Literature DB >> 34037097

MET overexpression and intratumor heterogeneity in esophageal squamous cell carcinoma.

H S Abboud1, D Camuzi1, D C Rapozo2, P V Fernandes2, P Nicolau-Neto1, S Guaraldi1, T A Simão3, L F Ribeiro Pinto1,3, I M Gonzaga1, S C Soares-Lima1.   

Abstract

Esophageal squamous cell carcinoma (ESCC) is among the ten most frequent and deadly cancers, without effective therapies for most patients. More recently, drugs targeting deregulated growth factor signaling receptors have been developed, such as HGF-MET targeted therapy. We assessed MET and HGF genetic alterations and gene and protein expression profiles in ESCC patients from the Brazilian National Cancer Institute and publicly available datasets, as well as the intratumor heterogeneity of the alterations found. Our analyses showed that HGF and MET genetic alterations, both copy number and mutations, are not common in ESCC, affecting 5 and 6% of the cases, respectively. HGF showed a variable mRNA expression profile between datasets, with no alterations (GSE20347), downregulation (GSE45670), and upregulation in ESCC (our dataset and GSE75241). On the other hand, MET was found consistently upregulated in ESCC compared to non-tumor surrounding tissue, with median fold-changes of 5.96 (GSE20347), 3.83 (GSE45670), 6.02 (GSE75241), and 5.0 (our dataset). Among our patients, 84% of the tumors showed at least a two-fold increase in MET expression. This observation was corroborated by protein levels, with 55% of cases exhibiting positivity in 100% of the tumor cells. Intratumor heterogeneity was evaluated in at least four tumor biopsies from five patients and two cases showed a consistent increase in MET expression (at least two-fold) in all tumor samples. Our data suggested that HGF-MET signaling pathway was likely to be overactivated in ESCC, representing a potential therapeutic target, but eligibility for this therapy should consider intratumor heterogeneity.

Entities:  

Mesh:

Substances:

Year:  2021        PMID: 34037097      PMCID: PMC8148886          DOI: 10.1590/1414-431X2020e10877

Source DB:  PubMed          Journal:  Braz J Med Biol Res        ISSN: 0100-879X            Impact factor:   2.590


Introduction

Esophageal cancer (EC) is among the most frequent and lethal malignancies in the world, ranking seventh in incidence and sixth in mortality among men (1). This tumor is classified into two histological subtypes: esophageal squamous cell carcinoma (ESCC) and adenocarcinoma. ESCC accounts for approximately 80% of EC cases and has the highest incidence rates in developing countries, such as Brazil. The high lethality of esophageal cancer is associated with a late diagnosis. Neoadjuvant chemoradiotherapy followed by surgery is the gold-standard treatment for this type of cancer (2), but most patients may not be eligible for this modality due to advanced disease and comorbidities (3). Also, radiotherapy and conventional chemotherapy based on taxane and platinum regimens are ineffective in most cases, commonly showing only a palliative role (4). Therefore, the development of new therapeutic strategies is crucial to improve patients' prognosis. In recent years, new therapeutic approaches mainly targeting growth factor receptors have been developed for cancer and have shown very positive results for some types of tumors, such as breast and colorectal tumors (5,6). In this context, new strategies are of major interest to improve ESCC treatment and the hepatocyte growth factor (HGF)-MET axis is a promising target. Physiologically, HGF acts as a cytokine and pleiotropic factor that binds to MET, leading to the receptor homodimerization and transphosphorylation of tyrosine residues, present in the intracellular portion of the receptor. As a result, multi-pathway activation takes place and regulates cell proliferation, survival, motility, differentiation, and morphogenesis (7). MET alterations have already been reported in ESCC, including both gene (8) and protein overexpressions (9,10). Moreover, studies have associated MET expression with a poor recurrence-free survival as well as finding it to be an independent predictor of overall survival in ESCC (9,10). Finally, in vitro studies have shown that HGF and MET pharmacological inhibition not only reduces the ability of transformed esophageal cells to invade the extracellular matrix but also prompts cell apoptosis and G2/M arrest induced by irradiation (11,12). These findings highlight the potential of HGF/MET-targeted therapies to improve ESCC patients' prognosis. Although the HGF-MET axis represents a promising target, some barriers for therapy response need to be considered, especially the intratumor heterogeneity, which includes morphological and genetic alterations in different regions of the same tumor mass (13). Cao and colleagues evaluated the mutation profile of patients with ESCC using exome sequencing and comparative array hybridization and described an intratumor heterogeneity rate of 90% (14). However, until this moment no study evaluating HGF-MET dysregulation in ESCC in Occidental populations has been conducted and the intratumor variation of MET expression has never been evaluated.

Material and Methods

In silico copy number and mutational analysis

MET and HGF copy number alterations and mutational profiles were obtained from The Cancer Genome Atlas project on esophageal cancer (TCGA, Firehose Legacy). For this, the cBioPortal platform (The cBio Cancer Genomics Portal; http://www.cbioportal.org) was assessed and only ESCC cases (n=96) were selected. The OncoPrint chart with copy number alterations and mutations per sample was generated and downloaded.

In silico microarray analysis

The Gene Expression Omnibus (GEO) database (http://www.ncbi.nlm.nih.gov/geo/) was assessed and three studies including global gene expression data on esophageal squamous cell carcinoma samples and non-tumor surrounding tissues were selected. Raw .CEL files were downloaded from GEO accession numbers: GSE20347 (17 non-tumor and 17 tumor samples) and GSE45670 (8 non-tumor and 28 tumor samples), and GSE75241 (15 non-tumor and 15 tumor samples). The studies used the Affymetrix Human Genome U133 Plus 2.0 Array platform or Affymetrix Human Exon 1.0 ST Array platforms and were processed individually using the software Affymetrix Transcriptome Analysis Console 4.0 (Thermo Fisher Scientific, USA). Summarization was performed by robust multi-array average (RMA) algorithm and gene expression levels by ANOVA (FDR<0.05).

Human samples

Sixty-six patients with a confirmed diagnosis of ESCC treated at the Brazilian National Cancer Institute (INCA) were included in this study. Fresh-frozen samples (tumor biopsy with at least 70% of tumor cells and adjacent non-tumor biopsy 5 cm from the tumor border) were collected from 37 patients and stored at the National Tumor Bank of INCA (BNT/INCA). Tumor and non-tumor formalin-fixed paraffin-embedded (FFPE) samples were obtained from 29 patients. Fresh-frozen and FFPE samples were from different patients. No patient had undergone chemo- or radiotherapeutic treatment before sample collection. For the analysis of intratumor heterogeneity, biopsies were collected from five patients submitted to endoscopy at INCA. Two fragments (superficial and profound) were collected from three different regions of the tumor mass: proximal, medial, and distal areas. In addition, two biopsies of adjacent non-tumor tissue were collected 5 cm from the tumor border whenever possible, from proximal and distal esophagus. The study was approved by INCA's ethics committee and followed the guidelines of the Declaration of Helsinki.

RNA isolation and RT-qPCR

Total RNA was extracted using the RNeasy Plus mini kit (QIAGEN, Germany), following the manufacturer's instructions. All samples were quantified by spectrophotometry and purity was verified by calculating the absorbance ratio of 260/280 nm and ensuring it was ≥1.7. A total of 500 ng of RNA was reverse transcribed using SuperScript II® (Invitrogen, USA) following the manufacturer's protocol. The Rotor-Gene Q system (QIAGEN) and QuantiFast SYBR Green PCR Kit (QIAGEN) were used for qPCR, and each reaction was optimized for the specific primers to evaluate the mRNA expression of MET, forward: 5′ TTTATTAGTGGTGGGAGCACA 3′, reverse: 5′ TGACATGCCACTGTAAAGTTCC 3′; HGF, forward: 5′ TCAGCAAAGACTACCCTAATCAA 3′, reverse: 5′ CAAAAGCCTTGCAAGTGAATGG 3′; and GAPDH (as reference gene), forward: 5′ CAACAGCCTCAAGATCATCAGCAA 3′, reverse: 5′ AGTGATGGCATGGACTGTGGTCAT 3′. Each reaction contained QuantiFast SYBR Green Buffer 1X (QIAGEN), 0.5 mM of forward and reverse primers, and sterile deionized water to complete the final volume of 10 µL. After the reaction, the expression of MET and HGF was normalized with GAPDH expression, using the comparative Ct method (15). The number of paired samples varied for each gene evaluation due to the limited amount of available cDNA. Regarding the intratumor heterogeneity analysis, when more than one non-tumor surrounding tissue (NTST) biopsy was available, the mean expression of all non-tumor tissues was used to calculate the expression fold-change in tumors.

Immunohistochemistry

Freshly cut 4-μm sections of each paraffin block of 22 ESCC samples and 19 NTST were used to perform immunohistochemistry using primary antibody against MET (EP1454Y, Abcam®, USA). Antigen retrieval was performed in a water bath while slides were submerged in citrate buffer, pH 6.0, for 40 min at 98°C. The detection was performed following the supplier's recommendations for Novolink™ Max Polymer Detection System (Leica, UK). Samples from lung adenocarcinoma were used as a positive control of MET expression. In the negative control, the primary antibody was replaced with the antibody diluent solution. Digital images were captured using the Aperio ScanScope CS Slide Scanner (Aperio Technologies, USA) under 20× objective magnification (0.5 μm resolution). An expert pathologist selected the tumor areas using ImageScope software suite (Aperio Technologies). The digital image analysis was performed on whole slide images with Aperio Membrane V9 algorithms (Aperio Technologies). The quantification was done automatically, after algorithm calibration by an experienced observer, and results are reported for MET immunohistochemistry (IHC) as scores from 0 to 3+, and positive tumor cell was defined at the membrane completeness between scores 1 to 3.

Statistical analysis

All statistical analyses were performed using GraphPad Prism 5 software version 5.02 for Windows (GraphPad Software, USA). Differences were considered statistically significant when P<0.05. Data distribution was assessed by the Kolmogorov-Smirnov normality test. For parametric distributions, ANOVA and paired or unpaired t-tests were used. Data with nonparametric distributions were compared using the Mann-Whitney, Wilcoxon, or Kruskal-Wallis test.

Results

HGF and MET alterations through in silico analysis

The overexpression of growth factor receptors in tumors can be associated with gene amplification and other genetic alterations, so we initially evaluated the copy number and mutational profiles of MET and HGF in ESCC by assessing TCGA publicly available data (n=96). In total, HGF genetic alterations were identified in five patients (5%), with four cases showing gene amplification and one showing a missense mutation of unknown significance (NP_00592.3:p.Arg261Leu); while for MET, these numbers were four and two (NP_000236.2:p.Ala327Thr and NP_000236.2:p.Gly672Asp), respectively, totaling six patients (6%) carrying genetic alterations (Figure 1A).
Figure 1

Hepatocyte growth factor (HGF) and MET molecular alterations in publicly available datasets. A, OncoPrint chart showing copy number alterations and mutations identified in esophageal squamous cell carcinoma (ESCC) cases from TCGA Firehose Legacy study. Each bar represents a case. B, Boxplots showing the expression profile of HGF (probe 209960_at or 3058944) and MET (probe 203510_at or 3020343) in three publicly available datasets of ESCC samples and non-tumor surrounding tissues (NTST) (GSE20347, GSE45670, and GSE75241). Datasets GSE20347 and GSE45670 used Affymetrix Human Genome U133 Plus 2.0 and dataset GSE75241 used Affymetrix Human Exon 1.0 ST Array. Data are reported as medians and interquartile range. *FDR<0.05 (ANOVA).

Since genetic alterations were not common in the HGF/MET axis, we evaluated their gene expression profiles in three independent public datasets. All studies showed consistent MET overexpression in tumors compared with non-tumor surrounding tissue (fold-change=5.96 in GSE20347; fold-change=3.83 in GSE45670; fold-change=6.02 in GSE75241) (Figure 1B). No significant alterations were observed for HGF in GSE20347 dataset, while GSE45670 showed HGF downregulation in tumors relative to non-tumor surrounding tissue (fold-change=-3.72), and GSE75241 presented HGF overexpressed in ESCC patients (fold-change=2.11) (Figure 1B). Therefore, the next step was to evaluate the expression of these genes in a Brazilian cohort of ESCC patients.

Patient characteristics

The median age of the patients included in this study was 59.5 years, varying between 40 and 79 years (Table 1). Most of the patients were male (75.8%), ever drinkers (72.7%), and/or ever smokers (78.8%). Tumors affected more frequently the middle third of the esophagus (30.3%), were moderately differentiated (74.2%), and half of patients had tumors diagnosed at early stages (50%). The median overall survival was 9.57 months (0.63 to 165.2 months).
Table 1

Social-demographic and clinical-pathologic characteristics of the esophageal squamous cell carcinoma (ESCC) cases included in the study.

CharacteristicsESCC patients, n (%)
Age (median, min-max)59.5 (40-79)
Gender
Female16 (24.2%)
Male50 (75.8%)
Tobacco smoking
Never6 (9.1%)
Ever52 (78.8%)
Missing8 (12.2%)
Alcohol drinking
Never7 (10.6%)
Ever48 (72.7%)
Missing12 (16.7%)
Tumor location in the esophagus
Upper third12 (18.2%)
Middle third20 (30.3%)
Lower third19 (28.8%)
More than one third15 (22.7%)
Tumor differentiation
In situ 1 (1.5%)
Well1 (1.5%)
Moderately49 (74.2%)
Poorly12 (18.2%)
Missing3 (4.5%)
Tumor stage
0 + I + II33 (50%)
III + IV26 (39.4%)
Missing7 (10.6%)
Survival in months (median, min-max)9.57 (0.63-165.2)
Techniques performed
IHC29 (43.9%)
RT-qPCR37 (56.1%)

IHC, immunohistochemistry; RT-qPCR: reverse transcription followed by quantitative polymerase chain reaction.

IHC, immunohistochemistry; RT-qPCR: reverse transcription followed by quantitative polymerase chain reaction. Patient information was available in part of the public datasets used for in silico analyses (GSE45670, GSE75241, and TCGA). The median age was 56.5, 60.5, and 57, the most prevalent gender was male (89, 67, and 84%), while the frequency for early diagnosed tumors was 29, 20, and 66% in the GSE45670, GSE75241, and TCGA, respectively.

HGF and MET gene expressions in fresh esophageal samples

The analysis of 24 paired samples showed a higher expression of HGF in tumors compared with their respective non-tumor surrounding tissue (P=0.015, Figure 2A). The median fold-change between groups was 2.23 (0.29-18.96), with 58% of tumors presenting at least a two-fold increase in HGF expression. We also observed MET overexpression in ESCC samples in a set of 37 patients (P<0.0001, Figure 2B). The median fold-change for MET expression was 5.0 (0.23-27.67), and 83.78% of the cases presented at least a two-fold increase in MET expression.
Figure 2

Gene expression of HGF-MET axis in fresh samples from esophageal squamous cell carcinoma (ESCC) patients. A, Box-plot showing HGF mRNA expression in tumors and non-tumor surrounding tissues (NTST) from 24 ESCC patients. B, Box-plot showing MET mRNA expression in tumors and NTST from 37 ESCC patients. Data are reported as medians and interquartile range (Wilcoxon test). C, Bar graphs showing MET mRNA fold-change in each tumor biopsy of five patients with respect to the mean MET mRNA expression in NTST.

No statistically significant associations between HGF (data not shown) and MET expression (Supplementary Table 1) and patient socio-demographic and clinical-pathologic data such as age, gender, tumor location, differentiation, and stage were observed. Furthermore, MET expression showed no impact on overall survival (data not shown). Next, we assessed MET expression in samples obtained from different tumor regions of five patients, including superficial and profound biopsies. Two out of five patients showed MET overexpression (at least two-fold change) in all tumor regions. The other three patients demonstrated a heterogeneous pattern, including some tumor areas with a reduction in MET expression compared with NTST (Figure 2C).

MET protein immunostaining

MET protein immunostaining was also evaluated in tumor tissues from 22 ESCC patients and NTST from 19 patients, as shown in Figure 3A-E. In all samples, staining was mainly detected in the cell membrane. Among NTST samples, 15 (78.9%) showed MET positive staining, which was mainly observed in the basal and suprabasal layers of the epithelium (Figure 3B). A total of 17 ESCC patients (77.3%) showed positive MET immunostaining in the cell membrane, from which 12 (54.5%) showed positivity in 100% of the tumor cells (Figure 3D-E). The remaining five ESCC samples (22.7%) were negative for MET immunostaining (Figure 3C). Overall, there was a significant increase in MET protein positivity in ESCC (P=0.0042, Figure 3F). No significant associations between the percentage of MET positive cells and socio-demographic and clinical-pathologic data were observed (Supplementary Table 2).
Figure 3

MET immunostaining in esophageal squamous cell carcinoma (ESCC). Representative slides showing a MET-negative (A) and a MET-positive (B) non-tumor surrounding tissue (NTST) sample, and a MET-negative ESCC sample (C). D and E, Representative slides showing MET-positive ESCC samples that showed membrane staining in 100% of the tumor cells. Scale bars, 100 μm. F, Dot-plot showing the percentage of positive cells for MET membrane staining in the NTST (n=22) and ESCC samples (n=25). Data are reported as mean±SD (Mann Whitney test).

Discussion

The search for molecular targets is a crucial step to improve and design new therapeutic strategies for cancer types that still rely on conventional chemotherapy as the main therapeutic approach, despite its low efficacy. This is the scenario observed in ESCC, a highly frequent and lethal disease, for which the highest incidence rates are observed in some of the most populous countries in the world, such as China, India, and Brazil (1). Identifying new potential therapeutic targets for ESCC could result in a benefit to a large number of patients, especially from low- and middle-income countries. Currently, the gold-standard treatment for ESCC is neoadjuvant chemoradiotherapy, followed by surgery (2). However, many of the patients are not eligible for surgery due to several factors such as high Performance Status (ECOG-PS), nutritional deficiency, high surgical risk, and advanced disease. Consequently, many patients undergo palliative treatment using chemotherapy and/or radiotherapy (4). Furthermore, few studies on targeted-therapy are being conducted on ESCC, with the focus on epidermal growth factor receptor (EGFR) (16,17). However, recent data have shown that EGFR alterations, both mutations and protein overexpression, are not common events in ESCC, which may hamper the success of this therapeutic approach (18,19). In this study, we focused on the evaluation of alterations in the expression of the HGF-MET axis in ESCC, one of the spotlight targets for gastrointestinal (GI) cancer, due to its overexpression in 10 to 70% of different GI tumors (20 –22). The HGF-MET axis orchestrates cell morphology and wound healing in a physiological state, but in cancer, it regulates crucial pathways for tumor growth and metastasis through Ras-MAPK, PI3K, FAK-Src, and STAT3 signaling (7). Alterations in HGF and MET expression are commonly reported in different types of cancers such as non-small cell lung cancer (NSCLC), GI tumors, and hepatocellular cancer (HCC) (23,24). The widespread alterations of the HGF-MET axis boosted the search for their inhibitors in the past decade, which led to FDA approval of two tyrosine kinase inhibitors (TKIs), Crizotinib for non-small cell lung cancer and Cabozantinib for renal cell cancer and medullary thyroid cancer, both capable of inhibiting the altered MET protein activity (25). HGF overexpression is reported in GI tumors and is associated with worse outcomes (22,26). Similar to gastric and colorectal cancer, HGF overexpression was observed in almost 60% of the Brazilian ESCC cases from the present study, but it was not associated with patient clinical or pathological features. However, in the two datasets including Chinese patients analyzed here, HGF dysregulation was discrepant, either showing no alterations or downregulation in ESCC. These data, together with the low HGF amplification frequency reported here, suggest that HGF is not commonly upregulated in ESCC. On the other hand, different studies have reported MET overexpression in ESCC, both at gene and protein levels. These observations were corroborated by our findings in an Occidental and in an Oriental population. However, this does not seem to be triggered by copy number gains since MET amplification frequency was low in TCGA dataset (6%), as previously described by other authors (ranging from 1-11%) (27 –29). However, MET was also described to be regulated by other mechanisms, such as the hypomethylation of its promoter in pancreatic cancer, and more than 30 microRNAs regulating MET expression, including miR-34a, downregulated in ESCC (30 –32). In our Brazilian cohort, MET overexpression was highly common, present in 80% of the patients, confirmed by protein immunostaining. MET detection in all tumor cells from more than 50% of the cases agreed with previous reports that showed MET protein overexpression in approximately 45% of ESCC samples (33,34), indicating that MET is a potential therapeutic target for ESCC patients. However, the failure of MET inhibitors in clinical trials for GI cancer, including MET-positive patients, raised a great deal of distrust about its effectiveness (35). Intratumor heterogeneity might explain, at least in part, these poor results. These trials in GI used a high-score IHC based on ≥50% positive tumor cells, or even ≥25% membrane staining in cancer cells, which still show a predominant heterogeneous pattern in the tumor (12,36,37). It is important to note that patients who present better outcomes in clinical trials with MET inhibitors usually harbor extremely high levels of MET expression (36,38). Also, most cancer treatments are chosen based on a diagnosis from a single biopsy, but recent evidence suggests that tumors are highly heterogeneous not only with respect to microenvironment but also to tumor clones carrying different molecular alterations (39). As a consequence, the development of biomarkers guided by a single biopsy and the use of heterogeneous patterns to classify positive IHC cases may be responsible for the recently reported failures in the implementation of promising therapies in the clinical setting (40). Thus, in the present study, we evaluated the intratumor heterogeneity of MET expression through the analysis of biopsies from different tumor regions. When considering the mean expression levels of all tumor biopsies, all patients showed at least a two-fold increased expression in ESCC compared with non-tumor surrounding tissue, but only two out of five cases presented increased expression of MET in all individual regions of the tumor. The intratumor patterns of MET expression could be an important element to determine a successful response to targeted therapy or to predict possible tumor relapse after treatment and should be better investigated during clinical trials aiming the use of anti-MET drugs in ESCC patients. Thus, a selection of patients based not only on IHC scores, but also on other evidence of MET upregulation has been proposed (24). These arguments together with our data suggest an approach in which ESCC patients with a homogenous overexpression of MET, showing complete IHC positiveness in cancer cells and high MET expression in different regions of the tumor mass, would be more likely to respond to anti-MET drugs.

Conclusions

Our study showed a high frequency of MET overexpression in ESCC patients, both in mRNA and protein levels. However, MET intratumoral expression patterns were heterogeneous, suggesting this should be considered among eligibility criteria if anti-MET therapy is applied to those cases in addition to IHC analysis. Furthermore, other studies are indispensable to test the potential efficacy of MET-inhibitors in pre-clinical settings with patient-derived xenografts (PDX)-models involving cases with a homogenous MET upregulation. Finally, it is important to highlight that all clinical trials with MET inhibitors on esophageal cancer included mostly adenocarcinoma cases, making ESCC an unexplored field.
  40 in total

1.  Molecular co-expression of the c-Met oncogene and hepatocyte growth factor in primary colon cancer predicts tumor stage and clinical outcome.

Authors:  Udai S Kammula; Eleanor J Kuntz; Todd D Francone; Zhaoshi Zeng; Jinru Shia; Ron G Landmann; Philip B Paty; Martin R Weiser
Journal:  Cancer Lett       Date:  2006-09-01       Impact factor: 8.679

2.  A phase 2 and biomarker study of cabozantinib in patients with advanced cholangiocarcinoma.

Authors:  Lipika Goyal; Hui Zheng; Matthew B Yurgelun; Thomas A Abrams; Jill N Allen; James M Cleary; Michelle Knowles; Eileen Regan; Amanda Reardon; Anna Khachatryan; Rakesh K Jain; Valentina Nardi; Darrell R Borger; Dan G Duda; Andrew X Zhu
Journal:  Cancer       Date:  2017-02-13       Impact factor: 6.860

3.  Icotinib in Patients with Pretreated Advanced Esophageal Squamous Cell Carcinoma with EGFR Overexpression or EGFR Gene Amplification: A Single-Arm, Multicenter Phase 2 Study.

Authors:  Jing Huang; Qingxia Fan; Ping Lu; Jianming Ying; Changwu Ma; Wei Liu; Ying Liu; Fenlai Tan; Yan Sun
Journal:  J Thorac Oncol       Date:  2016-03-12       Impact factor: 15.609

4.  Co-expression of hepatocyte growth factor and c-Met predicts peritoneal dissemination established by autocrine hepatocyte growth factor/c-Met signaling in gastric cancer.

Authors:  Yuji Toiyama; Hiromi Yasuda; Susumu Saigusa; Kouhei Matushita; Hiroyuki Fujikawa; Koji Tanaka; Yasuhiko Mohri; Yasuhiro Inoue; Ajay Goel; Masato Kusunoki
Journal:  Int J Cancer       Date:  2011-09-12       Impact factor: 7.396

Review 5.  Pre- and postoperative treatment modalities for esophageal squamous cell carcinoma.

Authors:  Christiane M R Thallinger; Barbara Kiesewetter; Markus Raderer; Michael Hejna
Journal:  Anticancer Res       Date:  2012-11       Impact factor: 2.480

Review 6.  Targeted therapy for metastatic colorectal cancer.

Authors:  Timothy J Price; Monica Tang; Peter Gibbs; Daniel G Haller; Marc Peeters; Dirk Arnold; Eva Segelov; Amitesh Roy; Niall Tebbutt; Nick Pavlakis; Chris Karapetis; Matthew Burge; Jeremy Shapiro
Journal:  Expert Rev Anticancer Ther       Date:  2018-08-03       Impact factor: 4.512

Review 7.  The miR-34 family in cancer and apoptosis.

Authors:  H Hermeking
Journal:  Cell Death Differ       Date:  2009-05-22       Impact factor: 15.828

8.  c-Met in esophageal squamous cell carcinoma: an independent prognostic factor and potential therapeutic target.

Authors:  Yohei Ozawa; Yasuhiro Nakamura; Fumiyoshi Fujishima; Saulo J A Felizola; Kenichiro Takeda; Hiroshi Okamoto; Ken Ito; Hirotaka Ishida; Takuro Konno; Takashi Kamei; Go Miyata; Noriaki Ohuchi; Hironobu Sasano
Journal:  BMC Cancer       Date:  2015-06-03       Impact factor: 4.430

9.  Alterations in epidermal growth factor receptors 1 and 2 in esophageal squamous cell carcinomas.

Authors:  Isabela Martins Gonzaga; Sheila Coelho Soares-Lima; Paulo Thiago Souza de Santos; Tania Cristina Moita Blanco; Bruno Souza Bianchi de Reis; Danielle Carvalho Quintella; Ivanir Martins de Oliveira; Paulo Antonio Silvestre de Faria; Cleber Dario Pinto Kruel; Nelson Adami Andreollo; Tatiana Almeida de Simão; Luis Felipe Ribeiro Pinto
Journal:  BMC Cancer       Date:  2012-12-04       Impact factor: 4.430

10.  Multiple region whole-exome sequencing reveals dramatically evolving intratumor genomic heterogeneity in esophageal squamous cell carcinoma.

Authors:  W Cao; W Wu; M Yan; F Tian; C Ma; Q Zhang; X Li; P Han; Z Liu; J Gu; F G Biddle
Journal:  Oncogenesis       Date:  2015-11-30       Impact factor: 7.485

View more
  2 in total

1.  Radiosensitizing effect of c-Met kinase inhibitor BPI-9016M in esophageal squamous cell carcinoma cells in vitro and in vivo.

Authors:  Chenxue Jiang; Shuiyun Han; Xiaojiang Sun; Yaping Xu; Jianguo Feng; Jinbiao Shang
Journal:  Ann Transl Med       Date:  2021-12

2.  MiR-300 Alleviates Cell Proliferation and Migration and Facilitates Cell Apoptosis by Targeting c-Met in Gastric Cancer.

Authors:  Xiaoyan Wang; Lian He; Yan Wang; Yunyun Liu; Yuxin Wang; Dandan Chen; Dandan Gong; Yu Fan
Journal:  J Oncol       Date:  2022-04-04       Impact factor: 4.375

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.