Literature DB >> 34029331

Reduced CXCL1 production by endogenous IL-37 expressing dendritic cells does not affect T cell activation.

M Kouwenberg1, W P C Pulskens1, L Diepeveen1, M Bakker-van Bebber1, C A Dinarello2,3, M G Netea2, L B Hilbrands1, J van der Vlag1.   

Abstract

The dendritic cell (DC)-derived cytokine profile contributes to naive T cell differentiation, thereby directing the immune response. IL-37 is a cytokine with anti-inflammatory characteristics that has been demonstrated to induce tolerogenic properties in DC. In this study we aimed to evaluate the influence of IL-37 on DC-T cell interaction, with a special focus on the role of the chemokine CXCL1. DC were cultured from bone marrow of human IL-37 transgenic (hIL-37Tg) or WT mice. The phenotype of unstimulated and LPS-stimulated DC was analyzed (co-stimulatory molecules and MHCII by flow cytometry, cytokine profile by RT-PCR and ELISA), and T cell stimulatory capacity was assessed in mixed lymphocyte reaction. The role of CXCL1 in T cell activation was analyzed in T cell stimulation assays with anti-CD3 or allogeneic DC. The expression of the co-stimulatory molecules CD40, CD80 and CD86, and of MHCII in LPS-stimulated DC was not affected by endogenous expression of IL-37, whereas LPS-stimulated hIL-37Tg DC produced less CXCL1 compared to LPS-stimulated WT DC. T cell stimulatory capacity of LPS-matured hIL-37Tg DC was comparable to that of WT DC. Recombinant mouse CXCL1 did not increase T cell proliferation either alone or in combination with anti-CD3 or allogeneic DC, nor did CXCL1 affect the T cell production of interferon-γ and IL-17. Endogenous IL-37 expression does not affect mouse DC phenotype or subsequent T cell stimulatory capacity, despite a reduced CXCL1 production. In addition, we did not observe an effect of CXCL1 in T cell proliferation or differentiation.

Entities:  

Year:  2021        PMID: 34029331      PMCID: PMC8143410          DOI: 10.1371/journal.pone.0251809

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Interleukin-37 (IL-37), a member of the IL-1 cytokine family, is a cytokine with strong anti-inflammatory properties [1]. In humans, IL-37 is expressed by different (immune) cell types upon stimulation, among which plasma cells, tissue macrophages, blood monocytes, dendritic cells, circulating B cells, natural killer cells, CD4+ T cells and regulatory T cells [2-4]. In contrast to other IL-1 cytokine family members, IL-37 is not expressed in mice, although murine cells react to the human cytokine, suggesting the presence of IL-37 receptors and potentially a functional counterpart. Since the murine orthologue of IL-37 is unknown, the anti-inflammatory potential of IL-37 has been investigated in transgenic mice, overexpressing the human IL-37 (hIL-37Tg). In these hIL-37Tg mice, IL-37 appeared capable to reduce morbidity in a wide spectrum of experimental inflammatory [5-15] and auto-immune [16, 17] conditions. The inhibitory effects of IL-37 on inflammatory processes involve both innate as well as adaptive immune cell responses. Dendritic cells (DC) are professional antigen presenting cells and crucial in naive T cell activation and differentiation, thereby shaping adaptive immunity. There are three levels of DC-derived signals that direct the T cell response and are involved in the balance between tolerance and immunity: the presentation of the MHC-antigen complex to the T cell receptor, the expression of co-stimulatory molecules, and the local cytokine milieu. Tolerogenic DC, characterized by a low expression of co-stimulatory molecules and an anti-inflammatory cytokine profile, can induce the generation of regulatory T cells [18], and are promising therapeutic targets in transplantation and autoimmune disease. By genetic manipulation or pharmacological interference during DC culture, attempts have been made to create tolerogenic DC producing low amounts of pro-inflammatory cytokines (e.g. IL-12) and high amounts of anti-inflammatory cytokines (e.g. IL-10, TGF-β). Based on the strong anti-inflammatory properties of IL-37, (increased) IL-37 expression in DC could result in a tolerogenic phenotype. Indeed, mouse DC expressing human IL-37 were shown to acquire a tolerogenic phenotype upon stimulation with LPS, with reduced expression of MHCII and co-stimulatory molecules, a reduced production of pro-inflammatory cytokines, and an increased production of anti-inflammatory cytokines [5, 11, 19]. Moreover, these DC reduced the allogeneic proliferative T cell response and increased the induction of regulatory T cells, compared to WT DC [11]. Based on aforementioned results we aimed to investigate the role of IL-37 in DC–T cell interaction in more detail. After observing a significantly lower production of CXCL1 in LPS-stimulated bone marrow derived hIL-37Tg DC as compared to WT DC, we focused especially on the role of CXCL1 in DC–T cell interaction.

Material & methods

Mice

Wild type C57Bl/6J and Balb/cAnNCrl male mice of 8–10 weeks old were obtained from Charles River (Maastricht, the Netherlands). Mice transgenic for human Interleukin-37 (hIL-37Tg) were created as described previously [5] and bred and housed under specific pathogen-free conditions in the animal facility of the Radboud university medical center in Nijmegen. Transgenic expression of IL-37 was confirmed by standard genotyping protocols on ear tissue samples. All mice received water and food ad libitum, and only age- and sex-matched mice were included in experiments. All animal experiments were carried out following the guidelines of local and national Animal Ethics Committees and after permission granted by the Animal Ethics Committee of the Radboud University Nijmegen (Permit Number 2011–024). Mice were sacrificed by cervical dislocation.

Isolation and maturation of primary dendritic cells

For isolation and culture of primary cells, wild type and hIL-37Tg mice were sacrificed at age of 8–12 weeks. Isolation and culturing of bone marrow-derived DC in the presence of GM-CSF was performed as described in detail before [20-22]. DC were matured by addition of prototype TLR-agonists (100 ng/ml LPS (from Escherichia coli, O111:B4), 1 μg/ml Pam3CSK, 1.3 μg/ml CpG ODN1826 or 1.3 μg/ml control ODN1826 (all from Invivogen, Carlsbad, USA)) for 24hrs. Control cells were treated with vehicle (PBS) to maintain an immature phenotype. Thereafter, cells were collected and either used in co-culture with T cells, or centrifuged in order to pellet cells for subsequent flow cytometry analysis and RNA isolation. Supernatant was harvested for subsequent ELISA measurements.

Cell staining and flow cytometry

For cell staining and subsequent flow cytometric analysis, DC were harvested after 9 days of culture and subsequently stained, as previously described in detail [22, 23]. Cells were incubated with hamster-anti-mouse CD11c Alexa-647 antibodies (clone N418; diluted 1:100; AbD Serotec Kidlington, UK), in conjunction with either PE-labeled rat-anti-mouse CD40 IgG2a antibodies (clone FGK45.5; diluted 1:40; MACS, Miltenyi Biotec GmbH, Gladbach, Germany), or PE-labeled rat-anti-mouse CD86 IgG2b antibodies (clone PO3.1; diluted 1:80; eBioscience, Vienna, Austria), or PE-labeled Armenian hamster-anti-mouse CD80 IgG antibodies (clone 16-10A1, Biolegend, Fell, Germany), or PE-labeled rat-anti-mouse MHCII IgG2b antibodies (clone M5/114.15.2, eBioscience). The degree of staining was determined by flow cytometry (FC 500, Beckman Coulter, CA, USA) and analyzed using CFX software package (Beckman Coulter).

Proliferation assay and mixed lymphocyte reaction

For both proliferation assay and mixed lymphocyte reaction (MLR), T cells (responder cells in MLRs) were obtained from Balb/c mice by mashing the spleen through a sterile, stainless 70 μm filter (Corning Inc., Corning, USA). Erythrocytes were lysed by Ammonium-Chloride-Potassium lysing buffer. T cells were 80–85% enriched from total splenocytes by depletion of MHCII-positive cells by magnetic cell sorting (MACS) using anti-MHCII magnetic beads and LS columns (Miltenyi Biotech GmbH, Bergisch Gladbach, Germany). Enriched T cells were intracellularly labeled with CFSE (Molecular Probes, Life Technologies Ltd, Paisley, UK) according to the manufacturer’s instructions. For T cell proliferation assay, 96 well round bottom plates (Corning Incorporated, Tewksbury, USA) were overnight coated with αCD3ε (clone 145-2C11, BD Biosciences, New Jersey, USA) and washed with sterile PBS. In each well 1x105 T cells were cultured in 200 μl medium supplemented with 10% FCS (at 37°C, 95% humidity and 5% CO2) for 4–6 days. For MLRs, washed DC (2.5 x 104 DC) were co-cultured with 1 x 105 T cells (at 37°C, 95% humidity and 5% CO2) for 4–6 days in 200 μl medium supplemented with 10% FCS in a 96 well round bottom plate (Corning Incorporated). Proliferation of responder cells reflected by dilution of CFSE signal was measured by flow cytometry; all cells with reduced CFSE signal (compared to the peak of “static cells”) were considered as proliferating cells. Culture supernatant was collected and stored at -20°C for subsequent cytokine analysis. Where indicated, recombinant mouse CXCL1 (ProspecBio, Ness-Ziona, Israel) was added to the proliferation assay and/or MLR.

RNA isolation and quantitative RT-PCR

Total RNA was isolated from cells using Trizol Reagent (Life Technologies; Bleiswijk, the Netherlands) according to the manufacturer’s guidelines. All RNA samples were quantified by spectrophotometry and RNA was subsequently converted to cDNA using random hexamers and the RevertAid First Strand cDNA Synthesis kit (Thermo Scientific, Breda, The Netherlands). Gene expression was analyzed by real-time quantitative reverse-transcription (RT)-PCR performed on a Bio-Rad CFX96TM Real-Time qPCR, using SYBR Green Supermix (Roche Diagnostics; Mannheim, Germany). Specific gene expression was normalized to housekeeping gene (hypoxanthine-guanine phosphoribosyl transferase; HPRT) and analyzed using the 2^-ddCt method [24]. The mouse gene-specific primers are listed in Table 1.
Table 1

Primer sequences used for quantitative RT-PCR.

Mouse GeneForward/reverse primerPrimer sequence 5’- 3’
HPRTForward5’-TCC TCC TCA GAC CGC TTT T-3’
Reverse5’-CCT GGT TCA TCA TCG CTA ATC-3’
CXCL1Forward5’-ATA ATG CCC TTT TAC ATT CTT TAA CC-3’
Reverse5’-AGT CCT TTG AAC GTC TCT GTC C-3’
TNF-αForward5’- CTGTAGCCCACGTCGTAGC -3’
Reverse5’- TTGAGATCCATGCCGTTG -3’
IL-6Forward5’- TGTATCTCTCTGAAGGACT -3’
Reverse5’-TCC TCC TCA GAC CGC TTT T-3’
IL-10Forward5’-GTG GAG CAG GTG AAG AGT GA-3’
Reverse5’- TGC AGT TGA TGA AGA TGT-3’
IL-12Forward5’- GGAAGCACGGCAGCAGAATC -3’
Reverse5’- AACTTGAGGGAGAAGTAGGAATGG -3’
IL-23Forward5’- TGGAGCAACTTCACACCTCC-3’
Reverse5’- GGCAGCTATGGCCAAAAAGG-3’

ELISA

CXCL1 (R&D Systems, catalog number DY453), IL-17 and interferon-γ (eBioscience, resp. catalog number 88-7472-88 and 88-7314-88) levels were measured using specific sandwich ELISA kits according to the manufacturer’s protocol.

Statistics

Differences between groups were analyzed using the Mann-Whitney U test with Graphpad (version 5.03 for Windows, GraphPad Software, San Diego, USA). Values are expressed as mean ± standard error of the mean (SEM), and a P-value ≤ 0.05 was considered as statistically significant.

Results

Endogenous expression of IL-37 does not affect the maturation of DC, but results in a reduced CXCL1 production

In order to evaluate the role of IL-37 in DC–T cell interaction, we first investigated the effect of endogenous IL-37 expression on DC maturation. Bone marrow derived DC from both hIL-37Tg and WT (C57Bl/6J) mice were cultured and 100 ng/ml LPS was added during final 24 hours of culture to induce maturation. Expression of co-stimulatory molecules (CD40, CD80, CD86) and MHCII expression on CD11c+ DC was analyzed by flow cytometry. We found no effect of endogenous IL-37 on expression of co-stimulatory molecules or MHCII in both unstimulated (Fig 1A) and LPS-stimulated DC (Fig 1B). Similarly, upon stimulation with TLR2 (PAM3CSK) or TLR9 (ODN1826) agonists expression of co-stimulatory markers did not differ between hIL-37Tg and WT DC (S1 Fig).
Fig 1

Dendritic cell co-stimulatory molecule and MHCII expression is not affected by endogenous IL-37 expression.

LPS-matured hIL-37Tg DC produce significantly less CXCL1 compared to their WT counterparts: Bone marrow-derived DC (hIL-37Tg or C57Bl/6J) were differentiated within 9 days using GM-CSF. Expression of co-stimulatory molecules (CD40, CD80, CD86) and MHCII on unstimulated (A) and (100 ng/ml) LPS-stimulated (B) CD11c+ DC was subsequently analyzed by flow cytometry. RT-qPCR analysis of cytokine mRNA expression in hIL-37Tg and WT unstimulated and LPS-maturated DC with HPRT serving as housekeeping gene (C). Culture supernatants of hIL-37Tg LPS-stimulated and WT DC were analyzed for CXCL1 production (D). Data represent mean with SEM of 5 independent experiments. * p< 0.05, ** p< 0.001 (Mann Whitney test).

Dendritic cell co-stimulatory molecule and MHCII expression is not affected by endogenous IL-37 expression.

LPS-matured hIL-37Tg DC produce significantly less CXCL1 compared to their WT counterparts: Bone marrow-derived DC (hIL-37Tg or C57Bl/6J) were differentiated within 9 days using GM-CSF. Expression of co-stimulatory molecules (CD40, CD80, CD86) and MHCII on unstimulated (A) and (100 ng/ml) LPS-stimulated (B) CD11c+ DC was subsequently analyzed by flow cytometry. RT-qPCR analysis of cytokine mRNA expression in hIL-37Tg and WT unstimulated and LPS-maturated DC with HPRT serving as housekeeping gene (C). Culture supernatants of hIL-37Tg LPS-stimulated and WT DC were analyzed for CXCL1 production (D). Data represent mean with SEM of 5 independent experiments. * p< 0.05, ** p< 0.001 (Mann Whitney test). Since the DC-derived cytokine profile dictates T cell differentiation, we subsequently analyzed the effect of IL-37 on cytokine mRNA expression profile in LPS-stimulated and unstimulated DC. mRNA expression of IL-6, IL-10, IL-12, IL-23, and TNF-α was comparable between WT and hIL-37Tg DC upon LPS stimulation for 24h (Fig 1C). We found a strong decline in CXCL1 mRNA expression in LPS-maturated hIL-37Tg DC, compared to their WT counterparts (Fig 1C). In line, we found a significantly reduced CXCL1 protein production by LPS-stimulated hIL-37Tg DC compared to WT DC (Fig 1D).

T cell stimulatory capacity of DC is not affected by endogenous IL-37 expression

We analyzed the T cell stimulatory capacity of hIL-37Tg DC in an allogeneic mixed lymphocyte reaction. DC were cultured during 9 days, in the presence or absence of LPS during the final 24 hours of culture. CFSE stained (Balb/c) MHCII-depleted splenocytes were co-cultured for 4–6 days with unstimulated and LPS-stimulated DC, derived from WT or hIL-37Tg origin (C57Bl/6J). Fluorescent staining of MHCII-depleted splenocytes revealed 80–85% T cells (CD3+) and less than 2% B cells (CD19+). Proliferation was analyzed by measuring the dilution of the CFSE signal in flow cytometry. We found no difference in proliferative response upon stimulation with hIL-37Tg or WT DC, either unstimulated (Fig 2A) or after stimulation with LPS (Fig 2B). Together this suggests that, despite reducing the production of CXCL1, endogenous expression of IL-37 does not affect the T cell stimulatory capacity of DC.
Fig 2

Endogenous IL-37 expression in DC does not result in reduced T cell activation in MLR.

Stimulatory capacity of unstimulated (A) or (100 ng/ml) LPS-matured (B) WT (C57Bl/6J) or hIL-37Tg DC was tested in an allogeneic MLR. MHCII-depleted, CFSE stained Balb/c splenocytes were co-cultured with DC for 4–6 days. Proliferation was determined by measuring the dilution of the intracellular CFSE signal by flow cytometry. Data represent mean with SEM of 4 independent experiments.

Endogenous IL-37 expression in DC does not result in reduced T cell activation in MLR.

Stimulatory capacity of unstimulated (A) or (100 ng/ml) LPS-matured (B) WT (C57Bl/6J) or hIL-37Tg DC was tested in an allogeneic MLR. MHCII-depleted, CFSE stained Balb/c splenocytes were co-cultured with DC for 4–6 days. Proliferation was determined by measuring the dilution of the intracellular CFSE signal by flow cytometry. Data represent mean with SEM of 4 independent experiments.

Recombinant CXCL1 does not influence proliferation of T cells

Few chemokines have been reported capable to activate T cells [25, 26] and T cells have been shown to respond to CXCL1 [27-30]. To further evaluate whether CXCL1 contributes to T cell proliferation and differentiation, we performed a proliferation assay with MHCII-depleted splenocytes in the presence or absence of recombinant mouse CXCL1 (rCXCL1). The biological activity of rCXCL1 was confirmed in a neutrophil migration assay (data not shown). After 4–6 days of incubation, no rCXCL1-induced proliferation could be observed, even in the presence of the highest rCXCL1 concentration (250 ng/ml, Fig 3A). Since rCXCL1 alone could be insufficient for T cell survival and activation, we used an additional assay in which rCXCL1 was added to anti-CD3 stimulation. MHCII-depleted splenocytes were cultured in anti-CD3ε pre-coated plates, to which increasing concentrations of rCXCL1 were added. While the stimulating effect of anti-CD3ε was clearly present, we did not observe an additional effect of rCXCL1 on T cell proliferation (Fig 3B).
Fig 3

Recombinant CXCL1 has no effect on CD3 stimulated T cell proliferation.

T cells were incubated for 4–6 days with (A) increasing concentrations of recombinant mouse CXCL1 (rCXCL1) (n = 3), or with (B) increasing concentrations of rCXCL1 in 0.5 μg/ml anti-CD3ε pre-coated plates (n = 3) (mean with SEM).

Recombinant CXCL1 has no effect on CD3 stimulated T cell proliferation.

T cells were incubated for 4–6 days with (A) increasing concentrations of recombinant mouse CXCL1 (rCXCL1) (n = 3), or with (B) increasing concentrations of rCXCL1 in 0.5 μg/ml anti-CD3ε pre-coated plates (n = 3) (mean with SEM).

Unstimulated DC express little CXCR2, while T cells lack CXCR2 expression

Since we were not able to detect a direct proliferative effect of CXCL1 on T cells and since there are conflicting reports on the expression of CXCR2 (the receptor of CXCL1) on T cells, we investigated CXCR2 expression on Balb/c T cells. Since CXCL1 produced by the LPS-stimulated DC could have an autocrine effect on DC, thereby increasing their T cell stimulatory capacities, we also evaluated CXCR2 expression on DC. We analyzed CXCR2 expression by flow cytometry on freshly isolated T cells (MHCII depleted splenocytes), unstimulated and LPS-stimulated DC,s and on granulocytes as a positive control. Granulocytes isolated from peripheral blood clearly express CXCR2 (Fig 4A), while T cells lack CXCR2 cell surface expression (Fig 4B). Unstimulated DC express low levels of CXCR2 (Fig 4C), which disappears upon LPS stimulation (Fig 4D).
Fig 4

CXCR2 expression on DC and T cells.

CXCR2 expression was analyzed by flow cytometry. Granulocytes (Gr1+; A), Balb/c T cells (CD3+; B) and unstimulated (C) and LPS-stimulated DC (CD11c+; D) were stained with anti-CXCR2 (black line) or isotype control (grey area). Granulocytes stained positive for CXCR2, while expression was low in unstimulated DC and absent in LPS-stimulated DC and T cells. Representative histograms of 4 independent experiments.

CXCR2 expression on DC and T cells.

CXCR2 expression was analyzed by flow cytometry. Granulocytes (Gr1+; A), Balb/c T cells (CD3+; B) and unstimulated (C) and LPS-stimulated DC (CD11c+; D) were stained with anti-CXCR2 (black line) or isotype control (grey area). Granulocytes stained positive for CXCR2, while expression was low in unstimulated DC and absent in LPS-stimulated DC and T cells. Representative histograms of 4 independent experiments. In summary, unstimulated DC express low levels of CXCR2 on their cell surface, while T cells lack CXCR2 expression.

Recombinant CXCL1 has no effect on DC stimulated T cell proliferation or differentiation

In the absence of CXCR2 on T cells, a direct effect of rCXCL1 on T cell activation or proliferation seems unlikely. DC-derived CXCL1 could exert an autocrine effect on the DC, affecting T cell functioning indirectly. Therefore, we performed a MLR assay with unstimulated DC as stimulators in the presence or absence of rCXCL1. The stimulating effect of DC on T cell proliferation was not enhanced by adding rCXCL1 (Fig 5A).
Fig 5

Recombinant CXCL1 has no effect on DC induced T cell stimulation.

Proliferative response of T cells (MHCII depleted splenocytes, Balb/c) co-cultured with unstimulated DC (C57Bl/6J) in the absence or presence of 250 ng/ml rCXCL1 (n = 2). Interferon-γ (B) and IL-17 (C) concentration in culture supernatants collected at day 4–6 of culture (mean with SEM).

Recombinant CXCL1 has no effect on DC induced T cell stimulation.

Proliferative response of T cells (MHCII depleted splenocytes, Balb/c) co-cultured with unstimulated DC (C57Bl/6J) in the absence or presence of 250 ng/ml rCXCL1 (n = 2). Interferon-γ (B) and IL-17 (C) concentration in culture supernatants collected at day 4–6 of culture (mean with SEM). While human CXCR2-transfected T cells produced interferon-γ (IFN-γ) upon incubation with CXCL1, naïve mouse CD4+ T cells have been reported to produce IL-17 upon stimulation by CXCL1 [31-33]. Therefore, we measured IFN-γ and IL-17 in culture supernatant, but did not find any change in either IFN-γ or IL-17 production related to the presence of rCXCL1 (Fig 5B and 5C). In summary, CXCL1 does not seem to contribute to DC-induced proliferation of T cells nor production of IFN-γ and IL-17.

Discussion

DC are key players in adaptive immunity and direct the skewing of T cell differentiation, mainly by skewing their cytokine profile. The anti-inflammatory cytokine IL-37 has been shown to mitigate immune responses in experimental inflammatory conditions [5-15] and autoimmune diseases [16, 17]. Since these effects could be favorable in the setting of organ transplantation, we aimed to further unravel the role of IL-37 in DC–T cell interaction, focusing on the effects of IL-37 on DC maturation and T cell stimulatory capacity. We found that endogenous expression of IL-37 does not affect the phenotype of LPS-matured DC, although we found a decline in CXCL1 production by IL-37 expressing LPS-matured DC compared to WT DC. The reduced production of CXCL1 induced by LPS in hIL-37Tg DC was not accompanied by a reduced cell surface expression of co-stimulatory molecules, a lower mRNA expression of inflammatory cytokines, or reduced ability to stimulate allogeneic T cells, which is in contrast with findings by others [5, 11, 34, 35]. Several differences in experimental setup can partly explain these conflicting results. We cultured DC from bone marrow of hIL-37Tg mice, while others [34, 35] added recombinant IL-37 to WT DC in culture. Nold et al. analyzed splenic DC of hIL-37Tg mice 24 hours after LPS injection in-vivo [5]. Luo et al. used a similar experimental setup as we did for culturing hIL-37Tg DC, but found significantly reduced expression of MHCII and CD40 in LPS-matured hIL-37Tg DC as compared to WT DC, accompanied by a reduced production of pro-inflammatory cytokines and increased secretion of IL-10 [11]. A clear explanation for these conflicting data is lacking. CXCL1, also known as keratinocyte chemoattractant and Gro-α, is a chemokine that belongs to the CXC chemokine family and is expressed both in humans and mice. CXCL1 plays a role in inflammation, angiogenesis, wound healing, and cancer development. Little is known about the direct effect of DC-derived CXCL1 on T cell functioning. However, intra-graft expression of CXCL1 has been associated with accelerated rejection and rejection could be promoted by CXCL1 [36, 37]. Although CXCL1 is a known chemoattractant for neutrophils, it was suggested to (indirectly) attract T cells as well, thereby contributing to accelerated rejection [36]. The clear inhibitory effect of IL-37 on CXCL1 production has been described before. In LPS-induced inflammation models, as well as an arthritis model and in macrophages, CXCL1 production is strongly decreased by IL-37 [5, 8, 16, 38]. The reduced CXCL1 production could be explained by the inhibitory effects of IL-37 expression on Nuclear Factor kappa B (NFκB) activity, a transcription factor driving CXCL1 transcription [6, 39, 40]. Indeed, expression of NFκB is reduced in hIL-37Tg DC [19]. Along with reduced TLR4 expression IL-37 appears to affect NFκB expression via increased IL-1 receptor 8 expression. Based on its nuclear translocation, IL-37 is thought to directly affect gene transcription as well. The intracellular precursor form of IL-37 needs caspase-1 processing in order to translocate to the nucleus [41] and upon caspase-1 inhibition the anti-inflammatory properties of IL-37 were abolished [4]. The reduced production of CXCL1 under influence of IL-37 combined with previously published data on decreased T cell stimulation by IL-37 expressing DC [11], suggested that CXCL1 may be involved in DC induced T cell stimulation. We were not able to detect expression of CXCR2, the receptor for CXCL1, on the surface of T cells by flow cytometry, which makes a direct effect of CXCL1 on T cells resulting in T cell proliferation less likely. CXCR2 gene expression has been described in T cells from older mice (18–22 months of age) and mammary tumor bearing mice [42-45], while we used young (aged 8–12 weeks) and healthy mice. Theoretically, CXCR2 could be expressed upon activation of T cells, though we found no effect of CXCL1 on T cells activated by anti-CD3 or DC either. Altogether, we found no evidence for a direct role of DC-derived CXCL1 on murine T cells. Subsequently, we hypothesized that there was an autocrine function for DC-derived CXCL1, thereby potentiating the stimulating effects of DC on naïve T cells. A proportion of mouse DCs in the circulatory system express CXCR2 [46]. While others could not demonstrate CXCR2 expression on DC of different mouse strains [47, 48], it has been shown on human monocyte derived DC [49, 50]. CXCL1 has been described to affect DC maturation and cytokine production [51].We found low expression levels of CXCR2 on the surface of unstimulated DC which disappeared after exposure to LPS. However, adding rCXCL1 to a co-culture of unstimulated DC and T cells did not enhance T cell proliferation. We therefore conclude that a pro-inflammatory, autocrine effect of DC-derived CXCL1 is unlikely. This is supported by the finding that incubation of human monocyte derived DC with CXCL1 prior to LPS exposure resulted in reduced production of the pro-inflammatory cytokine IL-12p70 [51]. In this study we addressed the hypothesis that IL-37 can induce a tolerogenic properties in DC and thereby impacts T cell adaptive immunity. We could not confirm earlier findings of reduced expression of MHCII and CD40 and the switch to a tolerogenic cytokine profile, but found reduced CXCL1 production in LPS-matured hIL37-Tg DC. We speculate that DC-derived CXCL1 contributes to T cell activation, but found no evidence for a role of CXCL1 in T cell activation by DC or other stimuli.

Expression of co-stimulatory molecules CD40 and CD86 in PAM3 and ODN stimulated bone marrow derived dendritic cells of hIL37Tg and WT mice.

Bone marrow-derived DC (hIL-37Tg or C57BI/6J) were differentiated within 9 days using GM-CSF. Expression of co-stimulatory molecules (CD40, CD86) on 1 μg/ml Pam3CSK or 1.3 μg/ml CpG ODN1826 stimulated CD11c+ DC was subsequently analyzed by flow cytometry. (TIF) Click here for additional data file. 3 Mar 2021 PONE-D-20-39909 Reduced CXCL1 production by endogenous IL-37 expressing dendritic cells does not affect T cell activation PLOS ONE Dear Dr. van der Vlag, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Reviewers have provided comments to improve the text. Also address the question on 'novelty' in the discussion Please submit your revised manuscript by Apr 01 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols We look forward to receiving your revised manuscript. Kind regards, Jagadeesh Bayry, DVM, PhD, HDR Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data. 3. Please provide the catalog numbers and sources of the sandwich ELISA kits. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: This study provides evidence that the endogenous expression of IL-37 does not affect the phenotype of LPS-matured dendritic cells (DC) while a decrease in CXCL1 production by IL-37 expressing is observed in LPS-matured DC when compared to WT DC. Addition This study provides evidence that ally, CXCL1 is not involved in T cell activation by DC or other stimuli. Overall, this study is very interesting and the manuscript is well written and clearly presented. Major concern, It is not clear why the authors focused only on the effect of the chemoattractant CXCL1 on T cell activation? Did the authors assess the effect of CXCL1 on B cell activation? please discuss. Minor concern The Y- and X-axis of Fig. 5C are not clear. Reviewer #2: Kouwenberg et al. present a study looking at the role of the anti-inflammatory IL-37 expression in the production of the chemokine, CXCL1, from dendritic cells. They found that IL-37 dampened CXCL1 expression and that the changes in CXCL1 expression did not affect T cell activation. Overall, the manuscript is easy to follow and read. Though the manuscript does show a negative results, I firmly believe negative results play a significant role in our scientific knowledge. Unfortunately the finding in Kouwenberg et al. are not novel. A quick literature search will find that CXCL1 is a chemokine that is not involved in T cell activation, due in part to T cells low/absence of the CXCL1 target receptor CXCR2 expression. CXCL1 is commonly found to affect the innate immune response and neutrophil and not T cell chemotaxis. A more relevant study would have looked at how IL-37 expression affects CXCL1 and how that in turn supports either neutrophil activation or chemotaxis. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: Yes: Samir Jawhara Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 6 Apr 2021 Reviewer #1: “This study provides evidence that the endogenous expression of IL-37 does not affect the phenotype of LPS-matured dendritic cells (DC) while a decrease in CXCL1 production by IL-37 expressing is observed in LPS-matured DC when compared to WT DC. Addition This study provides evidence that ally, CXCL1 is not involved in T cell activation by DC or other stimuli. Overall, this study is very interesting and the manuscript is well written and clearly presented.” We thank the reviewer for the very positive comments. Major concern, “It is not clear why the authors focused only on the effect of the chemoattractant CXCL1 on T cell activation? Did the authors assess the effect of CXCL1 on B cell activation? please discuss.” In our manuscript, we focus on the role of IL-37 expression on dendritic cell (DC) functioning and subsequent DC-induced T cell activation. We found that LPS-stimulated hTgIL-37 mouse DC produce significantly less CXCL1 than their WT counterparts. It has been reported that IL-37 expressing DC display reduced T cell activation (1, 2), and that T cells can respond to CXCL1 (3-8). We therefore hypothesized that the reduced T cell activating capacity of IL-37 expressing DC is mediated by reduced CXCL1 production. To our knowledge there are no reports clearly showing responses of B cells to CXCL1. Therefore, we focused on the potential role of DC-derived CXCL1 in T cell activation. To further clarify our further focus on the role of CXCL1 in T cell activation, we included these details to the manuscript in the result section (line 212-213). Minor concern The Y- and X-axis of Fig. 5C are not clear. We are a bit puzzled regarding this comment. Figure 5C depicts IL-17 levels in supernatant of MHC-II depleted splenocytes (Balb/c) co-cultured with unstimulated DC (C57Bl/6J) in the absence (white) or presence (black) of 250 ng/ml rCXCL1. Please let us know whether we have overlooked something. Reviewer #2: Kouwenberg et al. present a study looking at the role of the anti-inflammatory IL-37 expression in the production of the chemokine, CXCL1, from dendritic cells. They found that IL-37 dampened CXCL1 expression and that the changes in CXCL1 expression did not affect T cell activation. Overall, the manuscript is easy to follow and read. Though the manuscript does show a negative results, I firmly believe negative results play a significant role in our scientific knowledge. We completely agree that “negative” results should be published in the public domain. Unfortunately the finding in Kouwenberg et al. are not novel. A quick literature search will find that CXCL1 is a chemokine that is not involved in T cell activation, due in part to T cells low/absence of the CXCL1 target receptor CXCR2 expression. CXCL1 is commonly found to affect the innate immune response and neutrophil and not T cell chemotaxis. A more relevant study would have looked at how IL-37 expression affects CXCL1 and how that in turn supports either neutrophil activation or chemotaxis. We appreciate this comment and we agree that investigating the consequences of IL-37 expression induced changes in CXCL1 production on neutrophil chemotaxis would be interesting. However, as part of our research program on tolerizing DC for the prevention of allograft rejection, we were especially interested in a potential role of CXCL1 in the DC-T cell interaction. Notably, there is literature that describes responses of T cells to CXCL1 (3-8). In addition, recombinant human CXCL1 has been described as potent chemoattractant for freshly isolated human T cells (8, 9). CD4+ and CD8+ T cells were attracted to an equal extent, with predominant migration of the CD45+ memory T cell subset (9). In mice, CXCR2 expression has been detected on lymphocytes, as described in the manuscript. Furthermore, a possible autocrine effect of DC-derived CXCL1 was supported by the observation that a proportion of murine circulating CD11c+ DC express CXCR2 (10), and CXCL1 had been described to affect DC maturation and cytokine production (11). Based on these published data and our findings of reduced production of CXCL1 by IL-37 expressing DC, we focused on the effects of DC-derived CXCL1 on T cell activation. Since there are no detailed studies on DC-derived CXCL1 on T cell activation, we think our data set, although “negative”, is novel. We further revised the discussion section of the manuscript (line 313-317) by adding the above mentioned details. References 1. Luo Y, Cai X, Liu S, Wang S, Nold-Petry CA, Nold MF, et al. Suppression of antigen-specific adaptive immunity by IL-37 via induction of tolerogenic dendritic cells. Proceedings of the National Academy of Sciences of the United States of America. 2014;111(42):15178-83. 2. Nold MF, Nold-Petry CA, Zepp JA, Palmer BE, Bufler P, Dinarello CA. IL-37 is a fundamental inhibitor of innate immunity. Nature immunology. 2010;11(11):1014-22. 3. Khaw YM, Tierney A, Cunningham C, Soto-Díaz K, Kang E, Steelman AJ, et al. Astrocytes lure CXCR2-expressing CD4(+) T cells to gray matter via TAK1-mediated chemokine production in a mouse model of multiple sclerosis. Proceedings of the National Academy of Sciences of the United States of America. 2021;118(8). 4. Liu YJ, Guo DW, Tian L, Shang DS, Zhao WD, Li B, et al. Peripheral T cells derived from Alzheimer's disease patients overexpress CXCR2 contributing to its transendothelial migration, which is microglial TNF-alpha-dependent. Neurobiology of aging. 2010;31(2):175-88. 5. Takata H, Tomiyama H, Fujiwara M, Kobayashi N, Takiguchi M. Cutting edge: expression of chemokine receptor CXCR1 on human effector CD8+ T cells. Journal of immunology (Baltimore, Md : 1950). 2004;173(4):2231-5. 6. Rajaei T, Farajifard H, Rezaee SA, Azarpazhooh MR, Mahmoudi M, Valizadeh N, et al. Different roles of CXCR1 and CXCR2 in HTLV-1 carriers and HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP) patients. Med Microbiol Immunol. 2019;208(5):641-50. 7. Li YM, Liu ZY, Wang JC, Yu JM, Li ZC, Yang HJ, et al. Receptor-Interacting Protein Kinase 3 Deficiency Recruits Myeloid-Derived Suppressor Cells to Hepatocellular Carcinoma Through the Chemokine (C-X-C Motif) Ligand 1-Chemokine (C-X-C Motif) Receptor 2 Axis. Hepatology. 2019;70(5):1564-81. 8. Chen P, Yi Z, Zhang W, Klotman ME, Chen BK. HIV infection-induced transcriptional program in renal tubular epithelial cells activates a CXCR2-driven CD4+ T-cell chemotactic response. AIDS (London, England). 2016;30(12):1877-88. 9. Jinquan T, Frydenberg J, Mukaida N, Bonde J, Larsen CG, Matsushima K, et al. Recombinant human growth-regulated oncogene-alpha induces T lymphocyte chemotaxis. A process regulated via IL-8 receptors by IFN-gamma, TNF-alpha, IL-4, IL-10, and IL-13. Journal of immunology (Baltimore, Md : 1950). 1995;155(11):5359-68. 10. Katoh H, Wang D, Daikoku T, Sun H, Dey SK, Dubois RN. CXCR2-expressing myeloid-derived suppressor cells are essential to promote colitis-associated tumorigenesis. Cancer Cell. 2013;24(5):631-44. 11. Michielsen AJ, Hogan AE, Marry J, Tosetto M, Cox F, Hyland JM, et al. Tumour tissue microenvironment can inhibit dendritic cell maturation in colorectal cancer. PloS one. 2011;6(11):e27944. Submitted filename: Responses to the reviewers.docx Click here for additional data file. 4 May 2021 Reduced CXCL1 production by endogenous IL-37 expressing dendritic cells does not affect T cell activation PONE-D-20-39909R1 Dear Dr. van der Vlag, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Jagadeesh Bayry, DVM, PhD, HDR Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed Reviewer #2: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The authors have addressed most of the concerns that I had with this new submission. I dont have any additional comments for the authors. Reviewer #2: The authors of the manuscript, "Reduced CXCL1 production by endogenous IL-37 expressing dendritic cells does not affect T cell activation" have adequately addressed my concerns about the manuscript. ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: Yes: Samir Jawhara Reviewer #2: No 14 May 2021 PONE-D-20-39909R1 Reduced CXCL1 production by endogenous IL-37 expressing dendritic cells does not affect T cell activation Dear Dr. van der Vlag: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Jagadeesh Bayry Academic Editor PLOS ONE
  51 in total

1.  Cutting edge: expression of chemokine receptor CXCR1 on human effector CD8+ T cells.

Authors:  Hiroshi Takata; Hiroko Tomiyama; Mamoru Fujiwara; Naoki Kobayashi; Masafumi Takiguchi
Journal:  J Immunol       Date:  2004-08-15       Impact factor: 5.422

2.  NF-κB and STAT1 control CXCL1 and CXCL2 gene transcription.

Authors:  Susan J Burke; Danhong Lu; Tim E Sparer; Thomas Masi; Matthew R Goff; Michael D Karlstad; J Jason Collier
Journal:  Am J Physiol Endocrinol Metab       Date:  2013-11-26       Impact factor: 4.310

3.  Interleukin 35 (IL-35) and IL-37: Intestinal and peripheral expression by T and B regulatory cells in patients with Inflammatory Bowel Disease.

Authors:  Gabriela Fonseca-Camarillo; Janette Furuzawa-Carballeda; Jesús K Yamamoto-Furusho
Journal:  Cytokine       Date:  2015-06-30       Impact factor: 3.861

4.  Suppression of antigen-specific adaptive immunity by IL-37 via induction of tolerogenic dendritic cells.

Authors:  Yuchun Luo; Xiangna Cai; Sucai Liu; Sen Wang; Claudia A Nold-Petry; Marcel F Nold; Philip Bufler; David Norris; Charles A Dinarello; Mayumi Fujita
Journal:  Proc Natl Acad Sci U S A       Date:  2014-10-07       Impact factor: 11.205

5.  Early chemokine cascades in murine cardiac grafts regulate T cell recruitment and progression of acute allograft rejection.

Authors:  K Morita; M Miura; D R Paolone; T M Engeman; A Kapoor; D G Remick; R L Fairchild
Journal:  J Immunol       Date:  2001-09-01       Impact factor: 5.422

6.  IL-37 inhibits IL-18-induced tubular epithelial cell expression of pro-inflammatory cytokines and renal ischemia-reperfusion injury.

Authors:  Yunbo Yang; Zhu-Xu Zhang; Dameng Lian; Aaron Haig; Rabindra N Bhattacharjee; Anthony M Jevnikar
Journal:  Kidney Int       Date:  2014-09-10       Impact factor: 10.612

7.  Emergence, origin, and function of neutrophil-dendritic cell hybrids in experimentally induced inflammatory lesions in mice.

Authors:  Shuo Geng; Hironori Matsushima; Takashi Okamoto; Yi Yao; Ran Lu; Kristen Page; Robert M Blumenthal; Nicole L Ward; Toru Miyazaki; Akira Takashima
Journal:  Blood       Date:  2013-01-10       Impact factor: 22.113

8.  IL-37 requires the receptors IL-18Rα and IL-1R8 (SIGIRR) to carry out its multifaceted anti-inflammatory program upon innate signal transduction.

Authors:  Claudia A Nold-Petry; Camden Y Lo; Ina Rudloff; Kirstin D Elgass; Suzhao Li; Michael P Gantier; Amelie S Lotz-Havla; Søren W Gersting; Steven X Cho; Jason C Lao; Andrew M Ellisdon; Björn Rotter; Tania Azam; Niamh E Mangan; Fernando J Rossello; James C Whisstock; Philip Bufler; Cecilia Garlanda; Alberto Mantovani; Charles A Dinarello; Marcel F Nold
Journal:  Nat Immunol       Date:  2015-03-02       Impact factor: 31.250

9.  CXCL1 contributes to host defense in polymicrobial sepsis via modulating T cell and neutrophil functions.

Authors:  Liliang Jin; Sanjay Batra; David Nobuhiro Douda; Nades Palaniyar; Samithamby Jeyaseelan
Journal:  J Immunol       Date:  2014-08-29       Impact factor: 5.422

10.  The effect of aging and caloric restriction on murine CD8+ T cell chemokine receptor gene expression.

Authors:  Raymond Yung; RuRan Mo; Annabelle Grolleau-Julius; Mark Hoeltzel
Journal:  Immun Ageing       Date:  2007-11-14       Impact factor: 6.400

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.