on the A. bisporus genome and resequencing data. A total of 70 sets of CAPs markers were developed and applied to 41 A. bisporus accessions for diversity, multivariate, and population structure analyses. Of the 70 SNPs, 62.85% (44/70) were transitions (G/A or C/T) and 37.15% (26/70) were transversions (A/C, A/T, C/G, or G/T). The number of alleles per locus was 1 or 2 (average = 1.9), and expected heterozygosity and gene diversity were 0.0-0.499 (mean = 0.265) and 0.0-0.9367 (mean = 0.3599), respectively. Multivariate and cluster analyses of accessions produced similar groups, with F-statistic values of 0.134 and 0.153 for distance-based and model-based groups, respectively. A minimum set of 10 markers optimized for accession identification were selected based on high index of genetic diversity (GD, range 0.299-0.499) and major allele frequency (MAF, range 0.524-0.817). The CAPS markers can be used to evaluate genetic diversity and population structure and will facilitate the management of emerging genetic resources.

Entities:  

Keywords:  AMOVA; Agaricus bisporus; CAPS marker; PCoA; accumulation curve; genetic diversity; population structure

Year:  2021        PMID: 34064696      PMCID: PMC8151297          DOI: 10.3390/jof7050375

Source DB:  PubMed          Journal:  J Fungi (Basel)        ISSN: 2309-608X


1. Introduction

Button mushroom (Agaricus bisporus) is a popular edible mushroom that is consumed worldwide. A. bisporus extracts have high antioxidant activity and are known to improve cardiovascular health [1,2]. Global mushroom production increased more than 30-fold during 1978–2013, and total production value increased to $63 billion [3]. A. bisporus production is approximately 4.4 million tons per year, constituting 15% of global mushroom production [3]. Despite the high economic value of button mushrooms, genetic diversity is low. Although new strains can be produced through phenotypic selection and limited parent strain crossing, high similarity remains among varieties [4]. Evaluation of the genetic characteristics of mushrooms with similar phenotypes is needed to facilitate the introduction of novel traits into commercial varieties. Molecular resources are also needed to support the efficient selection of accessions, collection and preservation of strains, diversity assessment, and population structure analysis [5]. The rapid development of next-generation sequencing technologies has enabled large-scale sequencing projects in a variety of organisms. Molecular markers that are stable, highly polymorphic, and provide valuable diversity information are preferred over phenotype-based markers that are subject to environmental effects [6]. Polymerase chain reaction (PCR)-based molecular markers, such as simple sequence repeats (SSR) and single nucleotide polymorphisms (SNPs), can be used for molecular genetic studies of culture collections. Genetic diversity in A. bisporus has been examined using several similar approaches, including analysis with restriction fragment length polymorphisms (RFLP) [7], discrimination analysis with random amplified polymorphic DNA (RAPD) [8], genetic diversity analysis using SSR markers [9,10,11], phylogenetic analysis using SNP markers [12], SNP genotyping [13,14], and quantitative trait locus (QTL) mapping using SNP markers [15,16]. However, molecular markers that can be used for the analysis of population structure and diversity of accession collections are biased toward SSR markers, and new SNP genotyping markers are needed. SNPs, which are differences at single nucleotide positions between or within species, are the most widely distributed genetic variants in the genome. SNPs found in coding and non-coding regions are classified as transitions (Ts) (C/T or G/A) or transversions (Tv) (C/G, A/T, C/A, or T/G), depending on the type of nucleotide substitution. If present in coding regions, SNPs can change the structure or function of proteins, causing phenotypic differences [17]. Thus, compared with methods using other molecular markers, SNP genotyping-based diversity assessments can more accurately and specifically explain phenotypic differences. SNP markers are highly reproducible co-dominant markers that can be used to distinguish between homozygosity and heterozygosity and to discriminate accessions, and they can also be used for association mapping and analysis of genetic diversity and group structure [18,19,20]. Two main types of SNP-based markers are cleaved amplified polymorphic sequences (CAPS) and derived cleaved amplified polymorphic sequences (dCAPS), the latter of which offers increased utility for genotyping [21,22]. CAPS marker, also known as the PCR–RFLP marker, combined with primers that can amplify specific regions is popularly used for molecular genetic studies in fungus, owing to its advantage in detecting secondary polymorphisms that cannot be directly detected by PCR amplification [23,24]. Moreover, since the CAPS marker system consists of PCR and restriction enzyme treatment, it is much easier and less time-consuming than conventional RFLP based on Southern hybridization. In this study, CAPS markers were developed for the analysis of genetic diversity and population structure in A. bisporus accessions. The newly developed CAPS markers will support the efficient evaluation and management of new and existing accessions, thereby facilitating further studies on genetic diversity and population structure in button mushrooms.

2. Materials and Methods

2.1. A. bisporus Genetic Resources and DNA Extraction

For the genetic diversity and population structure analysis, we used 41 A. bisporus strains provided by the Korean Mushroom Culture Collection (KMCC) at the National Institute of Horticultural and Herbal Science (NIHHS) of Rural Development Administration (RDA) in Eumseong, Republic of Korea. Geographic origins and KMCC numbers of 41 A. bisporus strains are given in Table 1.
Table 1

A. bisporus accessions used for validation of CAPS markers.

Strain NumberGeographic RegionStrain NumberGeographic Region
KMCC00540KORKMCC00832CHN
KMCC00542KORKMCC00839CHN
KMCC00544KORKMCC00850NLD
KMCC00556JPNKMCC00851NLD
KMCC00569USAKMCC00866KOR
KMCC00570USAKMCC00867KOR
KMCC00575JPNKMCC00876KOR
KMCC00620NLDKMCC00877KOR
KMCC00631JPNKMCC00879KOR
KMCC00633JPNKMCC00881USA
KMCC00660DEUKMCC00882KOR
KMCC00662DEUKMCC00925KOR
KMCC00663DEUKMCC00926CHN
KMCC00670DEUKMCC00944USA
KMCC00677NLDKMCC00945NLD
KMCC00693DEUKMCC00947USA
KMCC00705JPNKMCC00952NLD
KMCC00706JPNKMCC00956USA
KMCC00728CHNKMCC00997CHN
KMCC00746KORKMCC4744KOR
KMCC00751KOR
A. bisporus strains were plated on compost dextrose agar (CDA) medium (Kisanbio, Seoul, Korea), incubated at 25 °C in the dark for 60 days, and lyophilized. DNA extraction was performed using a Plant SV mini kit (GeneAll, Seoul, Korea) according to the manufacturer protocol. Extracted DNA concentrations were quantified using an Epoch microplate spectrophotometer (BioTek, Winooski, VT, USA).

2.2. Primer Construction and PCR

To develop CAP markers, SNP mining was performed based on the A. bisporus genome and resequencing data derived from our previous study [10]. Software (dCAPS Finder 2.0) [25] was used to identify restriction enzyme recognition sites based on the resulting SNPs, and a set of 70 CAPS markers was produced (Table 2). PCR reactions (20 µL) contained 10 µL of Excel TB 2× Taq premix (Inclone Biotech, Yongin, Korea), 2 µL of 10 pmol primer (forward/reverse), 5 µL of distilled water, and 3 µL of DNA. DNA amplification was performed as follows: initial denaturation at 95 °C for 2 min; followed by 30 cycles of denaturation at 95 °C for 20 s, annealing at 55 °C for 40 s, and extension at 72 °C for 45 s; and a final extension at 72 °C for 10 min. Amplified PCR products were digested using 38 restriction enzymes. Restriction reactions (10 µL) contained 1 unit of restriction enzyme, 1 µL 10 × NEBuffer™, and 5 µL PCR product. Reactions were incubated at an appropriate temperature (Table 2) for 60 min. Digested PCR products were analyzed using 2.5% agarose gel electrophoresis.
Table 2

CAPS markers developed using SNPs mined from A. bisporus resequencing data.

CAPS MarkerSNP LocusChr.SubstitutionRefAltRestriction EnzymeTemp. (°C)Left (L)/Right (R) Primer
AB-gCAPS-001HD1 homeodomain transcription factor A mating type proteinChr01TransversionCAFnu4HI37L–TGTCAATGTCAATTCAGACTCC
R–TTTGAATATCGTGTTGCAGAGA
AB-gCAPS-002HD1 homeodomain transcription factor A mating type proteinChr01TransitionTCNdeI37L–CTCAATCGAGGACGAGTTATTC
R–GTTCGAGCTCAAAATCAAGTTC
AB-gCAPS-003HD1 homeodomain transcription factor A mating type proteinChr01TransversionGTHpyCH4V37L–CTCAATCGAGGACGAGTTATTC
R–GTTCGAGCTCAAAATCAAGTTC
AB-gCAPS-004PIF1 proteinChr01TransitionAGBtsCI50L–ACTACAGTATCCACCAATTGCC
R–ATAGGGATTTAGTTGCCATGTG
AB-gCAPS-005PIF1 proteinChr01TransitionGABsaBI60L–TGATTCTTCCAAAGTTTGAGGT
R–ATGGCCTCTTATACTGGTGTTG
AB-gCAPS-006Transposon Tf2-11 polyproteinChr02TransversionACBtsCI50L–GAACCGTCTTGGTACTATTTGC
R–TAAGGCAGAACGTCTAGAGGAA
AB-gCAPS-007Transposon Tf2-11 polyproteinChr02TransitionAGMseI37L–CCACACTCCTCGCATCTATATT
R–GTGGGTACAAAGACAAAGGAAA
AB-gCAPS-008Oleate activated transcription factor 3, partialChr06TransitionTCTaqI-v265L–CTCAGCCATCTCTACCTCTCTC
R–ACATGTACAAGACCGTCAATCA
AB-gCAPS-009ATP20 subunit G of the mitochondrial F1F0 ATP synthaseChr07TransversionGCHpy99I37L–TTAGGTGTACAAAGACAATGCG
R–CTTCTCCAACTCTTTAACGCTC
AB-gCAPS-012ATP20 subunit G of the mitochondrial F1F0 ATP synthaseChr07TransversionCAHpyCH4IV37L–CATCATCTGTTGTGGTCATCTC
R–AGTGAGGCAATAAAATGGAAGA
AB-gCAPS-013ATP20 subunit G of the mitochondrial F1F0 ATP synthaseChr07TransitionCTHaeIII37L–CATCATCTGTTGTGGTCATCTC
R–AGTGAGGCAATAAAATGGAAGA
AB-gCAPS-015Polyphenol oxidaseChr08TransitionGATaqI-v265L–GACCGTCAATTCTCTCTTTACG
R–AATCAAAACATAAGGACGATGC
AB-gCAPS-016Polyphenol oxidaseChr08TransversionACMseI37L–AAGTCATCTCCCTACCCAAAGT
R–TCGACTTTTATCAGACCCATTT
AB-gCAPS-017WC-1 blue light photoreceptorChr08TransitionGABtsCI50L–GTTCTGGAAGTAAAGCGAAGAC
R–CGTAGAACACAAAGTCTTGCAG
AB-gCAPS-018Serine/threonine-protein kinase ATG1Chr09TransitionAGHpyAV37L–GCAAGACTAGAGGGTGATGAAG
R–TATGTCCTTGTGGACGATACAA
AB-gCAPS-019Serine/threonine-protein kinase ATG1Chr09TransversionACApoI50L–CCTCCGATTGTTATCCATAGTC
R–GAGGTGTTAGATCCCAAAGCTA
AB-gCAPS-020Serine/threonine-protein kinase Ppk19Chr09TransitionGANcoI37L–ACCGTCTATCCCACAATGTTAG
R–GAATATGTTACCAGCATGGTCC
AB-gCAPS-021Serine/threonine-protein kinase Ppk19Chr09TransversionATBtsCI50L–TAGCAGTCTCTATGCTGGACAA
R–CCGGATACAGGAAGAACACTTA
AB-gCAPS-022Cytochrome P450Chr12TransversionTAHinfI37L–CATCGAAGCTGATGAGTACAAC
R–CGAATAGAACTGTCGAGTTTCC
AB-gCAPS-024Transposon Tf2-11 polyproteinChr12TransversionTGBccI37L–GTCTCCATTCTTCTAAACACCG
R–AGCACCAGAACTGGATAAAGAA
AB-gCAPS-025Retrovirus-related Pol polyproteinChr13TransitionGAHpy99I37L–CAAGTATCAAATGGAACTGCCT
R–AGATATACACACCGAAGGATGG
AB-gCAPS-026Retrovirus-related Pol polyproteinChr13TransitionCTDpnI37L–CAAATCTGCCTTCGTATTCATT
R–ATCATCAATCACGTCGAACATA
AB-gCAPS-028hypothetical protein AGABI2DRAFT_123095Chr02TransitionTCHpyCH4V37L–GTTTATCAAGTTCATCAAGCCC
R–TCTGGGTGCTTCTGTATTCTTT
AB-gCAPS-030hypothetical protein AGABI2DRAFT_196053Chr02TransitionCTRsaI37L–GAACCAATTCACAGTGGTTTCT
R–TACTTTATGGAGCCGTCAGAAT
AB-gCAPS-031hypothetical protein AGABI2DRAFT_146035Chr02TransitionCTHpy99I37L–AACGTCACTCTTACTCATGCAA
R–TACATGAATGCCTCATGTTGTT
AB-gCAPS-032hypothetical protein AGABI2DRAFT_146035Chr02TransversionTGMnlI37L–ATTACTGGGATGATGACTCTCG
R–AGGAGGGGTAGGGACTCTG
AB-gCAPS-033hypothetical protein AGABI2DRAFT_193507Chr03TransversionCABsmI65L–ATGTTGACATGTTGGACAGAAA
R–ATGGTGCCGTTGTAGTCTTACT
AB-gCAPS-034hypothetical protein AGABI2DRAFT_193507Chr03TransitionAGHpy166II37L–AGGGACGCTTAAAATTACCTGT
R–GTCTCCAAACTCGTCAGTTCTC
AB-gCAPS-035hypothetical protein AGABI2DRAFT_193507Chr03TransversionCGMspI37L–GCCATATGTCACCTCAGAAAAT
R–TTCTTTTTCTCAGGATGTTGCT
AB-gCAPS-036hypothetical protein AGABI1DRAFT_131635Chr03TransitionGAPvuI37L–CAATGGTGATCTAAGCACTCAA
R–AGGGAGACGAAGACAAAACATA
AB-gCAPS-037hypothetical protein AGABI2DRAFT_176555Chr03TransitionCTHaeIII37L–GTGCTTATCCTCGAATGTCTTC
R–GAATCGTCGGGATATAATGTTG
AB-gCAPS-038hypothetical protein AGABI2DRAFT_141360Chr03TransitionGAHpy188I37L–GTCACAGCAGCAAAGAAATACA
R–GGTGAGATTAGACAGAGGTTCG
AB-gCAPS-039hypothetical protein AGABI2DRAFT_200532Chr03TransversionTABtsCI50L–TGAGGATAGCGAAAGAAGAGAG
R–TAGCCTTCGATTTAAGTTCAGC
AB-gCAPS-041hypothetical protein AGABI2DRAFT_71082Chr03TransitionCTHaeIII37L–TATCTTGGTATTTACGATGGCG
R–TGTACTCAGCAGTCTTGTGCTC
AB-gCAPS-042hypothetical protein AGABI2DRAFT_71082Chr03TransitionTCNlaIV37L–ATAACAATGGCCATCAAACTCT
R–CGGCTCTCGTATAGAATGAATC
AB-gCAPS-043hypothetical protein AGABI2DRAFT_71082Chr03TransitionAGBsrDI65L–GATGCCACTTTAGACTTTTTGG
R–TATGGTAAATGGAAAAGATCCG
AB-gCAPS-045hypothetical protein AGABI2DRAFT_121386Chr04TransitionAGHpyCH4V37L–AACAGACTGACCTCACAAAACC
R–CGTCGTTATCTTTCCATTTGAT
AB-gCAPS-047hypothetical protein AGABI1DRAFT_90407Chr04TransitionGAHpyCH4V37L–CTCTTAGCGAGGCGTTATCTTA
R–ATTGGAACATAATTCATTGGGA
AB-gCAPS-048hypothetical protein AGABI2DRAFT_117363Chr04TransitionGAHpy188I37L–TTCCTTAAGCCAGTTTTGAAGA
R–GAGGATTGGACTAATACCGTGA
AB-gCAPS-050hypothetical protein AGABI2DRAFT_178864Chr06TransitionAGHphI37L–CACTACTTCCCCTCCTCTCTTT
R–ACTACCAAAAGAGGCATCTCAA
AB-gCAPS-051hypothetical protein AGABI2DRAFT_119143Chr06TransitionGAHaeIII37L–AGTTAGCTATTGCCTGAGCTTG
R–GTCACAAGCCATCTCAATCTTT
AB-gCAPS-052hypothetical protein AGABI2DRAFT_119143Chr06TransitionTCHpyCH4III37L–GGTTTTCTAGTGCCGTAGTGAG
R–TTCTCAATGACCCTTTGAACTT
AB-gCAPS-053hypothetical protein AGABI2DRAFT_119143Chr06TransversionATMluCI37L–TCAGTAAACTCCCTACGCTCAT
R–GCCTAGCCGTAAGTTCACATAA
AB-gCAPS-054hypothetical protein AGABI1DRAFT_126593Chr06TransitionAGSfaNI37L–CAACAATGTCTCCTTGAGTCCT
R–TTTCAGTTTGCATTCTCTGATG
AB-gCAPS-055hypothetical protein AGABI1DRAFT_126593Chr06TransversionATApoI50L–GATCCCCAAATAATGAATGCTA
R–TATACTCCCGACGTAGAACAGC
AB-gCAPS-056hypothetical protein AGABI1DRAFT_126595Chr06TransversionTGBtsCI50L–GATGGTCACGATTTGTTTCTTT
R–AACAAACCTCATTATTTCTGCC
AB-gCAPS-058hypothetical protein AGABI2DRAFT_179115, partialChr06TransversionCGRsaI37L–GTTTCTGGAGGGAGTATACGTG
R–ATCACATGTCAAGTTGTGGAGA
AB-gCAPS-059hypothetical protein AGABI2DRAFT_225478Chr10TransitionCTTsp45I65L–CAGTGGTACGACGTTCAAAATA
R–ACACCAATTATGGTCTCGATTC
AB-gCAPS-061hypothetical protein AGABI1DRAFT_133092, partialChr10TransitionGAHphI37L–ACAAAACGAGAAGAGCAGAGAG
R–CTAATACGATTTACGATGGCGT
AB-gCAPS-062hypothetical protein AGABI1DRAFT_133088Chr10TransitionGABssSI37L–CTCGAGATAGCAGAGGAGCAT
R–TACAACGCATCGTACTCAAAAC
AB-gCAPS-063hypothetical protein AGABI1DRAFT_133088Chr10TransversionGTBssSI37L–AGCTTTTGCACGAGATGAATAC
R–AGGAAGGTTGAGAAAGGGATAG
AB-gCAPS-064hypothetical protein AGABI2DRAFT_194394Chr10TransversionCGBstAPI60L–GTCTCTTCATCGAAACCATCTC
R–TTTGGCATCATTCATTACTTCA
AB-gCAPS-065hypothetical protein AGABI2DRAFT_179918Chr10TransitionCTBstNI60L–CCTTATTCTTGTGATTGAAGGC
R–GACATTTGGTGCAGGAGTAGAT
AB-gCAPS-066hypothetical protein AGABI2DRAFT_74687Chr10TransversionGCXcmI37L–AAGTCCGCAATTGACCTACTAA
R–AGTGTGCAAAATTGAGGAGAGT
AB-gCAPS-068hypothetical protein AGABI2DRAFT_74687Chr10TransversionGCHpyCH4III37L–GACGTCCAAAATCTTGAGTGAT
R–GACGTTGGTCTCAGCTTACTTC
AB-gCAPS-070hypothetical protein AGABI1DRAFT_48245, partialChr10TransitionTCMluCI37L–CTTCGGAAATATGTCTTCAAGG
R–GCGAGGTATCAGAGGAATGTAG
AB-gCAPS-071hypothetical protein AGABI1DRAFT_48245, partialChr10TransitionAGHpy188I37L–AACCTCATTCCCAACCTTATCT
R–AATATATTGGTCATTGGAACCG
AB-gCAPS-072hypothetical protein AGABI1DRAFT_48245, partialChr10TransitionGABstNI60L–TTGTAGCTTATGACATGGTTCG
R–GGAATTATTTTGACGGTTTGAA
AB-gCAPS-073Uncharacterized protein Hypma_04748, partialChr10TransitionCTTaqI65L–TATTGATCTCAGCCAACCTTTT
R–TCCTCACTTTTAGGAGGATCAA
AB-gCAPS-078hypothetical protein AGABI2DRAFT_195493Chr11TransitionCTHpy166II37L–CTAGGATCATATGCGATTTTGC
R–ATAGAACTCAACGCCGACAG
AB-gCAPS-081hypothetical protein AGABI2DRAFT_68830Chr11TransitionTCBsmI65L–ATTTTTCAGGTCACGTTCTCAC
R–TAGATGGTTAAACGTGTGGGAT
AB-gCAPS-082hypothetical protein AGABI2DRAFT_68830Chr11TransitionAGHinfI37L–GTAAAAACAGTTTCCGAAGCAC
R–TATTTCTCAACAGGAGTGACCC
AB-gCAPS-083hypothetical protein AGABI2DRAFT_196017, partialChr11TransitionCTMnlI37L–GATCTATACTTCGGCGATTGAG
R–ACTATAGAGAGTGCCACCAGGA
AB-gCAPS-084hypothetical protein AGABI2DRAFT_229511Chr11TransitionGABtsI55L–TGGAATTAATAAGGCATTTTGG
R–ATCGACCTCTGATATTCACGAT
AB-gCAPS-086hypothetical protein AGABI2DRAFT_79146Chr11TransversionTAHphI37L–CCCAATTCCTATCATGCTTATC
R–ATACTGACCATCGCCACTATGT
AB-gCAPS-087hypothetical protein AGABI1DRAFT_77545Chr11TransitionTCSfaNI37L–TGCAATCGCTTTGTAAGTATCA
R–ATCCCTATACCCATCGCTAGTT
AB-gCAPS-088hypothetical protein AGABI1DRAFT_77545Chr11TransversionGTBbsI37L–AATCATTCGACCAATGCTAATC
R–ACCATCCTGACCACTCTATTTG
AB-gCAPS-089hypothetical protein AGABI1DRAFT_77545Chr11TransversionCABstBI65L–TCGTACCATAGAACCCTTGACT
R–TTGGCTTCTACAACCCTTACAT
AB-gCAPS-090hypothetical protein AGABI1DRAFT_77545Chr11TransversionCGHpyAV37L–AGAAAGGTGAAGACTCACGGTA
R–GGGTTGTTGTTTTCAGCTTATC
AB-gCAPS-093hypothetical protein AGABI2DRAFT_188752Chr11TransitionTCHpy188I37L–AATCCTAGAATCACTTCAGCCA
R–CACCTCATTCCGAATTATTCAT

Chr., chromosome; Ref., reference nucleotide; Alt, alternative nucleotide; Temp., restriction reaction incubation temperature.

2.3. Data Analysis

Using the Power Marker version 3.25 software package [26], the diversity of each CAPS marker was analyzed on the basis of five statistical parameters including major allele frequency (MAF), number of genotypes (NG), number of alleles (NA), genetic diversity (GD), and heterozygosity (He). Genetic distance was calculated using ‘’Nei’s standard’’ [27] followed by phylogeny reconstruction using rooted unweighted pair group method with arithmetic mean (UPGMA) as implemented in MEGA version 7 [28]. To visualize the relationship between the sample genotypes among the 41 A. bisporus accessions, principle coordinate analysis (PCoA) was conducted using GenALEx 6.5 software [29]. It was chosen to complement the UPGMA cluster analysis. A non-hierarchical analysis of molecular variance (AMOVA) (1000 permutations) based on the degree of genetic divergence among populations was performed using GenALEx 6.5 software [29]. Population structure was analyzed based on Bayesian clustering using STRUCTURE 2.3.1 [30]. The populations number (K) was set from 1 to 10, and the populations set as location priors (LOCPRIOR) [31] under the admixture model were used to run the Markov chain Monte Carlo (MCMC) simulation algorithm. The length of the burn-in period was set to 10,000 iterations. The Delta K value was obtained by the method of Evanno [30]. The 10 runs for the optimal delta K were averaged by using the programs STRUCTURE HARVESTER [32]. Next, a hierarchical AMOVA, which was calculated considering the main groups obtained from the STRUCTURE analysis, was implemented by the software GenALEx 6.5 [29]. The statistical significance was also tested using a nonparametric approach described in Excoffier et al. (1992) with 1000 permutations [33]. The minimum number of marker sets (n) needed to distinguish each accession was determined using the accumulation curve approach of the “poppr package” in R [34]. For minimum marker set combinations, initial markers were selected with high GD, NA, and NG values. From the second to the last marker, markers were sequentially selected based on their ability to subdivide the highest number of accessions according to the genotyping data. Grouping based on genotyping data was performed in Microsoft Excel. After selection of minimum marker set combinations, phylogenetic analysis was used to confirm whether the accession could be fully distinguished using the minimum marker (Figure 1).
Figure 1

Pipeline used for minimum marker set selection.

3. Results

3.1. Genotyping and Marker Diversity

Seventy CAPS markers were developed and used to assess 41 A. bisporus accessions. Ts polymorphisms were more common than Tv polymorphisms. The most common Ts difference was G→A, which occurred 14 times, followed by 11 C→T, 10 A→G, and 9 T→C. The most common Tv differences were C→A and C→G (four instances), followed by three A→C, A→T, G→C, G→T, T→A, and T→G changes (Table 2). The diversity index of each marker is show in Table 3. Of the 70 CAPS markers, 64 were polymorphic and 6 were monomorphic (MAF = 1). Excluding the six monomorphic markers, MAF ranged from 0.5 (AB-gCAPS-036) to 0.984 (AB-gCAPS-093), with an average of 0.698. Two NAs and two (n = 28) and three (n = 36) NGs were identified with the polymorphic markers. Similarly, excluding the six markers with one allele, He ranged from 0 (12 accessions) to 0.826 (AB-gCAPS-003), with an average of 0.290. GD ranged from 0.031 (AB-gCAPS-093) to 0.05 (AB-gCAPS-036), with an average of 0.394.
Table 3

Genetic diversity index of 41 Agaricus bisporus accessions assessed with 70 CAPS markers.

MarkerMAF 1NG 2NA 3GD 4He 5
AB-gCAPS-0010.564320.4920.256
AB-gCAPS-0020.609320.4760.696
AB-gCAPS-0030.587220.4850.826
AB-gCAPS-0041.000110.0000.000
AB-gCAPS-0050.750320.3750.250
AB-gCAPS-0061.000110.0000.000
AB-gCAPS-0071.000110.0000.000
AB-gCAPS-0080.694220.4250.613
AB-gCAPS-0090.975220.0490.000
AB-gCAPS-0120.700220.4200.000
AB-gCAPS-0130.724320.4000.079
AB-gCAPS-0150.720320.4040.463
AB-gCAPS-0160.744220.3810.513
AB-gCAPS-0170.738220.3870.525
AB-gCAPS-0180.750220.3750.500
AB-gCAPS-0190.732320.3930.341
AB-gCAPS-0200.659320.4500.390
AB-gCAPS-0210.756220.3690.488
AB-gCAPS-0220.793320.3290.317
AB-gCAPS-0240.683220.4330.634
AB-gCAPS-0250.765220.3600.000
AB-gCAPS-0260.770220.3540.459
AB-gCAPS-0280.650220.4550.700
AB-gCAPS-0300.610220.4760.000
AB-gCAPS-0310.951220.0930.098
AB-gCAPS-0321.000110.0000.000
AB-gCAPS-0330.586320.4850.371
AB-gCAPS-0340.561320.4930.146
AB-gCAPS-0350.598320.4810.756
AB-gCAPS-0360.500320.5000.294
AB-gCAPS-0371.000110.0000.000
AB-gCAPS-0380.817220.2990.366
AB-gCAPS-0390.549320.4950.512
AB-gCAPS-0410.537320.4970.585
AB-gCAPS-0420.625320.4690.500
AB-gCAPS-0430.662320.4480.618
AB-gCAPS-0450.793320.3290.366
AB-gCAPS-0470.855220.2480.289
AB-gCAPS-0480.694320.4250.226
AB-gCAPS-0500.750320.3750.289
AB-gCAPS-0510.634320.4640.244
AB-gCAPS-0520.615320.4730.205
AB-gCAPS-0530.577320.4880.692
AB-gCAPS-0540.973220.0530.000
AB-gCAPS-0550.625220.4690.750
AB-gCAPS-0560.771320.3530.057
AB-gCAPS-0580.577320.4880.128
AB-gCAPS-0590.524320.4990.610
AB-gCAPS-0610.608320.4770.135
AB-gCAPS-0620.671320.4420.171
AB-gCAPS-0630.768220.3560.463
AB-gCAPS-0640.775220.3490.450
AB-gCAPS-0650.713320.4100.125
AB-gCAPS-0660.632220.4650.000
AB-gCAPS-0680.775320.3490.350
AB-gCAPS-0700.585220.4850.000
AB-gCAPS-0710.615220.4730.000
AB-gCAPS-0720.600220.4800.000
AB-gCAPS-0730.848220.2570.000
AB-gCAPS-0780.634320.4640.098
AB-gCAPS-0810.613320.4750.025
AB-gCAPS-0820.667220.4440.000
AB-gCAPS-0830.526320.4990.231
AB-gCAPS-0841.000110.0000.000
AB-gCAPS-0860.675220.4390.000
AB-gCAPS-0870.671320.4420.073
AB-gCAPS-0880.878320.2140.049
AB-gCAPS-0890.850320.2550.100
AB-gCAPS-0900.902320.1760.098
AB-gCAPS-0930.984220.0310.031
Mean0.72482.41.90.35990.2650

1 Major allele frequency 2 Number of genotype 3 Number of allele 4 Gene Diversity 5 Heterozygosity.

To assess whether the CAPS markers developed in this study were suitable for evaluating diversity and population structures, diversity was determined using the SSR diversity index, a widely used metric in population genetic studies [9,10,11,35]. GD, a representative diversity index, is influenced by the allele frequency. However, as SSR and SNP markers have multiple and single target locus characteristics, respectively, allele frequencies tend to differ and theoretically calculated GD index values also differ. As it is difficult to compare diversity between SNP and SSR markers using the GD index, an appropriate alternative comparison based on scaling to the maximum GD index value of each marker was used, with the following equation: . When the SNP marker had a maximum of three alleles, the maximum GD value was 0.66, and the SSR marker reached a maximum GD value of 0.99 as the number of alleles increased. The average GD value of the CAPS markers in this study was 0.3599, and the minimum and maximum GD values of polymorphic markers were 0.031 and 0.5, respectively. When compared with SSR values, the average corrected SSR value, based on the maximum, was 0.540, and the minimum and maximum GD values were 0.046 and 0.750, respectively. Polymorphism frequencies were lower than average GD values of 0.548, 0.619, and 0.6807 from previously developed SSR markers. However, polymorphism levels were higher than the average GD value of 0.395 from monospores of limited accessions [9,10,11,35].

3.2. Grouping Based on Data Analysis and AMOVA

Multivariate and population structure analyses were performed to understand accession and population characteristics. Multivariate analysis included phylogenetic cluster analysis and principal coordinates analysis (PCoA), and population structure analysis was performed using a model-based structure. Phylogenetic tree analysis produced three groups: Group 1 (CHN 2, DEU 1, JPN 1, KOR 7, NLD 3, and USA 2), Group 2 (DEU 2, JPN 1, KOR 3, NLD 2, and USA 3), and Group 3 (CHN 3, DEU 2, JPN 4, KOR 3, NLD 1, and USA 1) (Figure 2). PCoA analysis also revealed three groups: P1 (CHN 2, DEU 1, JPN 1, KOR 7, NLD 3, and USA 2), P2 (DEU 2, JPN 1, KOR 3, NLD 1, and USA 2), and P3 (CHN 3, DEU 2, JPN 4, KOR 3, NLD 1, and USA 1) (Figure 3).
Figure 2

Phylogenetic tree constructed using the unweighted pair pop method with arithmetic mean based on Nei’s genetic distance.

Figure 3

Principal coordinates analysis to identify the characteristics and members of each cluster. Accessions were divided into three main groups, with two central accessions not classified.

Model-based structure analysis produced two groups: POP 1 (CHN 2, DEU 1, JPN 1, KOR 7, NLD 3, and USA 2) and POP 2 (CHN 3, DEU 2, JPN 4, KOR 3, NLD 1, and USA 1), and the remaining accessions were classified as an Admix group. Population structure was revealed by classification of accessions into each group using an unrooted tree (Figure 4). Groupings were largely consistent across the three methods: Group 1, P3, and POP 1; and Group 3, P1, and POP 2 had the same accessions. Finally, Group 2 and Admix had the same accessions, with P2 having all except two of the same accessions.
Figure 4

Group structure analysis of Agaricus bisporus accessions. The most appropriate number of groups was determined by repeating five iterations using Structure Burn-in and Markov Chain Monte Carlo (MCMC) with 100,000 iterations. (A) Delta K values were calculated using Structure Harvester. (B) Probability of each accession belonging to a group. (C) Unrooted tree confirmation of population structure.

To determine the degree of genetic variation and differentiation among groups, AMOVA was performed with two group types as follows: distance-based groups (Groups 1, 2, and 3) and model-based groups (POP 1, POP 2, and Admix). The variation in the population level of the two groups was 13% in the distance-based groups and 15% in the model-based groups, and the variation on an individual level was 31% and 30% among individuals in distance-based and model groups, respectively, and 55% within individuals in both groups. The F-statistic (FST) value was 0.134 in the distance-based group and 0.153 in the model-based group (Table 4).
Table 4

AMOVA analysis of distance- and model-based clustering.

Distance-Based Group
SourcedfSSMSEst. Var.Percentage F ST
Among Pops2147.84473.9222.06213%0.134
Among Indiv38691.05818.1864.84931%
Within Indiv41348.0008.4888.48855%
Total811186.902 15.399100%
Model-Based Population
Source df SS MS Est. Var. Percentage FST
Among Pops2163.97181.9852.37715%0.153
Among Indiv38674.93217.7614.63730%
Within Indiv41348.0008.4888.48855%
Total811186.902 15.501100%

3.3. Selection of Minimum Markers for Discrimination

A minimal marker set for accession discrimination was developed using an accumulation curve (Figure 5A) according to the pipeline shown in Figure 1. AB-gCAPS-059 was selected as the first marker. From the second marker onwards, the phylogenetic tree was used to select markers that provided discrimination of the largest numbers of accessions. The 10 markers that were selected (AB-gCAPS-017, AB-gCAPS-022, AB-gCAPS-026, AB-gCAPS-033, AB-gCAPS-038, AB-gCAPS-039, AB-gCAPS-042, AB-gCAPS-059, AB-gCAPS-061, and AB-gCAPS-066) were able to distinguish among the 41 A. bisporus accessions, as confirmed using a phylogenetic tree (Figure 5B).
Figure 5

(A) The number of markers sufficient to serve as a minimum marker was determined using an accumulation curve calculated using the poppr package in R. (B) Phylogenetic tree illustrating discrimination of 41 Agaricus bisporus accessions using 10 selected markers.

4. Discussion

4.1. Polymorphism Did Not Differ According to SNP Mutation Type

SNPs occur throughout the genome, with differing effects depending on the polymorphism type and location. SNPs can affect protein amino acid sequences if they occur within a coding region and introduce a codon change (non-synonymous change). Two types of SNP are found: Ts and Tv. SNP differences within the purines (A, G) or pyrimidine (C, T) nucleotides are Ts SNPs, and those that change from purine to pyrimidine or vice versa are Tv SNPs. [17]. Although there are four possible Ts changes and eight possible Tv changes, Ts SNPs occur at higher frequency than Tv SNPs [36]. Research suggests this is due to the higher number of possibly damaging non-synonymous changes resulting from Tv mutations compared with Ts mutations. Thus, Tv changes have a greater physicochemical impact on amino acid sequences and are not favored during natural selection [37]. The tv is considered to be a more drastic change than a ts, because substitution of one-ring to two-ring chemical structure or vice versa (Tv) requires more energy than substitution without change in the ring structure (Ts) [38]. The Ts/Tv ratio has been used as an important parameter in bacteria studies such as phylogenetic tree reconstruction and estimation of divergence [39]. Numbers of Ts and Tv polymorphisms were compared in the A. bisporus CAPS markers developed in this study. Of the 70 markers, 44 markers were Ts SNPs, and 26 markers were SNPs, a ratio of 1.7:1 for Ts:Tv. Average GD values were 0.363 (Ts) and 0.354 (Tv), showing no substantial differences. Thus, it can be inferred that the SNP type (Ts or Tv) in the A. bisporus marker set was not biased.

4.2. Diversity of Developed SNP Markers

Assessments based on molecular markers can be divided into population genetic assessments and trait assessments. SSR markers, with relatively more alleles, show a high level of diversity and are frequently used for population genetics, whereas SNP markers are frequently used to identify specific traits or determine lineage and population [40,41]. SSR and SNP markers exhibit different polymorphism traits, such as the number of repeats in the sequence, mutations of a single nucleotide, and genome-wide mutations; and the ability to obtain different types of information in the same study may facilitate the combined use of the two marker types [41,42]. SSRs were found to be better suited for detecting structure in populations at a small spatial scale with a systematic and continuous sampling design. SNP markers rather reflect ancient divergence of distant and naturally separated populations, being less sensitive to sampling design [43]. Despite these differences, both marker types were suitable for detecting the genetic structure of the fungal populations considered. Previous studies of mushroom diversity and population structures using SSR and SNP markers focused on differences in the diversity index for the same marker [9,10,11,12,13,14,44]. However, direct comparison of diversity was difficult because of differences in the target loci of the two marker types. To solve these problems, the diversity index of the two markers was calculated and compared using an equation based on the maximum diversity index of each marker. This comparison method can be applied to a range of markers to facilitate comparative analysis of mushroom diversity and population structure.

4.3. Population Structure Analysis Using SNP Markers

In previous studies, SNP markers showed a similar grouping pattern and more accurate lineage classification of the neighbor joining tree in population structure analysis compared to SSR markers [41,42]. In particular, the explanatory value for the first main coordinate in PCoA analysis was higher for SNP markers, and this was a common phenomenon regardless of accession [41,42]. No common characteristics were observed in the clustered accessions of all groups with the three clustering methods used in this study, and collection location did not correlate with accessions in the clusters. This may be because the SNP markers classified lineage, and the current commercial accessions were divided into relatively few lineages. In addition, accessions in geographically separated regions had similar sequences, consistent with the genetically similar nature of accessions cultivated worldwide [4]. Population structure analysis is used to identify characteristics by composing clusters according to accession similarities. This led us to speculate that similarities among sequences would have a strong impact on accession clustering, and we therefore used AMOVA to confirm the extent to which genetic variation between populations and accessions were affected by one another. AMOVA of a model-based population revealed slight difference between groups and accessions by collection area (13% and 86%, respectively) and genotype (15% and 85%, respectively). Population variation according to genotype and collection area did not differ substantially, consistent with most commercially cultivated button mushrooms being derived from similar strains.

4.4. Selection of Minimum Markers for Accession Identification

Development of a minimum set of molecular markers to distinguish accessions provides the basis for future evaluation of existing new A. bisporus resources. An accumulation curve, in which SNP loci from the 70 CAPS markers were randomly identified and calculated [34], was used to determine the minimum number of loci required to distinguish between accessions. This approach can be extended to determine minimum marker numbers for future applications. In this study, 10 SNP markers were sufficient to distinguish 41 A. bisporus accessions. Previous research also developed minimum marker sets for accession differentiation: SSR markers were used to distinguish all accessions by using 4 of 26 accessions [10] and 6 of 171 accessions [11]. Discrimination using SNP markers tends to require more markers, and distinguish fewer accessions, than SSR markers. SNP markers may therefore be less efficient when examining large numbers of accessions; however, linkages determined using SNP markers may be more stable than linkages established using SSR markers. Currently, studies using SNP markers in button mushrooms focus on the evaluation of accessions by direct comparison of SNPs by sequencing or through QTL mapping related to characteristics such as mushroom color and robustness [13,14,15,16]. Advances in genomic analysis have facilitated the efficient use of SSR and SNP markers for population genetic studies of accession collections. However, studies of genetic diversity and population structure using CAPS markers in mushrooms are limited. The SNP markers developed in this study will facilitate the comparison and evaluation of existing A. bisporus accessions and will provide the basis of future analysis and management of new accessions.

5. Conclusions

Consumer demand for new button mushroom varieties has increased alongside the recent growth of the mushroom industry. Optimal selection of breeding materials through the evaluation and management of accession collections is important for the development of new varieties. Several molecular markers have been used to evaluate crops with restrictive genotypes, such as button mushrooms. Of these, SNP markers are widely used for association mapping, accession discrimination, and analysis of genetic diversity and population structure. However, only limited numbers of molecular markers are available to support A. bisporus breeding strategies. In this study, a set of 70 CAPS markers was developed to analyze the diversity and population structure of 41 A. bisporus accessions. Of the 70 markers, a set of 10 minimum markers was identified that was able to identify all 41 A. bisporus accessions. The developed CAPS markers will be useful for analysis of button mushroom diversity and population structures, and will also be useful for variety identification.
  34 in total

1.  Determinants of spontaneous mutation in the bacterium Escherichia coli as revealed by whole-genome sequencing.

Authors:  Patricia L Foster; Heewook Lee; Ellen Popodi; Jesse P Townes; Haixu Tang
Journal:  Proc Natl Acad Sci U S A       Date:  2015-10-12       Impact factor: 11.205

2.  Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study.

Authors:  G Evanno; S Regnaut; J Goudet
Journal:  Mol Ecol       Date:  2005-07       Impact factor: 6.185

Review 3.  Genotypic selection methods for the direct analysis of point mutations.

Authors:  B L Parsons; R H Heflich
Journal:  Mutat Res       Date:  1997-10       Impact factor: 2.433

4.  Relationships between gene trees and species trees.

Authors:  P Pamilo; M Nei
Journal:  Mol Biol Evol       Date:  1988-09       Impact factor: 16.240

5.  Poppr: an R package for genetic analysis of populations with clonal, partially clonal, and/or sexual reproduction.

Authors:  Zhian N Kamvar; Javier F Tabima; Niklaus J Grünwald
Journal:  PeerJ       Date:  2014-03-04       Impact factor: 2.984

6.  Development of Polymorphic Simple Sequence Repeat Markers using High-Throughput Sequencing in Button Mushroom (Agaricus bisporus).

Authors:  Hwa-Yong Lee; Sebastin Raveendar; Hyejin An; Youn-Lee Oh; Kab-Yeul Jang; Won-Sik Kong; Hojin Ryu; Yoon-Sup So; Jong-Wook Chung
Journal:  Mycobiology       Date:  2018-11-28       Impact factor: 1.858

7.  Molecular Characterization of 170 New gDNA-SSR Markers for Genetic Diversity in Button Mushroom (Agaricus bisporus).

Authors:  Hyejin An; Ick-Hyun Jo; Youn-Lee Oh; Kab-Yeul Jang; Won-Sik Kong; Jwa-Kyung Sung; Yoon-Sup So; Jong-Wook Chung
Journal:  Mycobiology       Date:  2019-09-27       Impact factor: 1.858

8.  Evaluating Genetic Diversity of Agaricus bisporus Accessions through Phylogenetic Analysis Using Single-Nucleotide Polymorphism (SNP) Markers.

Authors:  Youn-Lee Oh; In-Geol Choi; Won-Sik Kong; Kab-Yeul Jang; Min Ji Oh; Ji-Hoon Im
Journal:  Mycobiology       Date:  2020-12-17       Impact factor: 1.858

9.  Multi-trait QTL analysis for agronomic and quality characters of Agaricus bisporus (button mushrooms).

Authors:  Wei Gao; Johan J P Baars; Chris Maliepaard; Richard G F Visser; Jinxia Zhang; Anton S M Sonnenberg
Journal:  AMB Express       Date:  2016-09-08       Impact factor: 3.298

10.  Identification of Resistance to Wet Bubble Disease and Genetic Diversity in Wild and Cultivated Strains of Agaricus bisporus.

Authors:  Yongping Fu; Xinxin Wang; Dan Li; Yuan Liu; Bing Song; Chunlan Zhang; Qi Wang; Meiyuan Chen; Zhiwu Zhang; Yu Li
Journal:  Int J Mol Sci       Date:  2016-09-22       Impact factor: 5.923

View more
  1 in total

1.  Comprehensive Genetic Analysis of Monokaryon and Dikaryon Populations Provides Insight Into Cross-Breeding of Flammulina filiformis.

Authors:  Hui Li; Lei Shi; Weiqi Tang; Weiwei Xia; Yingli Zhong; Xinyu Xu; Baogui Xie; Yongxin Tao
Journal:  Front Microbiol       Date:  2022-07-05       Impact factor: 6.064

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.