Zhaohui Chai1, Peidong Zheng1, Jiesheng Zheng1. 1. Department of Neurosurgery, The First Affiliated Hospital, College of Medicine, Zhejiang University, Hangzhou, 310003, China.
Abstract
OBJECTIVE: Stroke is a cerebrovascular disorder that often causes neurological function defects. ARPP21 is a conserved host gene of miR-128 controlling neurodevelopmental functions. This study investigated the mechanism of ARPP21 antagonistic intron miR-128 on neurological function repair after stroke. METHODS: Expressions of ARPP21 and miR-128 in stroke patients were detected. The mouse neurons and astrocytes were cultured in vitro and treated with oxygen-glucose deprivation (OGD). The OGD-treated cells were transfected with pc-ARPP21 and miR-128 mimic. The proliferation of astrocytes, and the apoptosis of neurons and astrocytes were detected, and inflammatory factors of astrocytes were measured. The binding relationship between miR-128 and CREB1 was verified. The rat model of middle cerebral artery occlusion (MCAO) was established. ARPP21 expression in model rats was detected. The effects of pc-ARPP21 on neuron injury, brain edema volume, and cerebral infarct in rats were observed. RESULTS: ARPP21 expression was downregulated and miR-128 expression was upregulated in stroke patients. pc-ARPP21 facilitated the proliferation of astrocytes and inhibited apoptosis of neurons and astrocytes, and reduced inflammation of astrocytes. miR-128 mimic could reverse these effects of pc-ARPP21 on neurons and astrocytes. miR-128 targeted CREB1 and reduced BDNF secretion. In vitro experiments confirmed that ARPP21 expression was decreased in MCAO rats, and pc-ARPP21 promoted neurological function repair after stroke. CONCLUSION: ARPP21 upregulated CREB1 and BDNF expressions by antagonizing miR-128, thus inhibiting neuronal apoptosis and promoting neurological function repair after stroke. This study may offer a novel target for the management of stroke.
OBJECTIVE: Stroke is a cerebrovascular disorder that often causes neurological function defects. ARPP21 is a conserved host gene of miR-128 controlling neurodevelopmental functions. This study investigated the mechanism of ARPP21 antagonistic intron miR-128 on neurological function repair after stroke. METHODS: Expressions of ARPP21 and miR-128 in stroke patients were detected. The mouse neurons and astrocytes were cultured in vitro and treated with oxygen-glucose deprivation (OGD). The OGD-treated cells were transfected with pc-ARPP21 and miR-128 mimic. The proliferation of astrocytes, and the apoptosis of neurons and astrocytes were detected, and inflammatory factors of astrocytes were measured. The binding relationship between miR-128 and CREB1 was verified. The rat model of middle cerebral artery occlusion (MCAO) was established. ARPP21 expression in model rats was detected. The effects of pc-ARPP21 on neuron injury, brain edema volume, and cerebral infarct in rats were observed. RESULTS: ARPP21 expression was downregulated and miR-128 expression was upregulated in stroke patients. pc-ARPP21 facilitated the proliferation of astrocytes and inhibited apoptosis of neurons and astrocytes, and reduced inflammation of astrocytes. miR-128 mimic could reverse these effects of pc-ARPP21 on neurons and astrocytes. miR-128 targeted CREB1 and reduced BDNF secretion. In vitro experiments confirmed that ARPP21 expression was decreased in MCAO rats, and pc-ARPP21 promoted neurological function repair after stroke. CONCLUSION: ARPP21 upregulated CREB1 and BDNF expressions by antagonizing miR-128, thus inhibiting neuronal apoptosis and promoting neurological function repair after stroke. This study may offer a novel target for the management of stroke.
Stroke remains a dominant cause of mortality worldwide that often results in chronic disability and cognitive impairment, and the mounting incidence of stroke also poses enormous burdens on medicare systems.
The most common etiological origin of stroke is the narrowing of carotid or head arteries, which is usually attributed to atherosclerosis.
The core event of stroke is the blood supply interruption to brain tissues, which consequently leads to hypoxia and shortage of nutrients, and finally results in neuronal cell death and brain infarct.
The risk factors for stroke include arterial hypertension, dyslipidemia, diabetes mellitus, carotid stenosis, and unhealthy lifestyles such as smoking, alcohol, and lack of physical activity.
Currently, revascularization therapies including intravenous thrombolysis and endovascular thrombectomy remain the clinical approaches available for stroke patients.
However, a majority of stroke patients do not satisfy the criteria for thrombolysis and consequently, these patients tend to have residual neurological deficits.
It is well established that improving neurological functions by supporting neurogenesis contributes to reducing the chronic disability in stroke patients.
Hence, developing novel therapeutic targets to repair neurological functions after stroke has emerged as an urgent issue.ARPP21 is initially identified as a substrate of cAMP‐dependent protein kinase, which is enriched in basal ganglia.
The upregulated ARPP21 expression in permanent periodontal ligament tissues is concerned with neurological responses.
ARPP21 is also confirmed to play a regulatory role in controlling dendritic branching,
and nerve development and differentiation are tightly related to neurological function repair after stroke. Still, the role of ARPP21 in stroke‐induced neurological deficits remains unknown.microRNAs (miRs) are a class of small noncoding RNA molecules consisting of 18–24 nucleotides, which exert influences on the posttranscriptional modulation of gene expression.
,
Approximately half of miRs in mammals are located in the introns of protein‐coding genes, but the functional interaction between miRs and host genes has not been fully elucidated.
miR‐128 is an antagonistic intron located in ARPP21 gene.
ARPP21 contains miR‐128 coding units in the intronic region and serves as a RNA‐binding protein to antagonize the inhibitory effect of miR‐128 on target genes.
The enhanced miR‐128 expression is related to the severity of stroke partially by inhibiting neuronal cell cycle reentry.
Nevertheless, whether ARPP21 is implicated in the neurological function repair after stroke by antagonizes intron miR‐128 is unclear. This study herein investigated the mechanism of ARPP21 antagonistic intron miR‐128 in neurological function repair after stroke, which shall offer novel insights for the improvement of neural function after stroke.
Materials and Methods
Clinical samples
The peripheral blood samples were collected from 15 stroke patients (inclusion criteria: 18–80 years old, no gender limitation, meeting the diagnostic criteria for stroke confirmed by CT, no other autoimmune diseases, National Institutes of Health Stroke Scale (NIHSS) was 11.07 ± 3.49) and 15 healthy volunteers (no brain injury disease, autoimmune disease, and malignant tumors). The samples were centrifuged within 2 h and stored at −80℃.
In vitro culture of neurons and astrocytes
Ten ICR mice within 24 h after birth, male or female, were provided by Beijing HFK Bioscience Co., Ltd [SCXK (Beijing) 2012‐0004].For the culture of hippocampal neurons, the newborn mice were sterilized with 75% ethanol, and the brain tissues were removed on ice. Hippocampal neurons were isolated under the stereomicroscope, transferred into 1 mL of ice Hank’s balanced salt solution, detached with 0.25% trypsin at 37℃ for 25 min, and shaken once. The medium containing 10% fetal bovine serum (FBS) was added to terminate the detachment. The cells were resuspended (5 × 105 cells/mL), seeded, and cultured at 37℃ with 5% CO2. The serum‐free medium was changed within 12 h, and half of the medium was refreshed every 3 days. The cells were used for immunofluorescence staining on the 14th day. Over 95% microtubule‐associated protein 2 (MAP2)‐positive expression indicated that the purity of neurons met the requirements of subsequent experiments.For the culture of astrocytes, the mice were sacrificed, and then the cerebral cortex was removed with elbow tweezers under sterile conditions, and washed with phosphate‐buffered saline (PBS) three times. The connective tissues such as meninges and blood vessels were removed under the anatomical microscope. Then, the samples were detached with 0.25% trypsin and 0.04% ethylenediaminetetraacetic acid for 2–3 min by pipetting. The culture medium containing 10% FBS was added to terminate the detachment until no cell mass could be observed by naked eyes. The samples were centrifuged at 100 g for 8 min to remove the supernatant, and cultured in disposable culture bottles with fresh medium. After 7–10 days, astrocytes covered the bottom of the bottles. The bottles were shaken for 18 h to remove the supernatant. The bottom cells were passaged. Astrocytes at passage 3 were detached with 0.25% trypsin and then centrifuged to collect the supernatant. The complete medium was added to adjust the cell concentration to 1 × 104 cells/mL. The cells were seeded into the 6‐well plates with sterile cover glasses and cultured at 37℃ with 5% CO2, with each well supplemented 1.5 mL cell suspension. Immunofluorescence staining was performed when the cells were about 80% full of the bottom of the bottle. If the glial fibrillary acidic protein (GFAP)‐positive expression exceeded 90%, it was indicated that the purity of astrocytes met the requirements of subsequent experiments.Oxygen‐glucose deprivation (OGD) was used for in vitro model of cerebral ischemia. The cultured neurons and astrocytes were washed with 1 × PBS twice and cultured with EBSS (24010043, GIBCO, Grand Island, NY, USA) at 37℃ with 95% N2 and 5% CO2. After 2 h, the OGD medium was replaced with normal medium and the cells were cultured for 12 h under normal conditions.
Cell transfection
pcDNA‐ARPP21, pcDNA‐NC, mimic NC, and miR‐128 mimic were purchased from Sangon Biotech (Shanghai, China). The cell transfection was performed using Lipofectamine™ 2000 (Invitrogen, Carlsbad, CA, USA). The subsequent experiments were conducted after 48 h.
Astrocytes in the logarithmic phase were collected and cultured with 20 mL of 5 g/L of MTT solution (GIBCO) on the 1st, 2nd, 3rd, and 4th day, respectively. After 4 h of culture, the supernatant was removed. Each well was added with 150 μL of dimethyl sulfoxide (DMSO), and shaken until the crystal was fully dissolved. The optical density (OD) of each well at 490 nm was measured using a microplate reader (Rayto Life Science Co., Ltd, Shenzhen, Guangdong, China). The horizontal axis indicated the culture time and the vertical axis expressed the OD value. Five duplicated wells were set in each group. The experiment was repeated three times (Table 1).
Total RNA was extracted using the RNA extraction kit (Takara, Dalian, China) and the concentration of RNA was measured. RNA was reverse transcribed into cDNA using PrimeScript RT reagent kit with gDNA Eraser (Takara). The RT‐qPCR was performed on the provided instructions of SYBR® Premix Ex Tap™ Ⅱ kit (Takara), with cDNA as a template. The relative expression of genes was calculated by the 2−ΔΔCt method, with U6 and glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) acting as the internal reference. Primers (Table 2) were synthesized by Sangon Biotech.
Table 2
Primer sequence for RT‐qPCR.
Primers
Sequences (5’‐3’)
ARPP21
F: 5ʹ‐ATGTCTGAGCAAGGAGACCTGA‐3ʹ
R: 5ʹ‐TCAGAGAGTCTGATCCTGAAGA‐3ʹ
miR‐128
F: 5ʹ‐GCCGGCGCCCGAGCTCTGGCTC‐3ʹ
R: 5ʹ‐TCACAGTGAACCGGTCTCTTT‐3ʹ
CREB1
F: 5ʹ‐ATGACCATGGAATCTGGAGCCG‐3ʹ
R: 5ʹ‐TCAGTTACACTATCCACTGACT‐3ʹ
GAPDH
F: 5ʹ‐GGGAGCCAAAAGGGTCAT‐3ʹ
R: 5ʹ‐GAGTCCTTCCACGATACCAA‐3ʹ
U6
F: 5ʹ‐CGCTTCGGCAGCACATATAC‐3ʹ
R: 5ʹ‐AATATGGAACGCTTCACGA‐3ʹ
BDNF
F: 5ʹ‐ATGACCATCCTTTTCCTTACTA‐3ʹ
R: 5ʹ‐CTATCTTCCCCTTTTAATGGTC‐3ʹ
Primer sequence for RT‐qPCR.
Western blotting
Total protein was extracted in cell lysate on ice and the concentration of proteins was tested using the bicinchoninic acid assay kit (Thermo Scientific Pierce, Rockford, IL, USA). Next, the proteins were separated by SDS‐PAGE and transferred onto polyvinylidene fluoride membranes. The membranes were washed with Tris‐buffered saline‐tween (TBST) three times (15 min/time) and blocked with 5% skim milk for 2 h. Afterward, the membranes were cultured with the primary antibodies at 4℃ overnight: brain‐derived neurotrophic factor (BDNF) (ab108319, 1:1000, Abcam Inc., Cambridge, MA, USA), cAMP‐response element‐binding protein1 (CREB1) (ab178322, 1:500, Abcam), GFAP (ab33922, 1:500, Abcam) and MAP2 (ab11267, 1:1000, Abcam). Following washing with TBST (3 times/15 min), the membranes were cultured with the secondary antibody IgG (1:2000, ab205718, Abcam) for 2 h and then washed with TBST (three times/15 min) before chemiluminescence developing and visualization. The image of protein blotting was analyzed by Image J2x v2.1.4.7 software (Rawak Software, Inc. Dresden, Germany).
Enzyme‐linked immunosorbent assay (ELISA)
The culture supernatant of astrocytes was collected and centrifuged at 100 g for 5 min to remove the precipitate. The levels of tumor necrosis factor (TNF)‐α, interleukin (IL)‐6, and IL‐1β in supernatant were detected using ELISA assay kit (R&D Systems Inc., Minneapolis, MN, USA).
Dual‐luciferase reporter gene assay
The binding site of miR‐128 and CREB1 was predicted by bioinformatics software and website. The CREB1 3'UTR sequence containing miR‐128 binding site was synthesized to construct CREB1 3'UTR wild‐type (WT) plasmid (CREB1‐WT), and then the mutant type (MUT) plasmid CREB1‐MUT was constructed by mutating the binding site. CREB1‐WT and CREB1‐MUT were co‐transfected with mimic NC and miR‐128 mimic into 293T cells (American Type Culture Collection, Manassas, Virginia, USA). After 48 h, the cells were collected and lysed. The relative luciferase activity was detected using the dual‐luciferase assay kit (BioVision, San Francisco, CA, USA) and the fluorescence detector GloMax20/20 Luminometer (Promega, Madison, WI, USA).
Immunofluorescence staining
The neurons and astrocytes were washed with PBS three times and fixed with 4% paraformaldehyde for 10 min. Then, the cells were washed with PBS three times and permeabilized with Triton for 10 min. Following PBS washing three times, the cells were blocked with 0.5% bovine serum albumin for 30 min and cultured with the primary antibodies GFAP (ab33922, 1:2000, Abcam) and MAP2 (ab221693, 1:1000, Abcam) at 4℃ overnight. On the next day, the cells were cultured at room temperature for 15 min, washed with PBS three times, and cultured with the secondary antibody fluorescein isothiocyanate (ab6785, 1:10000, Abcam) in the dark at 37℃ for 90 min. Following PBS washing three times, the cells were sealed with fluorescent mounting media and observed under the fluorescence microscope (Olympus, Tokyo, Japan).
Oxidative stress measurement
For the detection of reactive oxygen (ROS), the neurons and astrocytes were seeded into the 48‐well plates and cultured at 37℃ for 30 min, with each well added with 250 μL of Dulbecco’s modified Eagle’s medium containing 5 μmol/L of dihydroethidium (DHE; Sigma‐Aldrich, Merck KGaA, Darmstadt, Germany). The images were captured by Cellomics ArrayScan VTI High Content System (East Test Technology Co., Ltd., Shenzhen, Guangdong, China). The fluorescence intensity of DHE was counted and the relative content of ROS was calculated.For the detection of glutathione (GSH), superoxide dismutase (SOD), and oxidation marker malondialdehyde (MDA), the neurons and astrocytes were seeded into the 60 mm culture dishes (106 cells/dish), washed with PBS, and centrifuged to collect the supernatant. The contents of GSH, MDA, and SOD were detected using the kits (Jiancheng Bioengineering Institute, Nanjing, Jiangsu, China). Each reaction solution was added to 96‐well plates. The absorbance value at 410 nm was measured on a microplate reader to calculate the GSH content. The absorbance value at 530 nm was measured to calculate the MDA content. The absorbance value at 450 nm was measured to calculate the SOD content. The experiment was repeated three times.
Experimental animal
Totally 72 adult male Sprague‐Dawley (SD) rats (aged 7–10 weeks and weighed 230–260 g) were purchased from SLAC Laboratory Animal Co., Ltd (Shanghai, China). The rats were kept in a standard animal room at 18–22℃ and maintained in a 12 h light/dark cycle. Food and water were provided ad libitum. All rats were euthanized by an intraperitoneal injection of ≥100 mg/kg pentobarbital sodium to collect tissues.
Rat model of middle cerebral artery occlusion (MCAO)
The 72 rats were assigned into the sham group, MCAO + DMSO group, MCAO + pc‐ARPP21 group, and MCAO + pc‐NC group, with 18 rats in each group. The rats were anesthetized by an intraperitoneal injection of pentobarbital sodium (0.05 g/kg). A 4/0 nylon thread (Shadong Biotechnology Co., Ltd, Beijing, China) was inserted at the external carotid artery to ligate the upper end of the internal carotid artery about 18–20 mm to block the right middle cerebral artery. After 60 min of ischemia, nylon thread was slowly drawn out and the blood supply of the common carotid artery was restored. During the operation, the rats were placed on a 37℃ heating blanket to maintain body temperature. The sham‐operated rats received the whole operation without nylon insertion.Two days before modeling, rats in the MCAO + pc‐ARPP21 group and MCAO + pc‐NC group were microinjected with adenovirus overexpression vectors pcDNA‐ARPP21 and pcDNA‐NC (Cyagen Biosciences, Guangzhou, Guangdong, China). The titer of adenovirus was 4 × 108 CFU/mL; the injection dose was 0.1 mL, and the needle was retained for 5 min after injection.
Neurobehavioral test
The neurological deficits were graded 24 h after operation according to Bederson's method.
The criteria were as follows: 0, no neurological symptoms; 1, when the tail was lifted in the air, the contralateral forelimb of the animal could not be fully extended, which showed wrist elbow flexion, shoulder internal rotation, elbow abduction close to the chest wall; 2, the animal was placed on a smooth plane, and the animal circled to the contralateral side of operation when walking; 3, the animal was tipped to the contralateral side of the operation when walking; 4, the animal failed to autonomous walking, accompanied by a consciousness decrease; 5, death.
Edema volume measurement
The rat brain was quickly dissected and weighed immediately on pre‐weighed aluminum foil to obtain the wet weight. The tissues were dried in an electronic oven at 105℃ for 24 h to obtain the dry weight. The water content was expressed as (wet weight‐dry weight/wet weight × 100%).
The corresponding brain tissue sections of SD rats were collected and stained with 1% TTC solution (2530‐85‐0, Guidechem, Shanghai, China) for 30 min. The infarct volume of each brain region was measured by Image Analyzer (Bio‐Rad Laboratories Inc., Hercules, CA, USA), and the infarct volume was calculated as the total infarct volume of each section.
Hematoxylin and eosin (HE) staining
The rat brain tissues were fixed with 4% formaldehyde for 6 h and then embedded in paraffin. The embedded brain tissues were sliced into 3 μm sections, baked overnight at 60℃, and dewaxed twice with xylene I and xylene II. The sections were immersed in 100%, 95%, 80%, and 70% ethanol for 5 min and then put into distilled water. Then the sections were stained with hematoxylin for 10 min and washed with water for 15 min to make the sections blue. The sections were stained with eosin (RY0648, Qingdao Jisskang Biotechnology Co., Ltd, Qingdao, China) for 30 s and washed with double distilled water. Afterward, the sections were dehydrated with alcohol, cleared with xylene, and sealed with neutral balsam. The morphological changes of neurons in rat brain tissues were detected by Morphological Image Analysis System (JD801, Jeda Technology Co., Ltd, Nanjing, China), and images were captured randomly.
Statistical analysis
Data analysis was introduced using the SPSS 21.0 software (IBM Corp., Armonk, NY, USA). Data are expressed as mean ± standard deviation. Kolmogorov‐Smirnov method was adopted to check whether the data were in normal distribution. If the data were in normal distribution and homogeneity of variance, then the t test was adopted for comparison between two groups. One‐way analysis of variance (ANOVA) or two‐way ANOVA was employed for the comparisons among multiple groups, following Tukey's multiple comparisons test. If the data were not in normal distribution or homogeneity of variance, the rank‐sum test was carried out. The p < 0.05 meant a statistical significance.
Results
ARPP21 was downregulated in patients with stroke
The expressions of ARPP21 and miR‐128 in peripheral blood of stroke patients and healthy volunteers were detected using RT‐qPCR. The results exhibited that ARPP21 expression was downregulated and miR‐128 expression was upregulated in stroke patients (p < 0.05; Fig. 1A/B).
FIGURE 1
ARPP21 was downregulated in patients with stroke. (A/B) Expressions of ARPP21 and miR‐128 in peripheral blood serum of stroke patients and healthy volunteers were detected using RT‐qPCR. The experiment was repeated three times independently. Data were expressed as mean ± standard deviation and analyzed using t test, *p < 0.05.
ARPP21 was downregulated in patients with stroke. (A/B) Expressions of ARPP21 and miR‐128 in peripheral blood serum of stroke patients and healthy volunteers were detected using RT‐qPCR. The experiment was repeated three times independently. Data were expressed as mean ± standard deviation and analyzed using t test, *p < 0.05.
Astrocytes were incubated and identified in vitro
Neurons and astrocytes are the main functional cells after ischemic stroke.
,
To deeply analyze the mechanism of neuronal regeneration and astrocyte nutritional function, and explore effective targets for the prevention and treatment of stroke, we cultured neurons, and astrocytes in vitro. After 24 h, neurons began to adhere to the wall under the inverted phase‐contrast microscope, and the cells were round with halo and small processes. On the 4th day, the number of processes and branches was increased notably. On the 7th day, a very dense network between cells was formed. On the 14th day, some cell processes were slightly atrophied. With the extension of culture time, the cell growth gradually slowed down, and cells continued to shrink, aging and gradually died. The survival time of the cells was about 3 weeks. Most of the astrocytes adhered to the wall after 1 day, and a small number of astrocytes grew irregular processes after 14 days of culture. On the 7th day, the number of cell processes was increased; the division and proliferation were rapid, and many intercellular connections were formed. On the 14th day, the cells covered the bottom of the culture dish and arranged closely (Fig. 2A).
FIGURE 2
Astrocytes were incubated and identified in vitro. (A) Morphological changes in neurons and astrocytes were observed under the inverted phase‐contrast microscope. (B) Proliferation ability of astrocytes was detected using MTT assay. (C) Neurons and astrocytes were identified using immunofluorescence. (D) Expressions of ARPP21 and miR‐128 in cells were detected using RT‐qPCR. The cell experiment was repeated three times independently. Data were expressed as mean ± standard deviation. Data in panel (B/D) were analyzed using t test, **p < 0.01.
Astrocytes were incubated and identified in vitro. (A) Morphological changes in neurons and astrocytes were observed under the inverted phase‐contrast microscope. (B) Proliferation ability of astrocytes was detected using MTT assay. (C) Neurons and astrocytes were identified using immunofluorescence. (D) Expressions of ARPP21 and miR‐128 in cells were detected using RT‐qPCR. The cell experiment was repeated three times independently. Data were expressed as mean ± standard deviation. Data in panel (B/D) were analyzed using t test, **p < 0.01.MTT assay showed that the OD value of cells was increased with the extension of culture time, and the proliferation ability of astrocytes peaked on the 14th day (Fig. 2B). The neurons cultured for 14 days and astrocytes at P3 cultured for 2 weeks were used for immunofluorescence staining. The purity of neurons exceeded 95%, and the GFAP‐positive expression in astrocytes was higher than 95% (Fig. 2C). Neurons and astrocytes cultured in vitro could be used for subsequent experiments. Then we treated neurons and astrocytes with OGD and detected ARPP21 and miR‐128 expressions using RT‐qPCR. ARPP21 expression was lower and miR‐128 was higher in OGD‐treated cells than those in control cells (all p < 0.01; Fig. 2D).
Overexpression of ARPP21 facilitated the proliferation and activation of astrocytes, and inhibited the apoptosis of neurons and astrocytes
To explore the specific roles of ARPP21 and miR‐128 in neurons and astrocytes, we transfected pc‐ARPP21 and miR‐128 mimic into OGD‐treated neurons and astrocytes, respectively. The transfection efficiency was confirmed using RT‐qPCR (p < 0.01; Fig. 3A). Then, we performed MTT assay to detect the proliferation of astrocytes after overexpression of ARPP21. The results demonstrated that OGD + pc‐ARPP21‐treated cells showed enhanced proliferation ability and GFAP level compared with OGD + pc‐NC‐treated cells; OGD + pc‐ARPP21 + miR‐128 mimic‐treated cells had reduced proliferation ability and GFAP and MAP2 level compared with OGD + pc‐ARPP21 + miR‐NC‐treated cells (all p < 0.01; Fig. 3B/C). Additionally, OGD + pc‐ARPP21‐treated cells showed decreased apoptosis rate compared with OGD + pc‐NC‐treated cells; OGD + pc‐ARPP21 + miR‐128 mimic‐treated cells had increased apoptosis rate compared with OGD + pc‐ARPP21 + miR‐NC‐treated cells (p < 0.01; Fig. 3D). Briefly, overexpression of ARPP21 enhanced the proliferation and activation of astrocytes, and inhibited apoptosis of neurons and astrocytes, while overexpression of miR‐128 showed the opposite trend.
FIGURE 3
Overexpression of ARPP21 facilitated the proliferation of astrocytes, and inhibited apoptosis of neurons and astrocytes. pc‐ARPP21 and miR‐128 mimic were transfected into OGD‐treated neurons and astrocytes. (A) Expressions of ARPP21 and miR‐128 in cells were detected using RT‐qPCR. (B) Proliferation ability of astrocytes was detected using MTT assay. (C) GFAP and MAP2 expression was detected using Western blotting. (D) Cell apoptosis was measured using flow cytometry. The cell experiment was repeated three times independently. Data were expressed as mean ± standard deviation, and analyzed using one‐way ANOVA, followed by Tukey’s multiple comparisons test, **p < 0.01.
Overexpression of ARPP21 facilitated the proliferation of astrocytes, and inhibited apoptosis of neurons and astrocytes. pc‐ARPP21 and miR‐128 mimic were transfected into OGD‐treated neurons and astrocytes. (A) Expressions of ARPP21 and miR‐128 in cells were detected using RT‐qPCR. (B) Proliferation ability of astrocytes was detected using MTT assay. (C) GFAP and MAP2 expression was detected using Western blotting. (D) Cell apoptosis was measured using flow cytometry. The cell experiment was repeated three times independently. Data were expressed as mean ± standard deviation, and analyzed using one‐way ANOVA, followed by Tukey’s multiple comparisons test, **p < 0.01.
Overexpression of ARPP21 reduced inflammation and alleviated oxidative stress of astrocytes
Cerebral inflammation represents a promising therapeutic target for ischemic stroke.
The levels of TNF‐α, IL‐6, and IL‐1β in astrocytes were detected using ELISA. OGD + pc‐ARPP21‐treated cells showed decreased levels of TNF‐α, IL‐6, and IL‐1β compared with OGD + pc‐NC‐treated cells, while miR‐128 could reverse these trends (all p < 0.01; Fig. 4A). Inflammation can cause oxidative stress in cells.
ROS content was determined by fluorescence probe DCFH‐DA. After overexpression of ARPP21, the fluorescence of OGD cells was decreased notably (p < 0.05; Fig. 4B). The levels of GSH, SOD, and MDA were detected using colorimetric assay. Compared with OGD + pc‐NC‐treated cells, OGD + pc‐ARPP21‐treated cells showed increased GSH and SOD levels and decreased MDA, while miR‐128 could reverse these trends (p < 0.05; Fig. 4C–E). In brief, overexpression of ARPP21 reduced cellular inflammation and alleviated oxidative stress.
FIGURE 4
Overexpression of ARPP21 reduced cellular inflammation and alleviated oxidative stress. pc‐ARPP21 and miR‐128 mimic were transfected into OGD‐treated neurons and astrocytes. (A) Levels of TNF‐α, IL‐6, and IL‐1β in astrocytes were detected using ELISA. (B) Content of ROS was determined by fluorescence probe DCFH‐DA. (C–E) Contents of GSH, SOD, and MDA were detected using the kits. The cell experiment was repeated three times independently. Data were expressed as mean ± standard deviation, and analyzed using one‐way ANOVA, followed by Tukey’s multiple comparisons test, **p < 0.01.
Overexpression of ARPP21 reduced cellular inflammation and alleviated oxidative stress. pc‐ARPP21 and miR‐128 mimic were transfected into OGD‐treated neurons and astrocytes. (A) Levels of TNF‐α, IL‐6, and IL‐1β in astrocytes were detected using ELISA. (B) Content of ROS was determined by fluorescence probe DCFH‐DA. (C–E) Contents of GSH, SOD, and MDA were detected using the kits. The cell experiment was repeated three times independently. Data were expressed as mean ± standard deviation, and analyzed using one‐way ANOVA, followed by Tukey’s multiple comparisons test, **p < 0.01.
miR‐128 targeted CREB1
The target genes of miR‐128 were predicted by Starbase, among which CREB1 is involved in neuronal repair.
According to the binding site of miR‐128 and CREB1 3ʹUTR (Fig. 5A), we verified the binding relationship between miR‐128 and CREB1 using dual‐luciferase reporter gene assay (p < 0.05; Fig. 5B). CREB1 promotes the secretion of neurotrophic factors such as BDNF and inhibits neuronal apoptosis.
Therefore, we speculated that CREB1 and BDNF could mediate ARPP21/miR‐128 in the process of neurological function repair after stroke. After overexpression of miR‐128, ARPP21 and CREB1 expressions were decreased notably, and BDNF secretion was reduced (p < 0.01; Fig. 5C). Based on the above results, we speculated that CREB1 and BDNF could mediate ARPP21/miR‐128 in the neurological function repair after stroke.
FIGURE 5
miR‐128 targeted CREB1. (A) The binding site of miR‐128 and CREB1 was predicted by bioinformatics website. (B) The binding relationship between miR‐128 and CREB1 was verified using dual‐luciferase reporter gene assay. (C) Expression of miR‐128 was detected using RT‐qPCR. The cell experiment was repeated three times independently. Data were expressed as mean ± standard deviation and analyzed using one‐way ANOVA, followed by Tukey’s multiple comparisons test, *p < 0.05, **p < 0.01.
miR‐128 targeted CREB1. (A) The binding site of miR‐128 and CREB1 was predicted by bioinformatics website. (B) The binding relationship between miR‐128 and CREB1 was verified using dual‐luciferase reporter gene assay. (C) Expression of miR‐128 was detected using RT‐qPCR. The cell experiment was repeated three times independently. Data were expressed as mean ± standard deviation and analyzed using one‐way ANOVA, followed by Tukey’s multiple comparisons test, *p < 0.05, **p < 0.01.
ARPP21 was downregulated in the brain tissues of MCAO rats
To verify the above hypothesis, we established the rat model of MCAO to observe the expression and localization of ARPP21 in rats. The tissues around the infarcted area were collected on the 3rd, 7th, and 14th day. Immunofluorescence showed that ARPP21 was localized in neurons and astrocytes of rats (Fig. 6A). Western blotting exhibited that the expressions of ARPP21, CREB1, and BDNF were increased gradually (all p < 0.01; Fig. 6B). RT‐qPCR exhibited that miR‐128 expression was decreased (p < 0.01; Fig. 6C). It was indicated that with the enhancement of ARPP21 expression in MCAO rats, the ability of miR‐128 to inhibit CREB1 was weakened, and the increase of CREB1 expression promoted the secretion of BDNF. These results suggested that ARPP21 antagonizing miR‐128 played a vital role in promoting neurological function repair after stroke.
FIGURE 6
ARPP21 was downregulated in the brain tissues of MCAO rats. (A) Expression and localization of ARPP21 in rats were determined using immunofluorescence. (B) Expressions of ARPP21, CREB1, and BDNF were detected using Western blotting. (C) Expression of miR‐128 was detected using RT‐qPCR. N = 18. Data were expressed as mean ± standard deviation, and analyzed using one‐way ANOVA, followed by Tukey’s multiple comparisons test, **p < 0.01.
ARPP21 was downregulated in the brain tissues of MCAO rats. (A) Expression and localization of ARPP21 in rats were determined using immunofluorescence. (B) Expressions of ARPP21, CREB1, and BDNF were detected using Western blotting. (C) Expression of miR‐128 was detected using RT‐qPCR. N = 18. Data were expressed as mean ± standard deviation, and analyzed using one‐way ANOVA, followed by Tukey’s multiple comparisons test, **p < 0.01.
Overexpression of ARPP21 reduced infarct size and alleviated brain injury in rats
We further verified the effect of ARPP21 on MCAO rats in vivo. ARPP21 expression was decreased in MCAO rats, and was promoted by pc‐ARPP21 treatment (p < 0.05; Fig. 7A). The neurologic score was determined by the Bederson’s scale 24 h after modeling. The rats in MCAO + pc‐NC group showed severe neurological deficits, which indicated that the cortical and striatal functions were impaired and the motor and sensory coordination were weakened, while pc‐ARPP21 treatment significantly alleviated the neurobehavioral deficits in MCAO rats (all p < 0.05; Fig. 7B). Compared with the sham‐operated rats, the rats in the MCAO + DMSO group showed increased brain water content, indicating the formation of edema after ischemic stroke, while pc‐ARPP21 treatment decreased the brain water content (p < 0.05; Fig. 7C). TTC and HE staining were performed to evaluate neuronal injury. Compared with the sham‐operated rats, the rats in the MCAO + DMSO group showed increased infarct size, while pc‐ARPP21 treatment reduced the infarct size (all p < 0.05; Fig. 7D/E). The expressions of miR‐128, CREB1, and BDNF were detected using RT‐qPCR. Compared with that in the MCAO + pc‐NC group, the rats in the MCAO + pc‐ARPP21 group showed reduced miR‐128 expression (p < 0.01; Fig. 7F), and increased CREB1 and BDNF mRNA expression (p < 0.01; Fig. 7G). Taken together, overexpression of ARPP21 notably reduced the area of cerebral infarction in MCAO rats and promoted neurological function repair after stroke.
FIGURE 7
Overexpression of ARPP21 reduced infarct size and alleviated brain injury in MCAO rats. pcDNA‐ARPP21 and pcDNA‐NC were transfected into MCAO rats. (A) expression of ARPP21 was detected using RT‐qPCR. (B) Neurologic score was determined by the Bederson’s scale. (C) Analysis of brain edema. (D/E) infarct size was evaluated using TCC and HE staining. (F) Expression of miR‐128 was detected using RT‐qPCR. (G) mRNA expressions of CREB1 and BDNF were detected using RT‐qPCR. N = 18. Data were expressed as mean ± standard deviation, and analyzed using one‐way ANOVA, followed by Tukey’s multiple comparisons test, *p < 0.05, **p < 0.01.
Overexpression of ARPP21 reduced infarct size and alleviated brain injury in MCAO rats. pcDNA‐ARPP21 and pcDNA‐NC were transfected into MCAO rats. (A) expression of ARPP21 was detected using RT‐qPCR. (B) Neurologic score was determined by the Bederson’s scale. (C) Analysis of brain edema. (D/E) infarct size was evaluated using TCC and HE staining. (F) Expression of miR‐128 was detected using RT‐qPCR. (G) mRNA expressions of CREB1 and BDNF were detected using RT‐qPCR. N = 18. Data were expressed as mean ± standard deviation, and analyzed using one‐way ANOVA, followed by Tukey’s multiple comparisons test, *p < 0.05, **p < 0.01.
Discussion
Approximately 87% of strokes result from ischemic injury due to acute disruption of blood supply, and these patients usually present serious neurological deficits.
Nerve development and differentiation are closely related to neurological function repair in ischemic stroke, and ARPP21 can promote neuron differentiation and axon growth.
ARPP21 is a conserved host gene of miR‐128 and transactivates a range of mRNA targets for miR‐128‐mediated silencing.
We illustrated the mechanism of ARPP21 antagonistic intron miR‐128 in neurological function repair after stroke.ARPP21 represents a positive modulator of dendritic growth,
and miR‐128 is an antagonistic intron located in the ARPP21 gene.
ARPP21 can regulate neurodevelopmental function by antagonizing the activity of miR‐128.
,
We speculated that ARPP21 antagonistic intron miR‐128 was implicated in neurological function repair after stroke. ARPP21 and miR‐128 expressions in stroke patients and healthy volunteers were detected. The results exhibited that ARPP21 expression was downregulated and miR‐128 expression was upregulated in stroke patients. Consistently, differential miR expression analysis has exhibited the upregulation of miR‐128 in cerebrospinal fluid of stroke patients, and repression of miR‐128 can reduce cell death and infarct volume.
miR‐128 expression in patients with acute ischemic stroke is elevated with the aggravation of this disease.Neurons are first directly affected by insufficient blood flow due to their inherent high energy requirements.
Astrocytes constitute the most abundant cell type in the central nervous system.
Besides being the source of neuroprotective agents, astrocytes can provide nutrition for neurons, regulate cerebral blood flow, maintain blood‐brain barrier, and regulate extracellular glutamate level.
The activated astrocytes generate neurotrophic factors and take in excessive glutamine, thus protecting neurons and reducing neuron injury.
In the current study, the neurons and astrocytes were cultured in vitro and treated with OGD. The expression of ARPP21 was lower and miR‐128 was higher in OGD‐treated cells than those in control cells. The neurological deficits after stroke are commonly attributed to neuronal apoptosis or dysfunction.
Astrocyte apoptosis also contributes to the pathogenesis of acute or chronic neurodegenerative disorders, including cerebral ischemia stroke.
We transfected pc‐ARPP21 and miR‐128 mimic into OGD‐treated neurons and astrocytes, respectively. Overexpression of ARPP21 enhanced the proliferation and activation of astrocytes, and inhibited apoptosis of neurons and astrocytes, while overexpression of miR‐128 showed the opposite trend. Consistently, suppression of miR‐128 expression has been demonstrated to attenuate Aβ‐induced cytotoxicity
and enhance the neuronal activity in primary mouse cortical neurons.
The critical role of inflammation in stroke during initiation, progression, and recovery has been unveiled,
and anti‐inflammatory therapies can reduce infarct volume and promote cell survival.
As a result of inflammation, oxidative stress also leads to neuronal apoptosis.
Inflammation and oxidative stress are undoubtedly effective intervention targets for stroke.
Elevated miR‐128 expression enhances the expressions of inflammation‐associated genes, pro‐inflammatory cytokines, and fibrosis in normal rat kidney cells.
miR‐128 exacerbates doxorubicin‐induced liver injury by facilitating oxidative stress.
Consistently, we exhibited that overexpression of ARPP21 reduced cell inflammation and alleviated oxidative stress in astrocytes, while overexpression of miR‐128 could also reverse these trends.Then, we shift to investigating the downstream target gene of miR‐128. CREB is demonstrated to mediate neuroprotective effect and CREB silencing leads to the increase of apoptosis after oxidative stress.
CREB family transcription factors represent the primary mediators of BDNF transcriptional self‐regulation in cortical neurons.
BDNF is actively expressed in the brain, which is involved in the regulation of neuronal activity and normal daily functions; importantly, BDNF participates in the recovery of neurological function after stroke.
After overexpression of miR‐128, the expressions of ARPP21 and CREB1 were decreased notably, and the secretion of BDNF was reduced. CREB1 and BDNF might mediate the regulation of ARPP21 and miR‐128 in neurological function repair after stroke.The CREB/BDNF pathway is involved in Aβ‐induced apoptosis
and propofol‐triggered cytotoxicity to primary hippocampal neurons.
BDNF is emerged as a crucial promoter of neuroplasticity implicated in motor learning and rehabilitation after stroke.
The rat model of MCAO was established. With the enhancement of ARPP21 expression in MCAO rats, the ability of miR‐128 to inhibit CREB1 was weakened. The increased CREB1 expression promoted the secretion of BDNF. Briefly, ARPP21 antagonizing miR‐128 played a vital role in promoting neurological function repair after stroke. Moreover, we conducted in vivo experiments to further verify the effect of ARPP21 on MCAO rats. Overexpression of ARPP21 reduced neurobehavioral deficits, brain water content, and infarct size in MCAO rats. Additionally, overexpression of ARPP21 decreased miR‐128 expression and promoted CREB1 and BDNF mRNA expressions in MCAO rats.To sum up, ARPP21 antagonized intron miR‐128 and increased the expressions of CREB1 and BDNF in neurons and astrocytes, thus facilitating neurological function repair after stroke. This study may hint a potential target for the clinical diagnosis and treatment of ischemic stroke. This study simply revealed that ARPP21 antagonistic intron miR‐128 played a role in neural repair after stroke, but the mechanism of ARPP21 antagonistic intron miR‐128 in the clinical treatment of stroke remained in‐depth exploration. Moreover, the selected clinical sample size was small and did not show a significant difference, and this study failed to conduct the in‐depth study on the correlation of NIHSS in stroke patients. In future researches, we shall look for effective targets for the development of stroke prevention and treatment measures.
Conflicts of Interest
All authors declare that there is no conflict of interest in this study.
Ethics Statement
This study got the permission of the Ethical Committee of the First Affiliated Hospital of Zhejiang University (2018‐642). Informed consent was signed by each eligible participant. All the laboratory procedures were applied to reduce the pain of the rats, such as heating pads, disinfection, and fluid replenishment with normal saline.
Authors: Si Zhang; Odysseus Zis; Philip T T Ly; Yili Wu; Shuting Zhang; Mingming Zhang; Fang Cai; Richard Bucala; Woei-Cherng Shyu; Weihong Song Journal: FASEB J Date: 2014-06-26 Impact factor: 5.191