Literature DB >> 34062444

Dietary 25-hydroxyvitamin D improves intestinal health and microbiota of laying hens under high stocking density.

Jianping Wang1, Chunhua Zhang2, Tao Zhang1, Lei Yan3, Lingyun Qiu1, Huadong Yin1, Xuemei Ding1, Shiping Bai1, Qiufeng Zeng1, Xiangbing Mao1, Keying Zhang1, Caimei Wu1, Yue Xuan1, Zhiguo Shan4.   

Abstract

The high stocking density is a major stress factor that adverpan class="Chemical">sely affects the health and performance of poultry. Therefore, the object of this study was conducted to explore whether dietary 25-hydroxyvitamin D (25-OH-D3) could improve gut health of laying hens reared under high stocking density. A 2 × 2 factorial design was used in this 16-week study, in which 800 45-week-old Lohmann laying hens were allocated into two levels of dietary 25-OH-D3 levels (0 and 69 µg/kg) and two rates of stocking densities [506 (low density, LD) and 338 (high density, HD) cm2/hen]. Compared with the layers with LD, the layers with HD had lower crypt depth in duodenum (P(Density) < 0.05), lower short chain fatty acid (propionic and butyric acid) contents in cecum (P(Density) < 0.05), and lower mRNA expression of intestinal barrier associated protein (claudin-1, mucin-1 and mucin-2). Exposed layer to HD also led to lower intestinal antioxidative capacity [superoxide dismutase (SOD), catalase (CAT), total antioxidant capacity (T-AOC), and higher malondialdehyde (MDA) content] in small intestine (P(Density) < 0.05), lower bacterial abundance of Bacteroidetes (phylum), Spirochaetes (phylum) and Bacteroides (genus; P(Density) < 0.05), higher bacterial enrichment of Lactobacillaceae (genus) and Firmicutes/Bacteroidetes ratio (P(Density) < 0.05) in cecum. Dietary 25-OH-D3 increased the villus height in duodenum and jejunum (P(25-OH-D3) < 0.05), decreased Chao 1 and ACE indexes in cecum (P(25-OH-D3) < 0.05), and it also up-regulated the mRNA expression of claudin-1, mucin-1 and mucin-2 (P(25-OH-D3) < 0.05). Layers treated with 25-OH-D3 led to an enhanced antioxidative enzyme activity of CAT (P(25-OH-D3) < 0.05). Additionally, the effect of 25-OH-D3 reversed the effect of HD on T-AOC and MDA content (P(Interaction) < 0.05). In HD layers, 25-OH-D3 administration decreased the enrichment of Bacteroidetes (phylum), increased Firmicutes (phylum), and Firmicutes/Bacteroidetes ratio (P(Interaction) < 0.05). These results suggest that supplementing 25-OH-D3 in diets may elevate gut health through the improvement of intestinal barrier function, antioxidant capacity and cecal microbiota composition in laying hens with high stocking density.
Copyright © 2021 The Authors. Published by Elsevier Inc. All rights reserved.

Entities:  

Keywords:  25-hydroxycholecalciferol; antioxidative capacity; intestinal barrier; microbiota; stocking density

Mesh:

Substances:

Year:  2021        PMID: 34062444      PMCID: PMC8173302          DOI: 10.1016/j.psj.2021.101132

Source DB:  PubMed          Journal:  Poult Sci        ISSN: 0032-5791            Impact factor:   3.352


INTRODUCTION

At present, the cage housing system (or conventional cage system) were the most commonly used rearing system for layers in China due to its better economic benefits. Stocking density refereed to the space provided for an individual hen in conventional cage system, which has been closely related to the welfare and stress of layers (Mench et al., 2011). Inadequate rearing density or high stocking density (HD) has been recognized as a source of chronic stress, which were shown to cause adverse effect on growth performance, egg production, egg weight, feed intake, feather pecking (Jalal et al., 2006; Saki et al., 2012; Kang et al., 2016; Li et al., 2019; Weimer et al., 2019; Wang et al., 2020). In addition, high stocking density is associated with chronic oxidative stress (Wu et al., 2018) and decreased the intestinal morphology and microbiota diversity in broilers and ducks (Sohail et al., 2010; Guardia et al., 2011; Wu et al., 2018). Vitamin D is generally involved in the calcium and phosphorus and maintains optimal Ca and P homeostasis for bone health and development (Lamberg-Allardt, 2006). Vitamin D is also found to maintain the intestine health by regulating the intestinal barrier integrity, controlling mucosal inflammation and microbiota homeostasis (Jin et al., 2015; Li et al., 2015; Cantorna et al., 2019; Zhang et al., 2020a,b; Fakhoury et al., 2020). The 25-hydroxyvitamin D (25-OH-D) is an active metabolite of vitamin D3, which were shown to have better bioactivity than vitamin D. In our previous study, we found that dietary administration of 69 µg/kg 25-OH-D3 improved the egg quality and tibia quality of layers under high stocking density (Wang et al., 2020); however, whether 25-OH-D3 can alleviate the adverse effects of high stocking density on intestinal health is not clear. Therefore, the aim of the present study was to investigate the effects of 25-OH-D3 on intestinal health and microbiota of laying hens with high stocking density.

MATERIALS AND METHODS

Birds, Diets, Management, and Sampling

The experimental protocol used in the study was aical">pproved by the Animal Care and Use Committee of the Sichuan Agricultural University (Chengdu, Sichuan, China). At 45 weeks of age, 800 Lohman pink-shell laying hens were randomly divided into 4 treatments with 10 replicates per treatment. Two 25-OH-D3 levels (0 and 69 µg/kg; the vitamin D was supplemented at 5000 IU in basal diet) and two stocking densities [506 (low density, LD) and 338 (high density, HD) cm2/hen] were designed by 2 × 2 factor experiment. The total experimental period was 16 weeks. Laying hens were fed a complete feeding mixture in a mash form (Table 1), and the 69 µg/kg 25-OH-D3 were premixed with 1 kg corn to make a premix prior to addition. Layers (LD: 4 hens per cage; HD: 6 layers per cage) in each replicate were raised in 8 adjacent cages (45 cm width × 50 cm length × 45 cm height). Room environment was controlled at 22°C by a daily lighting schedule of 16 h light and 8 h dark. Birds were allowed ad libitum access to water and feed.
Table 1

Composition and nutrient level of basal diet (as-fed basis).

Item, %Amount
Corn59.06
Wheat bran3.87
Soybean oil1.50
Soybean meal (CP, 43%)15.24
Corn gluten (CP, 60%)5.00
Corn DDGS5.00
Calcium carbonate (granular)6.10
Calcium carbonate (powder)2.50
Calcium hydrophosphate (powder)0.94
NaCl0.25
NaHCO30.10
L-Lysine HCl0.16
DL-Methionine0.01
Choline chloride, 60%0.10
Vitamin premix10.02
Mineral premix20.15
Total100.00
Calculated nutrient content, %
ME3, kcal/kg2690
Analyzed nutrient levels, %
Crude protein15.82
Calcium3.65
Total phosphate0.64
Lysine0.65
Methionine0.33

Provided per kilogram of diets: VA 9950 IU, VB1 37.7 mg, VB2 12 mg, D-pantothenate 18.2 mg, VB6 7.55 mg, VB12 0.5 mg, VD3 5000 IU, VE 70 IU, VK3 4.47 mg, Biotin 4 mg, VC 195 mg, niacin acid 70.35 mg.

Provided per kilogram of diets: Cu (as copper sulfate) 9.6 mg, Fe (as ferrous sulfate) 64 mg, Mn (as manganese sulfate) 121.5 mg, Zn (as zinc sulfate) 57 mg, I (as potassium iodide) 0.60 mg, Se (as sodium selenite) 0.36 mg.

Calculated according to NRC (1994).

Composition and nutrient level of basal diet (as-fed basis). Provided per kilogram of diets: VA 9950 IU, VB1 37.7 mg, VB2 12 mg, D-pantothenate 18.2 mg, VB6 7.55 mg, VB12 0.5 mg, VD3 5000 IU, VE 70 IU, VK3 4.47 mg, Biotin 4 mg, VC 195 mg, niacin acid 70.35 mg. Provided per kilogram of diets: Cu (as copper sulfate) 9.6 mg, Fe (as ferrous sulfate) 64 mg, Mn (as manganese sulfate) 121.5 mg, Zn (as zinc sulfate) 57 mg, I (as potassium iodide) 0.60 mg, Se (as sodium selenite) 0.36 mg. Calculated according to NRC (1994). At the end of 16 wk, 40 layers (10 replicates/treatment) were sacrificed by pan class="Chemical">CO2 suffocation, the intestine tissues (duodenum, jejunal) and cecum chyme were taken and then stored at -80°C till gene expression analysis.

Morphology of Intestinal Mucosa

Duodenum and jejunal mucosa (1 layer/replicate, 10 replipan class="Gene">cates/treatment) morphology were analyzed as described previously (Gong et al., 2021). Briefly, the intestinal segments were fixed in 4% paraformaldehyde, then embedded in paraffin, and stained with hematoxylin-eosin. Villus height and crypt depth were measured in 40 × magnification with a digital camera microscope (BA400Digital, McAudi Industrial, Group Co., Ltd). A total of 10 intact villi and crypts were randomly selected in each sample. Then, the data included villus height, crypt depth and their ratio (V/C) was calculated.

Antioxidant Enzyme Activity of Jejunum

Superoxide dismutase (SOD) activity, total antioxidant capacity (T-AOC), catalase (CAT) and malondialdehyde (MDA) level in jejunum (1 layer/replicate, 10 replicates/treatment) were analyzed by using commercial kits obtained from Nanjing Jiancheng Bioengineering Institute (Nanjing, China) according to the manufacturer's instructions.

Intestinal Barrier Related Genes

Total RNA of jejunal mucosa (1 layer/replicate, 10 replipan class="Gene">cates/treatment) was extracted with TRIzol reagent (TaKaRa Biotechnology (Dalian Co., Ltd, Dalian, China) on basis of the manufacturer's instructions. The cDNA of samples was synthesized by using PrimeScript RT reagent kit and gDNA Eraser (TaKaRa Biotechnology (Dalian) Co., Ltd, Dalian, China). The primers of genes, listed in Table 2, were purchased from TaKaRa Biotechnology (Dalian) Co., Ltd (Dalian, China). The real-time quantitative PCR with SYBR Premix Ex Taq reagents (TaKaRa Biotechnology, Ltd, Dalian, China) and a CFX-96 Real-Time PCR detection System (Bio-Rad Laboratories, Richmond, CA) were performed. The house keeping gene (β-actin) was chosen in order to correct for variance in the amount of RNA input in the reaction. The relative mRNA expression of occluding, claudin-1, (zonula occluden-1), (zonula occluden-1), mucin-1 and mucin-2 compared to the house keeping gene was obtained with previous methods (Wang et al., 2021). The specific primer sequences are shown in Table 2.
Table 2

Primer sequences used to measure gene expression.

GenesOrientationPrimer Sequences (5′-3′)Product size (bp)Accession number
β-actinForwardGCTACAGCTTCACCACCACA90NM_205518.1
ReverseTCTCCTGCTCGAAATCCAGT
OccludinForwardGCTGAGATGGACAGCATCAA97NM_205128.1
ReverseCCTCTGCCACATCCTGGTAT
ZO-1ForwardGAGCGCAAGTTTGAAAGTCC135XM_015278981.2
ReverseAGGAGGCTGTGATGAGCTGT
ZO-2ForwardGAAAGCTCCAGCTGGTTGTC124NM_204918.1
ReverseGGGGAGAACGATCTGTTTGA
Mucin-1ForwardGCCATCGTAGTTGTGTGTGG126XM_015279045.2
ReverseTGCTTCAGGGTCTCTCCTGT
Mucin-2ForwardTGCCAGCCTTTTTATGCTCT80NM_001318434.1
ReverseAGTGGCCATGGTTTCTTGTC
Claudin-1ForwardGTCTTTGGTGGCGTGATCTT117NM_001013611.2
ReverseTCTGGTGTTAACGGGTGTGA

Abbreviations: ZO-1, zonula occluden-1; ZO-2, zonula occluden-2.

Primer sequences used to measure gene expression. Abbreviations: ZO-1, zonula occluden-1; ZO-2, zonula occluden-2.

pH Value and Short Chain Fatty Acid Concentration of Cecal Digesta

1 g of cecal chyme (1 layer/replicate, 10 reical">plipan class="Gene">cates/treatment) were taken to measure pH value with pH analyzer (pH-start, Germany). The short-chain fatty acids (SCFA; including acetic, propionic and butyric acid) were then analyzed by gas chromatographic system (Varian CP-3800, USA) as described by Yuan et al., (2016).

Microbiota Analysis in Cecal Digesta

Bacterial DNA was extracted from cecal digesta (6 replicates/treatment) using the QIAamical">p DNA Stool Mini Kit (QIAGEN, CA, Hamburg, Germany) according to the manufacturer's instructions. Total DNA was eluted in 50 μL of elution buffer, confirmed by 1.2% agarose gel electrophoresis, and stored at -80°C until analysis in the PCR by LC-Bio Technology (Hangzhou, China). Before sequencing, the above 16S rDNA V3-V4 region of each sample was amplified with a set of primers targeting 16S rRNA gene region. Sequencing libraries were generated with NEB Next Ultra DNA Library Prep Kit for Illumina (NEB, USA) following manufacturer's recommendations, and index codes were added. The library quality was assessed, qualified and then sequenced using HiSeq2500 PE250. Sequencing and bioinformatics analysis were performed by Novogene Bioinformatics Technology Co. (Tianjin, China).

Statistical Analysis

Data were analyzed as a 2 × 2 factorial arrangement of treatments by 2-way ANOVA analysis of variance using GLM procedure of SAS 9.2 software (SAS Institute Inc., Cary, NC). The model included the main effects of stocking density and 25-OH-D3, as well as their interaction. Tukey's range test was used to determine significant differences among means. The significance was determined by P ≤ 0.05.

RESULTS

Intestinal Morphology

As shown in Table 3, there was no significant different in duodenum and jejunal mucosa morphology (villus height, crypt depth and V/C) between LD and HD layers (P > 0.05), except the HD decreased the crypt depth in duodenum mucosa (P(Density) < 0.05). And dietary 25-OH-D3 supplementation increased the villus height of duodenum and jejunum (P(25-OH-D3) < 0.05).
Table 3

Effect of stocking density and dietary 25-OH-D3 supplementation on intestinal morphology of laying hens.

ItemDuodenum
Jejunum
Villus height, μmCrypt depth, μmV/CVillus height, μmCrypt depth, μmV/C
Density25-OH-D3
Low-1205.31224.45ab5.501033.11b191.94b5.49
Low+1345.47233.23a6.321120.79a219.43a5.22
High-1202.31196.08b6.171015.44b180.93b5.91
High+1290.57202.23b6.591141.14a201.34a5.65
SEM63.8314.300.5132.248.450.41
P-Value0.24<0.010.470.010.030.69
Main effect (P-Value)
 Density0.52<0.010.190.710.140.16
 25-OH-D30.040.460.09<0.010.340.37
 Density*25-OH-D30.570.900.580.720.710.98

Means with different superscripts within a column differ significantly (P ≤ 0.05).

1Each mean represents 10 replicates per treatment, with 1 layer per replicate.

Abbreviations: 25-OH-D3, 25-hydroxyvitamin D; V/C, ratio of villus height to crypt depth.

Effect of stocking density and dietary 25-OH-D3 supplementation on intestinal morphology of laying hens. Means with different superscripts within a column differ significantly (P ≤ 0.05). 1Each mean represents 10 replicates per treatment, with 1 layer per replicate. Abbreviations: 25-OH-D3, 25-hydroxyvitamin D; V/C, ratio of villus height to crypt depth.

Antioxidative Capacity of Jejunum

Lower antioxidant enzymes activity, including SOD, CAT, pan class="Chemical">T-AOC, and higher MDA content in small intestine were found in layers exposed to HD treatment (Figure 1; P(Density) < 0.05). Layers treated with 25-OH-D3 led to an enhanced antioxidative enzyme activity of CAT (P(25-OH-D3) < 0.05), and also the effect of 25-OH-D3 reversed the effect of HD on T-AOC and MDA content (P(Interaction) < 0.05).
Figure 1

Effect of stocking density and dietary 25-OH-D3 supplementation on antioxidant enzyme activity in jejunum of layers. Data are means ±SEM represented by vertical bars or plot individual values. The activities of antioxidant enzymes, including (A) SOD, (B) CAT, (C) T-AOC, (D) SOD activity, and lipid peroxidation products (D) MDA levels. The difference N = 10. Statistical significance was evaluated by Tukey's range test, P ≤ 0.05. Abbreviations: SOD, total superoxide dismutase; CAT, catalase; T-AOC, total antioxidant capacity; MDA, malondialdehyde.

Effect of stocking density and dietary 25-OH-D3 supplementation on antioxidant enzyme activity in jejunum of layers. Data are means ±SEM represented by vertical bars or plot individual values. The activities of antioxidant enzymes, including (A) SOD, (B) CAT, (C) T-AOC, (D) SOD activity, and lipid peroxidation products (D) MDA levels. The difference N = 10. Statistical significance was evaluated by Tukey's range test, P ≤ 0.05. Abbreviations: SOD, total superoxide dismutase; CAT, catalase; T-AOC, total antioxidant capacity; MDA, malondialdehyde.

The mRNA Expression Levels of Gut-Barrier Related Gene in Jejunal Mucosa

Compared with the layers with LD, the layers with HD had lower mRNA expression of intestinal barrier associated protein (claudin-1, mucin-1 and mucin-2) (Figure 2; P(Density) < 0.05), while the addition of 25-OH-D3 up-regulated the mRNA expression of claudin-1, mucin-1 and mucin-2 (P(25-OH-D3) < 0.05).
Figure 2

Effect of stocking density and dietary 25-OH-D3 supplementation on jejunal barrier related gene expression. mRNA expression about tight junction protein (A) Occludin, (B) Claudin-1, (C) ZO-1, (D) ZO-2, and mucous barrier related protein (E) Mucin-1 and (F) Mucin-2. The difference N = 10. Statistical significance was evaluated by Tukey's range test, P ≤ 0.05. Abbreviations: ZO-1, zonula occluden-1; ZO-2, zonula occluden-2.

Effect of stocking density and dietary 25-OH-D3 supplementation on jejunal barrier related gene expression. mRNA expression about tight junction protein (A) Occludin, (B) Claudin-1, (C) ZO-1, (D) ZO-2, and mucous barrier related protein (E) Mucin-1 and (F) Mucin-2. The difference N = 10. Statistical significance was evaluated by Tukey's range test, P ≤ 0.05. Abbreviations: ZO-1, zonula occluden-1; ZO-2, zonula occluden-2.

Short Chain Fatty Acid Concentration and pH Value of Cecum Digesta

The content of propionic acid, butyric acid and total short-chain fatty acid content in cecum were lower in layers reared under HD situation (Table 4; P(Density) < 0.05). No effect of 25-OH-D3 were observed to affect the short-chain fatty acid profiles and pH value of layers irrespective of space density (P > 0.05).
Table 4

Effect of stocking density and dietary 25-OH-D3 supplementation on short chain fatty acid concentration and pH value of cecum (μmol/g).

ItemAcetic acidPropionic acidButyric acidTotalpH
Density25-OH-D3
Low-55.6522.267.4885.396.64
Low+53.6923.448.8585.986.90
High-43.1117.915.7867.806.86
High+50.3120.177.7378.216.80
SEM6.443.361.284.780.14
P-Value0.480.260.440.870.34
Main effect (P-Value)
 Density0.250.030.020.010.53
 25-OH-D30.700.480.210.590.30
 Density*25-OH-D30.500.820.820.670.12

a,bMeans with different superscripts within a column differ significantly (P ≤ 0.05).

1Each mean represents 10 replicates per treatment, with 1 layer per replicate.

Abbreviations: 25-OH-D3, 25-hydroxyvitamin D; V/C, ratio of villus height to crypt depth.

Effect of stocking density and dietary 25-OH-D3 supplementation on short chain fatty acid concentration and pH value of cecum (μmol/g). a,bMeans with different superscripts within a column differ significantly (P ≤ 0.05). 1Each mean represents 10 replicates per treatment, with 1 layer per replicate. Abbreviations: 25-OH-D3, 25-hydroxyvitamin D; V/C, ratio of villus height to crypt depth.

Alpha Diversity of Microbiota in the Cecal Digesta

As shown in Table 5, the community diversity (Shannon) and richness (Chao1 and ACE) indices of the microbiota in the cecal digesta of layers with pan class="Disease">HD were lower than those in the LD group (P(Density) < 0.05). Supplementing 25-OH-D3 in the diets decreased the Chao 1 and ACE index of microbiota in the cecal digesta of layers (P(25-OH-D3) < 0.05).
Table 5

Effect of stocking density and dietary 25-OH-D3 supplementation on alpha diversity in cecum.

ItemShannonSimpsonChao1ACE
Density25-OH-D3
Low-7.120.98740.34a739.81a
Low+6.920.98664.29b656.89b
High-6.930.98715.41ab702.18ab
High+7.040.98707.90ab697.34ab
SEM0.12<0.0127.8022.00
P-value0.420.61<0.010.04
Main effect (P-Value)
 Density0.720.270.640.93
 25-OH-D30.610.530.050.04
 Density*25-OH-D30.090.530.100.04

Means with different superscripts within a column differ significantly (P ≤ 0.05).

1Each mean represents 10 replicates per treatment, with 1 layer per replicate.

Abbreviations: 25-OH-D3, 25-hydroxyvitamin D; V/C, ratio of villus height to crypt depth.

Effect of stocking density and dietary 25-OH-D3 supplementation on alpha diversity in cecum. Means with different superscripts within a column differ significantly (P ≤ 0.05). 1Each mean represents 10 replicates per treatment, with 1 layer per replicate. Abbreviations: 25-OH-D3, 25-hydroxyvitamin D; V/C, ratio of villus height to crypt depth.

Beta Diversity and Composition of Microbiota in the Cecal Digesta

The shared and specific OTUs among 4 groups are shown in Figure 3A and the principal coordinate analysis plot were shown in Figure 3B. The microbiota of cecal sample was clearly differentiated between LD and LDV, as well as between HD and HDV groups, whereas the separation between HD and LDV could be hardly detected. As shown in Table 6, the relative abundance of the cecum at phylum level indicated that Bacteroidetes (LD 48.34%, LDV 60.28%, HD 50.63%, and HDV 40.50%) and Firmicute (LD 41.19%, LDV 32.26%, HD 41.06%, and HDV 51.21%) was the dominant phylum in all dietary treatments. The HD had lower Bacteroidete, Spirochaetes, higher Firmicute abundance, and higher Firmicute/Bacteroidetes ratio (P(Density) < 0.05). Administration of 25-(OH)-D3 were shown to increase the Bacteroidetes and decreased Firmicutes enrichment as well their ratio in the cecum of LD layers, while it decreased the abundance of Bacteroidetes and increased Firmicute enrichment and their ratio in the cecum of HD layers (P(Interaction) < 0.05). As shown in Figure 3D, E and F, HD increased Coprobacter (genus, P < 0.05) and Subdoligranulum (genus, P < 0.05), decreased unidentified_Lachnospiraceae (genus, P < 0.05), Clostridium_sp_Marseille-P3244 (Species) and Parasullterlla_secunda (species, P < 0.05). The HDV had higher Alistipes (genus, P < 0.05), Bacteroidales (genus, P < 0.05) and Butyricicoccus (genus, P < 0.05) enrichment than that in HD layers (P < 0.05). These data showed that while density and 25-(OH)-D3 caused microbial variations but did not change the dominant species at phylum level in the cecum, and also indicate that differences in microflora result from 25-(OH)-D3 were differ between HD and LD situation.
Figure 3

Effect of stocking density and dietary 25-OH-D3 supplementation on cecal microbiota enrichment of layers. (A) The Venn diagram. (B) The principal coordinate analysis (PCA) of the cecum microbiota based on unweighted UniFrac metrc. (C, D) The relative abundance of the top 10 phylum (C) and genus (D). (E) Linear discrimination analysis coupled with effect size (LEfSe) identified most differentially abundant taxa in the cecum with LDA significant threshold > 4 were shown. (F) Analysis of different species between groups at genus level (a) and species level (b). The difference N = 6. Statistical significance was evaluated by Students T-test, P ≤ 0.05.

Table 6

The relative abundance of the top 5 dominant microbiota ratio at phylum level in cecum.

ItemBacteroidetesFirmicutesProteobacteriaActinomyceteSpirochaetesFirmicutes/Bacteroidetes
Density25-OH-D3
Low-48.34bc41.19a4.531.202.11a0.85b
Low+60.28a32.26b3.061.182.18a0.54c
High-50.63b41.06a4.451.680.58b0.81b
High+40.50c51.21a3.781.621.18ab1.26a
SEM4.603.930.90.430.610.11
P-value<0.01<0.010.320.470.02<0.01
Main effect (P-Value)
 Density0.040.040.140.62<0.010.01
 25-OH-D30.780.860.890.110.450.04
 Density*25-OH-D3<0.010.040.960.530.54<0.01

Means with different superscripts within a column differ significantly (P ≤ 0.05).

1Each mean represents 10 replicates per treatment, with 1 layer per replicate.

Abbreviations: 25-OH-D3, 25-hydroxyvitamin D; V/C, ratio of villus height to crypt depth.

Effect of stocking density and dietary 25-OH-D3 supplementation on cecal microbiota enrichment of layers. (A) The Venn diagram. (B) The principal coordinate analysis (PCA) of the cecum microbiota based on unweighted UniFrac metrc. (C, D) The relative abundance of the top 10 phylum (C) and genus (D). (E) Linear discrimination analysis coupled with effect size (LEfSe) identified most differentially abundant taxa in the cecum with LDA significant threshold > 4 were shown. (F) Analysis of different species between groups at genus level (a) and species level (b). The difference N = 6. Statistical significance was evaluated by Students T-test, P ≤ 0.05. The relative abundance of the top 5 dominant microbiota ratio at phylum level in cecum. Means with different superscripts within a column differ significantly (P ≤ 0.05). 1Each mean represents 10 replicates per treatment, with 1 layer per replicate. Abbreviations: 25-OH-D3, 25-hydroxyvitamin D; V/C, ratio of villus height to crypt depth.

DISCUSSION

Deficiency in sical">pace allowance (HD) were reported to increase oxidative stress and had adverse effect on intestinal health of broilers (Li et al., 2019; Magnuson et al., 2020). Reactive oxidative species (ROS) are byproducts of energy metabolism in tissues of animals and can be readily elevated by environmental stresses such as crowding (Surai et al., 2019). Oxidative stress resulted from stocking density or other stressors were proved to impair the health and production performance of layers (Kang et al., 2016; Abbas et al., 2020; Wang et al., 2020). Intestinal morphology changes with nutritional variations, stress, aging, and (or) disease and it determines the nutrient absorption capacity and are also closely related to the immune response (Celi et a., 2019). An increase in villus height indicated a larger absorption area, while deeper crept health indicates that the villi in the small intestinal mucosa are atrophied and their absorptive capacity is decreased (Zhang et al., 2005). In the same study, we found that HD decreased the production performance and increased the corticosterone in layers (Wang et al., 2020), which indicated that the HD induced a stress in layers. At the same time, we didn't observe any difference in villus height caused by HD, however, as expected, HD decreased the crypt depth and antioxidative capacity of small intestine, as demonstrated by lower activities of antioxidant enzymes, SOD, CAT and T-AOC, and higher corresponding levels of MDA. Kridtayopas et al. (2019) also reported that exposed to HD reduced the duodenum, jejunal and ileal villus height in broilers. In previous study, high stocking density led to a reduction in activities of T-AOC, SOD and GSH-Px and higher MDA in serum of broilers and ducks (Wu et al., 2018; Li et al., 2019). We also found that 25-(OH)-D3 supplementation improved CAT activity of small intestine of layers, and the protective effect of 25-(OH)-D3 on T-AOC and MDA were more pronounced in layers suffered from HD. It has been demonstrated that both 25-(OH)-D3 and its active hormonal form (1,25(OH)2D3) are essential for physiological functions, including damping down inflammation and oxidative stress (Nakai et al., 2014; Wimalawansa, 2019). Although, literatures about supplementation 25-(OH)-D3 in layers exposed to HD is limited, previous studies also reported that 25-(OH)-D3 and vitamin D3 can alleviate the immune response and improve performance of layers against lipopolysaccharide or coccidia-induced immunological stress (Morris et al., 2014, 2015; Geng et al., 2018). This may indicate that 25-(OH)-D3 exert protective effect against HD as indicated by intestinal morphology and antioxidative capacity. The intestinal barrier function is one of the important components that maintain gut health and function, and it is generally determined by tight junction integrity of epithelial cells and mucus gel layer (Moretó and Pérez-Bosque, 2009). The tight junctions including occluding, claudins and junction adhesion molecule (JAM) are the main component proteins of tight junctions and ZO-1 acts as a plague protein connecting between those tight junction proteins and cytoskeletons (Ulluwishewa et al., 2011). Mucins are the main constituent of mucus gel layer on intestinal mucosa. The decreased expression of tight junction and mucus layer related genes and proteins has been considered a molecular evidence for impaired intestinal health (Moretó and Pérez-Bosque, 2009; Gilani et al., 2018). In this study, we found that HD led to down-regulation of intestinal barrier associated protein (claudin-1, mucin-1 and mucin 2). This result agrees with previous experiments that reported high stocking density decreased the expression of ZO-1 and JAM-2 in jejunal mucosa of broiler chickens (Goo et al., 2019). We also observed that 25-(OH)-D3 supplementation improved the intestinal barrier function (higher gene expression of claudin-1, mucin-1 and mucin-2) of small intestine of layers regardless of the stocking density. Vitamin D plays a key role in immune system and also been involved in the intestinal mucosa barrier homeostasis (Liu et al., 2013; Assa et al., 2014; Rodriguez-Lecompte et al., 2016). It has been evident that vitamin D ensures an appropriate level of antimicrobial peptides in the mucus and maintains epithelial integrity by reinforcing intercellular junctions (Kong et al., 2008; Fakhoury et al., 2020). Also, vitamin D and its receptor exhibited protective effect on intestinal structure and barrier function in colitis model by modulation the Th1, Th2 and Th17 response (Golan et al., 2015; Liu et al., 2013; Shi et al., 2020). The gut microbiota has been implicated in a variety of stress-related conditions including stress, disease, and changed nutrient regimen on animal studies (Foster et al., 2017). The rearing system, including cage system and floor space were shown to alter the microbiota composition in poultry (Wang et al., 2018; Zhu et al., 2019). In current study, HD also result in a reduction of the SCFA content in cecum and also decreased the cecal microbiota diversity, as indicated by Shannon, Chao1 and ACE indices. Interestingly, dietary supplementation with 25-OH-D3 also reduced the ACE index under low stocking density. It has been suggested that vitamin D deficiencies result in less diverse, dysbiotic microbial communities and increased susceptibility to infection or injury of the gastrointestinal tract (Cantorna et al., 2019). Vitamin D-mediated regulation of the intestinal epithelium and mucosal immune system shape the microbial communities in the gut to maintain homeostasis. The reason why the result of 25-OH-D3 on diversity is not consistent in different stocking density is not clear. Besides microbiota diversity, the phylogenetic composition of gut microbiota also shifts substantially between layers with different stocking density. SCFA, acetate, propionate and butyrate are the end products of microbiota (such as Firmicutes and Bacteroidetes) fermentation (Turnbaugh et al., 2006). We found that HD decreased the total SCFA (propionate and butyrate). Since SCFA accounts for dietary energy source for animals, this may suggest that HD had lower available energy for maintenance and performance. We also found that HD layers had lower proportion of Bacteroidetes, Spirochaetes, and higher enrichment of Firmicutes abundance and Firmicutes/Bacteroidetes ratio in cecum compared to LD layers at present study. However, Zhu et al. (2019) shown that heat stress decreased fecal Firmicutes and increased abundance of Bacteroidetes in layers. The discrepancy may result from the stress origin and animal species and physiological stage in different study. Also, the Lactobacilli was not affected by stocking density in current study, which is in accordance with the result of Harrow et al (2007), who also found that stocking density didn't change the numbers of Lactobacillus salivarius in ileal of broilers. Moreover, it also shown that 25-(OH)-D3 increased the Bacteroidetes and decreased Firmicutes enrichment as well their ratio in the cecum of LD layers in current study. This observation suggests that Firmicutes are inhibited to a larger extent by 25-OH-D3, thus tilting the balance of gastrointestinal functionality and can be indicative of eubiosis conditions in the gastrointestinal tract. But this effect of 25-OH-D3 on Bacteroidetes and Firmicutes enrichment in cecum was opposite in HD group, and the reason relied in this is not clear, which need to be further studied. At the same time, an in enrichment of Coprobacter and Subdoligranulum, and decreased unidentified_Lachnospiraceae (genus), Clostridium_sp_Marseille-P3244 (Species) and Parasullterlla_secunda were found in cecum of HD layers in current study. The genus Coprobacter, first described in 2013, is described as a propionic and acetic acids producer (Shkoporov et al., 2013). Wang et al. (2018) described an increased cecal Coprobacter proportion in ducks with litter floor rearing system. Also, Clostridium_sp_Marseille-P3244 belongs to Firmicutes, and is used as a probiotic candidate, which was decreased by HD. These observations suggest that the layers reared high stocking density enables its microbial assemblages within the cecum to response to the stress. Interestingly, we observed opposite results when using 25-OH-D3 in alternation of Bacteroidetes and Firmicutes in cecum of layers with different stocking density (a rise of Bacteroidetes and lowing of Firmicutes in LDV), which may indicate the complex interaction among microbiome, nutrient diet regimen and environmental stressors. Moreover, we also found that supplementation 25-OH-D3 in HD led to an increase in anti-inflammatory bacterial taxa, including Bacteroidales, Butyricicoccus and Alistipes in current study. Wu et al. (2018) reported that high stocking density depleted these taxa in ducks. Also, studies suggested that patients with IBD and Clostridium diffcile infection have a lower abundance of Alistipe than their healthy counterparts (Mancabelli et al., 2017). Few literatures can be found on the influence of vitamin D in microbiota of layers under different stocking density, but vitamin D was proved to alternate microbiome and have anti-inflammatory in mammals (Guillot et al., 2010; Cantorna et al., 2019; Fakhoury et al., 2020; Zhang et al., 2020b).

CONCLUSION

These results suggest that supplementing 25-OH-D3 in diets may elevate gut health through the improvement of intestinal morphology, barrier function, antioxidant capacity and microbiota composition in laying hens with high stocking density.
  2 in total

1.  Effects of Housing System on Anxiety, Chronic Stress, Fear, and Immune Function in Bovan Brown Laying Hens.

Authors:  Andrew M Campbell; Alexa M Johnson; Michael E Persia; Leonie Jacobs
Journal:  Animals (Basel)       Date:  2022-07-14       Impact factor: 3.231

2.  Dietary 25-Hydroxyvitamin D3 Supplementation Modulates Intestinal Cytokines in Young Broiler Chickens.

Authors:  Gerardo A Abascal-Ponciano; Samuel F Leiva; Joshua J Flees; Luis P Avila; Jessica D Starkey; Charles W Starkey
Journal:  Front Vet Sci       Date:  2022-07-11
  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.