Literature DB >> 34013885

Abortive intussusceptive angiogenesis causes multi-cavernous vascular malformations.

Wenqing Li1, Virginia Tran1, Iftach Shaked2, Belinda Xue1, Thomas Moore3, Rhonda Lightle3, David Kleinfeld2,4, Issam A Awad3, Mark H Ginsberg1.   

Abstract

Mosaic inactivation of CCM2 in humans causes cerebral cavernous malformations (CCMs) containing adjacent dilated blood-filled multi-cavernous lesions. We used CRISPR-Cas9 mutagenesis to induce mosaic inactivation of zebrafish ccm2 resulting in a novel lethal multi-cavernous lesion in the embryonic caudal venous plexus (CVP) caused by obstruction of blood flow by intraluminal pillars. These pillars mimic those that mediate intussusceptive angiogenesis; however, in contrast to the normal process, the pillars failed to fuse to split the pre-existing vessel in two. Abortive intussusceptive angiogenesis stemmed from mosaic inactivation of ccm2 leading to patchy klf2a overexpression and resultant aberrant flow signaling. Surviving adult fish manifested histologically typical hemorrhagic CCM. Formation of mammalian CCM requires the flow-regulated transcription factor KLF2; fish CCM and the embryonic CVP lesion failed to form in klf2a null fish indicating a common pathogenesis with the mammalian lesion. These studies describe a zebrafish CCM model and establish a mechanism that can explain the formation of characteristic multi-cavernous lesions.
© 2021, Li et al.

Entities:  

Keywords:  angiogenesis; blood flow signaling; cerebral cavernous malformations; developmental biology; zebrafish

Mesh:

Substances:

Year:  2021        PMID: 34013885      PMCID: PMC8175082          DOI: 10.7554/eLife.62155

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.140


Introduction

Cerebral cavernous malformations (CCMs) are central nervous system (CNS) vascular anomalies that lead to significant morbidity and mortality (Leblanc et al., 2009). CCMs affect ~1/200 humans and cause a lifelong risk of stroke and other neurological sequelae for which there is no pharmacological therapy. Heterozygous loss of function mutations of three CCM genes (KRIT1(CCM1), CCM2, and PDCD10(CCM3)) are associated with development of venous capillary dysplasias with hemorrhage and increased vascular permeability (Mikati et al., 2015) characteristic of CCM (Leblanc et al., 2009). Heterozygous patients often exhibit a ‘second hit’ on the normal CCM allele in CCM endothelial cells (Akers et al., 2009; McDonald et al., 2011) and loss of function of P53 or Msh2, genes that maintain genome stability, ‘sensitize’ Krit1 or Pdcd10 mice for development of CCM. Thus, CCMs are likely to arise following mosaic inactivation of both alleles of a given CCM gene. Neonatal endothelial-specific inactivation of murine Krit1, Pdcd10 (Ccm3), or Ccm2 results in cerebellar and retinal vascular lesions that resemble CCM (Boulday et al., 2011; Chan et al., 2011; Jenny Zhou et al., 2016). Thus, human CCMs arise from venous capillaries as a consequence of mosaic inactivation of these genes in endothelial cells. The most striking form of CCM are large complexes containing adjacent dilated blood-filled thin-walled vessels with surrounding hemosiderin deposition indicative of chronic bleeding. These are the lesions that are surgically resected either to relieve either mass effects or recurrent bleeding and are therefore clinically relevant. The cellular mechanism whereby these hallmark multi-cavernous lesions form is unknown and we reasoned that the genetic and experimental accessibility of the zebrafish and the optical transparency of its embryos and larvae (Gore et al., 2018) could enable in vivo analysis of CCM development. In particular, the fish is amenable to examination of genetic perturbations by study of mutant fish, CRISPR/Cas9 mutagenesis, or morpholino silencing (Stainier et al., 2017). The zebrafish ‘heart of glass’ defect in cardiac development led to the discovery of HEG1 (a binding partner for KRIT1; Gingras et al., 2012) and to the demonstration that loss of KRIT1 (santa) or its binding partner, CCM2 (valentine), produced an identical cardiac phenotype (Mably et al., 2006). Importantly, neither mutation nor silencing of any of these genes have been reported to produce zebrafish CCM. Second, silencing of pdcd10 does not produce either cardiac dilation or CCM in the fish (Yoruk et al., 2012). Furthermore, there is compelling evidence that HEG1 mutations do not produce CCM in mice or humans (Zheng et al., 2014). These data indicate important differences between the consequences of deletion of these genes in the endocardium and in brain endothelial cells and underscore the need for a zebrafish model of authentic CCM. Here, we used CRISPR-Cas9 mutagenesis of ccm2 to recapitulate the mosaic inactivation of a CCM gene. We observed a highly penetrant novel phenotype in embryos. By 2 days post fertilization (dpf), ~30% of embryos developed striking segmental dilatation of the caudal vein associated with slowed blood flow and formation of multiple dilated contiguous blood-filled chambers. We show that these lesions are caused by the intraluminal extension of pillars that lead to physical obstruction of blood flow. These pillars resemble the first steps of intussusceptive angiogenesis; however, in contrast to the physiological process, these pillars fail to organize and fuse together to split the pre-existing vessel in two. We show that this process of abortive intussusceptive angiogenesis is due to mosaic inactivation of ccm2 leading to aberrant flow signaling and that, as in CCMs, KLF2 transcription factors play an important role in the formation of these lesions. In addition, typical CCM formed in the brains of all surviving adult and juvenile fish. As in murine CCM models, KLF2 transcription factors played a key role in the pathogenesis of zebrafish CCMs. Thus, abortive intussusceptive angiogenesis, as a consequence of aberrant flow signaling, leads to formation of multi-cavernous venous lesions in zebrafish embryos that resemble human multi-cavernous CCM.

Results

ccm2 CRISPR zebrafish embryos display segmental dilation of the caudal venous plexus

As noted above, although null mutations of krit1 and ccm2 result in cardiac dilation and some vascular abnormalities, CCMs have not been observed in zebrafish (Mably et al., 2006; Renz et al., 2015). We reasoned because humans with CCM are mosaic for homozygous inactivation of CCM1 or CCM2, that induction of such mosaicism using a CRISPR-Cas9 system (Ablain et al., 2015) could result in lesion formation. To create a mosaic animal, we co-injected Cas9 mRNA and gRNAs targeting the ccm2 gene in zebrafish embryos (Figure 1—figure supplement 1A, Supplementary file 2). As expected, both genomic DNA sequencing and whole mount in situ hybridization showed that ccm2 was targeted in a variable mosaic pattern affecting all tissues (Figure 1—figure supplement 1B and C). About half of these mosaic embryos displayed lethal cardiovascular defects.
Figure 1—figure supplement 1.

ccm2 CRISPR zebrafish exhibit mosaic expression of CCM2.

(A) Outline of the experiment: cas9 mRNA and gRNAs targeting ccm2 were co-injected into one-cell stage zebrafish embryos. (B) Sequencing showed that the Cas9 together with designed gRNA could successfully target ccm2 and produce indels. PAM sequence (5’-AGG-3’) is indicated in a rectangle. Though the wild-type sequence is the top read in each downstream position, indicating existence of wild-type allele, multiple reads emerged downstream of the PAM in ccm2 CRISPR embryos. (C) Whole mount in situ hybridization of 2 days post fertilization (dpf) embryos showed ccm2 CRISPR embryos displaying patchy loss of CCM2 expression.

The most prevalent lethal phenotype, observed in ~30% of 2 dpf ccm2 CRISPR embryos, was localized dilatation of the caudal venous plexus (CVP) associated with erythrocyte accumulation and sluggish blood flow (Figure 1A and B, Video 1). This phenotype was clearly demonstrated in Tg(fli1:EGFP) and Tg(gata1:DsRed) embryos in which erythrocytes are labeled with DsRed and endothelial cells with EGFP (Figure 1C and D). Examination of the dilated CVP revealed multiple large blood-filled chambers separated by thin-walled partitions that bore a resemblance to Stage 2 human multi-cavernous CCM (Figure 1C) in contrast to the normal architecture of control embryos (Figure 1D). In addition, ~5% of ccm2 CRISPR embryos also displayed dilated cranial vessels (CV) (Figure 1E). We also noted expected phenotypes previously reported in ccm2 morphants and mutants (Mably et al., 2006; Renz et al., 2015), a small proportion (~10%) of ccm2 CRISPR embryos exhibited both heart dilation at 2 dpf and increased branching of the subintestinal vein (SIV) at 3 dpf (Figure 1—figure supplement 2). Co-administration of ccm2 mRNA prevented both CVP dilation and heart dilation in ccm2 CRISPR embryos (Figure 1G) confirming that both phenotypes are due to ccm2 loss. Notably, the dilated heart and CVP dilation appeared to be mutually exclusive, that is, in over 200 embryos analyzed, we never observed both phenotypes in a single ccm2 CRISPR embryo. Thus, the localized CVP dilation was the most prevalent phenotype observed in 2 dpf ccm2 CRISPR embryos in comparison to the cardiac and SIV phenotypes that characterize ccm2 null and ccm2 morphant embryos (Figure 1H; Mably et al., 2006; Renz et al., 2015).
Figure 1.

ccm2 CRISPR zebrafish embryo display novel vascular phenotypes.

Endothelial cells and red blood cells were labeled by EGFP and DsRed respectively in double transgenic Tg(fli1:EGFP) embryos. (A) Red blood cells accumulate in dilated segments of the caudal vein of ccm2 CRISPR fish at 2 days post fertilization (dpf). (B) cas9 mRNA-injected control embryo. (C) ccm2 CRISPR embryos showed accumulation of red blood cells and intraluminal endothelial cells in a dilated segment of caudal vein in contrast to a control embryo. Note: In this and all succeeding sagittal views, anterior is to the left (D). (E) ccm2 CRISPR embryos occasionally showed dilations of cerebral veins, whereas control embryos (F) showed normal development of cerebral veins (F). MCeV: mid-cerebral vein, PMBC: primordial midbrain channel, PHBC: primordial hindbrain channel. (G) The dilated caudal venous plexus (CVP) and heart of ccm2 CRISPR embryos were rescued by ccm2 mRNA injection. p=0.0336 (dilated CVP), 0.0037 (dilated heart). p-Values were calculated using an unpaired two-tailed Student’s t-test. (H) Phenotypic distribution of dilated heart, CVP, and cerebral veins (CV) in ccm2 CRISPR embryos at 2 dpf. p=0.0078 (dilated CVP), 0.0268 (dilated heart), 0.0041 (dilated CV). p-Values were calculated using a paired two-tailed Student’s t-test. Error bars indicate SD. Scale bar: 1 mm in A and B, and 100 µm in C through F.

(A) Outline of the experiment: cas9 mRNA and gRNAs targeting ccm2 were co-injected into one-cell stage zebrafish embryos. (B) Sequencing showed that the Cas9 together with designed gRNA could successfully target ccm2 and produce indels. PAM sequence (5’-AGG-3’) is indicated in a rectangle. Though the wild-type sequence is the top read in each downstream position, indicating existence of wild-type allele, multiple reads emerged downstream of the PAM in ccm2 CRISPR embryos. (C) Whole mount in situ hybridization of 2 days post fertilization (dpf) embryos showed ccm2 CRISPR embryos displaying patchy loss of CCM2 expression.

Microinjection was performed on Tg(fli1:EGFP) embryos. (A and B) Both atrium and ventricle were dilated in ~10% of ccm2 CRISPR embryos on 2 days post fertilization (dpf) (A) compared with normal heart in control (B). The heart was outlined by dash lines. (C and D) Increased branch points were observed on 3 dpf in ~10% of ccm2 CRISPR embryos indicated by arrows. Scale bar: 100 µm.

Video 1.

On 2 days post fertilization (dpf), ccm2 CRISPR embryo displayed cavernoma-like lesion in the tail.

Blood flow was slowed down in the lesion area that contained retained blood cells.

Figure 1—figure supplement 2.

Approximately 10% of ccm2 CRISPR zebrafish embryos exhibited dilation of heart and increased branch points of subintestinal vein.

Microinjection was performed on Tg(fli1:EGFP) embryos. (A and B) Both atrium and ventricle were dilated in ~10% of ccm2 CRISPR embryos on 2 days post fertilization (dpf) (A) compared with normal heart in control (B). The heart was outlined by dash lines. (C and D) Increased branch points were observed on 3 dpf in ~10% of ccm2 CRISPR embryos indicated by arrows. Scale bar: 100 µm.

ccm2 CRISPR zebrafish embryo display novel vascular phenotypes.

Endothelial cells and red blood cells were labeled by EGFP and DsRed respectively in double transgenic Tg(fli1:EGFP) embryos. (A) Red blood cells accumulate in dilated segments of the caudal vein of ccm2 CRISPR fish at 2 days post fertilization (dpf). (B) cas9 mRNA-injected control embryo. (C) ccm2 CRISPR embryos showed accumulation of red blood cells and intraluminal endothelial cells in a dilated segment of caudal vein in contrast to a control embryo. Note: In this and all succeeding sagittal views, anterior is to the left (D). (E) ccm2 CRISPR embryos occasionally showed dilations of cerebral veins, whereas control embryos (F) showed normal development of cerebral veins (F). MCeV: mid-cerebral vein, PMBC: primordial midbrain channel, PHBC: primordial hindbrain channel. (G) The dilated caudal venous plexus (CVP) and heart of ccm2 CRISPR embryos were rescued by ccm2 mRNA injection. p=0.0336 (dilated CVP), 0.0037 (dilated heart). p-Values were calculated using an unpaired two-tailed Student’s t-test. (H) Phenotypic distribution of dilated heart, CVP, and cerebral veins (CV) in ccm2 CRISPR embryos at 2 dpf. p=0.0078 (dilated CVP), 0.0268 (dilated heart), 0.0041 (dilated CV). p-Values were calculated using a paired two-tailed Student’s t-test. Error bars indicate SD. Scale bar: 1 mm in A and B, and 100 µm in C through F.

ccm2 CRISPR zebrafish exhibit mosaic expression of CCM2.

(A) Outline of the experiment: cas9 mRNA and gRNAs targeting ccm2 were co-injected into one-cell stage zebrafish embryos. (B) Sequencing showed that the Cas9 together with designed gRNA could successfully target ccm2 and produce indels. PAM sequence (5’-AGG-3’) is indicated in a rectangle. Though the wild-type sequence is the top read in each downstream position, indicating existence of wild-type allele, multiple reads emerged downstream of the PAM in ccm2 CRISPR embryos. (C) Whole mount in situ hybridization of 2 days post fertilization (dpf) embryos showed ccm2 CRISPR embryos displaying patchy loss of CCM2 expression.

Approximately 10% of ccm2 CRISPR zebrafish embryos exhibited dilation of heart and increased branch points of subintestinal vein.

Microinjection was performed on Tg(fli1:EGFP) embryos. (A and B) Both atrium and ventricle were dilated in ~10% of ccm2 CRISPR embryos on 2 days post fertilization (dpf) (A) compared with normal heart in control (B). The heart was outlined by dash lines. (C and D) Increased branch points were observed on 3 dpf in ~10% of ccm2 CRISPR embryos indicated by arrows. Scale bar: 100 µm.

On 2 days post fertilization (dpf), ccm2 CRISPR embryo displayed cavernoma-like lesion in the tail.

Blood flow was slowed down in the lesion area that contained retained blood cells.

Abortive intussusceptive angiogenesis in the dilated CVP of ccm2 CRISPR embryos

We used confocal microscopy and three-dimensional (3D) reconstruction of the dilated area of the CVP in Tg(fli1:EGFP;gata1:DsRed) zebrafish to explore their underlying structural defect. We noted intraluminal endothelial pillars that partitioned the lumen (Figure 2A through C) of the dilated CVP. In contrast, as expected, a completely patent caudal and ventral vein lumen formed in control embryos (Figure 2D through F). Furthermore, the ventral vein, which normally forms by a combination of sprouting and intussusceptive angiogenesis (Karthik et al., 2018), was lost in the dilated area of the CVP (Figure 2A through F). Importantly, examination of 3D reconstructions of the vessel revealed that these pillars were associated with pits on the external surface of the dilated CVP (Figure 2G arrows), a hallmark of the initial phase of intussusceptive angiogenesis (Djonov et al., 2003). In contrast to normal intussusceptive angiogenesis, wherein transluminal pillars ultimately fuse to divide vessels longitudinally into new daughter vessels (Djonov et al., 2003), the intussusceptions observed in ccm2 CRISPR embryos were not coordinately formed and failed to fuse resulting in a honeycombed lumen. This honeycombing created a lumen with multiple chambers filled with red blood cells (RBCs) associated with sluggish blood flow (Figure 2I through K, Videos 2 and 3), whereas patent lumens and normal blood flow were observed in control embryos (Video 4). Thus, in these mosaic ccm2 null zebrafish, an expanded region of the CVP is formed by multiple dilated erythrocyte-filled chambers and is associated with evidence of incomplete intussusceptive angiogenesis.
Figure 2.

Intravascular pillars honeycomb the lumen of the caudal vein in ccm2 CRISPR embryos.

(A–F) XZ planes and three-dimensional (3D) projection along Y axis of Airyscan images revealed intraluminal endothelial pillars at 2 days post fertilization (dpf) (A–C), whereas Cas9-injected control embryos displayed a normal patent lumen in both a dorsal and ventral caudal vein (D–F). Endothelial cells were labeled by EGFP in Tg(fli1:EGFP) embryos. Arrow, arrowhead, and asterisk indicated the dorsal aorta, dorsal vein, and ventral vein, respectively. (G and H) Ventral view of 3D reconstruction show the irregular surface of the dramatically dilated caudal vein segment in ccm2 CRISPR embryo (G) and normal ventral vein (H). Arrows in G indicate small pits where the endothelial pillars originate. (I–K) Intraluminal view of 3D reconstruction of ccm2 CRISPR embryo reveals the intraluminal pillars honeycombing the lumen and the accumulated red blood cells (I). Erythrocytes were not imaged in J to reveal pillars and the area within the box in (J) was magnified in (K), and arrowhead indicates the intravascular pillar. Endothelial cells and red blood cells were labeled by EGFP or DsRed respectively in Tg(fli1:EGFP) embryos. Scale bar: 20 µm.

Video 2.

Three-dimensional exterior view of caudal venous plexus (CVP) of 2 days post fertilization (dpf) ccm2 CRISPR embryo.

Note pits on the surface and that the CVP is partitioned into several dilated areas.

Video 3.

Three-dimensional interior view of caudal venous plexus (CVP) of 2 days post fertilization (dpf) ccm2 CRISPR embryo.

Note the endothelial pillars within the lumen and accumulated red blood cells.

Video 4.

Three-dimensional view of caudal venous plexus (CVP) of 2 days post fertilization (dpf) control embryo.

Intravascular pillars honeycomb the lumen of the caudal vein in ccm2 CRISPR embryos.

(A–F) XZ planes and three-dimensional (3D) projection along Y axis of Airyscan images revealed intraluminal endothelial pillars at 2 days post fertilization (dpf) (A–C), whereas Cas9-injected control embryos displayed a normal patent lumen in both a dorsal and ventral caudal vein (D–F). Endothelial cells were labeled by EGFP in Tg(fli1:EGFP) embryos. Arrow, arrowhead, and asterisk indicated the dorsal aorta, dorsal vein, and ventral vein, respectively. (G and H) Ventral view of 3D reconstruction show the irregular surface of the dramatically dilated caudal vein segment in ccm2 CRISPR embryo (G) and normal ventral vein (H). Arrows in G indicate small pits where the endothelial pillars originate. (I–K) Intraluminal view of 3D reconstruction of ccm2 CRISPR embryo reveals the intraluminal pillars honeycombing the lumen and the accumulated red blood cells (I). Erythrocytes were not imaged in J to reveal pillars and the area within the box in (J) was magnified in (K), and arrowhead indicates the intravascular pillar. Endothelial cells and red blood cells were labeled by EGFP or DsRed respectively in Tg(fli1:EGFP) embryos. Scale bar: 20 µm.

Three-dimensional exterior view of caudal venous plexus (CVP) of 2 days post fertilization (dpf) ccm2 CRISPR embryo.

Note pits on the surface and that the CVP is partitioned into several dilated areas.

Three-dimensional interior view of caudal venous plexus (CVP) of 2 days post fertilization (dpf) ccm2 CRISPR embryo.

Note the endothelial pillars within the lumen and accumulated red blood cells.

Ablation of intravascular pillars reverts the dilated CVP phenotype

The multiple dilated compartments and sluggish blood flow suggested that this phenotype could be due to obstruction of free flow of erythrocytes by the meshwork of intravascular pillars. In support of this idea, we observed that spontaneous regression of an existing pillar was accompanied by reduced dilation of the CVP (Figure 3A through D). In addition, the trapped erythrocytes began to circulate freely. This rapid relief of both vessel dilation and blood stagnation suggested that the aberrant pillars may form a physical barrier thus resulting in accumulation of erythrocytes in dilated cavernous structures. To directly test the role of obstruction by intravascular pillars in dilation, we used targeted short pulses of near-infrared laser light to sever the pillars, a technique that generates negligible heat transfer and collateral damage to neighboring tissues (Nishimura et al., 2006). There was near instantaneous reduction of the dilated vessel diameter (93.4 µm) to near-normal dimensions (69.4 µm) in the example shown (Figure 3E and F, Video 5). In three such independent experiments, severing these pillars resulted in a 29 ± 4% reduction in vessel diameter (p=0.0004, two-tailed t-test). Thus, the pillars are an underlying cause of the CVP dilation observed in ccm2 CRISPR embryos.
Figure 3.

Intravascular pillars obstruct blood flow leading to vessel dilation in ccm2 CRISPR embryos.

(A through D) Time lapse images reveal spontaneous retraction of an intravascular pillar leading to re-entry of blood cells into circulation and reduced dilation of the caudal vein. Endothelial cells were labeled by mCherry, and their nucleus and some red blood cells were labeled by EGFP in the Tg(fli1:nEGFP) embryos. The retracted pillar is outlined by dotted lines for emphasis. Note that pillar retraction and vessel dilation were temporally correlated. (E and F) Laser ablation of pillar reduced caudal venous plexus (CVP) diameter. The diameter of the dilated vein (E) was reduced after ablation (F). Note the pillars indicated by arrows in (E) are gone after ablation in (F). Dashed line indicates the diameter of the vein before and after ablation. Scale bar: 50 µm.

A ccm2 embryo displayed heart dilation but no CVP dilation (A, A’, and A”) compared with a ccm2 embryo (B, B’, and B”). A ccm2 morphant displayed heart dilation but no CVP dilation (C, C, and C”) compared with a control morphant (D, D, and D”). Scale bar: 500 µm (A, B, C, and D), 200 µm (A’, B’, C’, and D’), 50 µm (A”, B”, C”, and D”).

Video 5.

Laser ablation of intussusception reduced the vessel diameter.

Intravascular pillars obstruct blood flow leading to vessel dilation in ccm2 CRISPR embryos.

(A through D) Time lapse images reveal spontaneous retraction of an intravascular pillar leading to re-entry of blood cells into circulation and reduced dilation of the caudal vein. Endothelial cells were labeled by mCherry, and their nucleus and some red blood cells were labeled by EGFP in the Tg(fli1:nEGFP) embryos. The retracted pillar is outlined by dotted lines for emphasis. Note that pillar retraction and vessel dilation were temporally correlated. (E and F) Laser ablation of pillar reduced caudal venous plexus (CVP) diameter. The diameter of the dilated vein (E) was reduced after ablation (F). Note the pillars indicated by arrows in (E) are gone after ablation in (F). Dashed line indicates the diameter of the vein before and after ablation. Scale bar: 50 µm.

Both ccm2 null mutants and morphants displayed heart dilation but no caudal venous plexus (CVP) dilation on 2 days post fertilization (dpf).

A ccm2 embryo displayed heart dilation but no CVP dilation (A, A’, and A”) compared with a ccm2 embryo (B, B’, and B”). A ccm2 morphant displayed heart dilation but no CVP dilation (C, C, and C”) compared with a control morphant (D, D, and D”). Scale bar: 500 µm (A, B, C, and D), 200 µm (A’, B’, C’, and D’), 50 µm (A”, B”, C”, and D”).

Blood flow and red blood cells are required for CVP dilation

The importance of the pillars in CVP dilation suggested that obstruction of blood flow was responsible for the phenotype. Consistently, as noted above, ccm2 CRISPR embryos displaying CVP dilation did not show heart dilation. Conversely, segmental CVP dilation was absent in ccm2 null mutants or ccm2 morphants that exhibit characteristic heart dilation (Figure 3—figure supplement 1). These observations suggest that a normally pumping heart and thus normal blood flow is required for CVP dilation. To investigate the role of blood flow, we took advantage of the capacity of zebrafish embryos to obtain sufficient oxygen by diffusion to survive temporarily in the absence of circulating blood. We induced a silent heart phenotype by using a troponin T (tnnt) morpholino, resulting in ~65% reduction in the frequency of CVP dilation (Figure 4A). We also reasoned that the meshwork of pillars would not obstruct fluid flow but would present a barrier to free passage of erythrocytes. Reduction of erythrocytes using morpholinos directed against gata1(Galloway et al., 2005) or tif1-γ (Monteiro et al., 2011) transcription factors produced a similar dramatic reduction in the CVP dilation (Figure 4A). These data indicate that the meshwork of pillars obstructs the passage of erythrocytes in flowing blood resulting in multiple erythrocyte-filled cavernous chambers that dilate the CVP.
Figure 3—figure supplement 1.

Both ccm2 null mutants and morphants displayed heart dilation but no caudal venous plexus (CVP) dilation on 2 days post fertilization (dpf).

A ccm2 embryo displayed heart dilation but no CVP dilation (A, A’, and A”) compared with a ccm2 embryo (B, B’, and B”). A ccm2 morphant displayed heart dilation but no CVP dilation (C, C, and C”) compared with a control morphant (D, D, and D”). Scale bar: 500 µm (A, B, C, and D), 200 µm (A’, B’, C’, and D’), 50 µm (A”, B”, C”, and D”).

Figure 4.

Blood flow is required for pillar formation and vessel dilation.

Morpholinos targeting tnnt, gata1, tif1gamma, or a control morpholino were co-injected with ccm2 guide and Cas9 RNA. (A) Reduction of blood flow in tnnt morphants (A, B, C) resulted in reduced caudal venous plexus (CVP) dilation (A) and intravascular honeycombing (B, C) in 2 days post fertilization (dpf) ccm2 CRISPR Tg(fli1:EGFP) embryos. Arrows indicate intussusceptions. Scale bar: 100 µm. (A) Loss of erythrocytes in gata1 or tif1gamma morphant ccm2 CRISPR embryos also reduced the incidence of CVP dilation. p-Values were calculated using one-way ANOVA. **p<0.01. Error bars indicate SD. (D and E) At 23 hpf, ccm2 CRISPR Tg(klf2a:H2b-EGFP) embryos displayed a mosaic increase of EGFP expression in endothelial cells in the CVP (D), compared with cas9 mRNA control embryos (E). Scale bar: 25 µm. (F) Quantification of the EGFP fluorescence intensity using ImageJ. A total of 20 nuclei were analyzed from ccm2 CRISPR embryos, and 16 nuclei were analyzed from control embryos. Note that 11 nuclei in CRISPR embryo displayed intensity above 3000, while all of the nuclei in control embryo are below 3000. (G) ccm2 CRISPR and tnnt morpholino-injected Tg(klf2a:H2b:EGFP 2 dpf) embryos displayed a mosaic increase of endothelial nuclear EGFP expression in dorsal vein. Scale bar: 50 µm. In A through C, EGFP expression was driven by klf2a promoter in Tg(klf2a:H2b:EGFP) embryo, and endothelial cells were labeled by mcherry in Tg(kdrl:mcherry) transgenic line. Arrows indicated the endothelial nuclei with increased EGFP, and arrowheads indicated the other endothelial nuclei along the ventral wall of dorsal vein.

(A and A’) A ccm2 morphant displayed an increase of endothelial nuclear EGFP KLF2a reporter expression, whereas a tnnt morphant displayed a decrease of endothelial nuclear EGFP KLF2a reporter expression compared with a control morpholino-injected embryo (C and C’). EGFP expression was driven by klf2a promoter in Tg(klf2a:H2b-EGFP), and endothelial cells were labeled by mcherry in Tg(kdrl:mcherry). Arrows indicated the endothelial cell nucleus. Scale bar: 50 µm.

Blood flow is required for pillar formation and vessel dilation.

Morpholinos targeting tnnt, gata1, tif1gamma, or a control morpholino were co-injected with ccm2 guide and Cas9 RNA. (A) Reduction of blood flow in tnnt morphants (A, B, C) resulted in reduced caudal venous plexus (CVP) dilation (A) and intravascular honeycombing (B, C) in 2 days post fertilization (dpf) ccm2 CRISPR Tg(fli1:EGFP) embryos. Arrows indicate intussusceptions. Scale bar: 100 µm. (A) Loss of erythrocytes in gata1 or tif1gamma morphant ccm2 CRISPR embryos also reduced the incidence of CVP dilation. p-Values were calculated using one-way ANOVA. **p<0.01. Error bars indicate SD. (D and E) At 23 hpf, ccm2 CRISPR Tg(klf2a:H2b-EGFP) embryos displayed a mosaic increase of EGFP expression in endothelial cells in the CVP (D), compared with cas9 mRNA control embryos (E). Scale bar: 25 µm. (F) Quantification of the EGFP fluorescence intensity using ImageJ. A total of 20 nuclei were analyzed from ccm2 CRISPR embryos, and 16 nuclei were analyzed from control embryos. Note that 11 nuclei in CRISPR embryo displayed intensity above 3000, while all of the nuclei in control embryo are below 3000. (G) ccm2 CRISPR and tnnt morpholino-injected Tg(klf2a:H2b:EGFP 2 dpf) embryos displayed a mosaic increase of endothelial nuclear EGFP expression in dorsal vein. Scale bar: 50 µm. In A through C, EGFP expression was driven by klf2a promoter in Tg(klf2a:H2b:EGFP) embryo, and endothelial cells were labeled by mcherry in Tg(kdrl:mcherry) transgenic line. Arrows indicated the endothelial nuclei with increased EGFP, and arrowheads indicated the other endothelial nuclei along the ventral wall of dorsal vein.

Klf2a expression is regulated by ccm2 expression and by blood flow.

(A and A’) A ccm2 morphant displayed an increase of endothelial nuclear EGFP KLF2a reporter expression, whereas a tnnt morphant displayed a decrease of endothelial nuclear EGFP KLF2a reporter expression compared with a control morpholino-injected embryo (C and C’). EGFP expression was driven by klf2a promoter in Tg(klf2a:H2b-EGFP), and endothelial cells were labeled by mcherry in Tg(kdrl:mcherry). Arrows indicated the endothelial cell nucleus. Scale bar: 50 µm. As shown in Figure 2, the sprouts that form the ventral vein are lost in the dilated region of the CVP. Because CVP development in tnnt morphants is nearly normal (Choi et al., 2011), we inspected the regions of the CVP displaying loss of ventral sprouting in tnnt morphant ccm2 CRISPR embryos. In 11 such embryos, in spite of the defective ventral sprouting and ventral vein formation, we observed no intravascular pillars. This result suggests that blood flow, in addition to causing the CVP dilation, is required for intussusceptive pillar formation (Figure 4B and C) as it is for normal CVP arborization (Karthik et al., 2018). Inactivation of either ccm1 or ccm2 markedly upregulates expression of KLF2, a flow-regulated transcription factor required for normal cardiovascular development and for CCM formation (Renz et al., 2015; Zhou et al., 2015; Zhou et al., 2016). In situ hybridization revealed that klf2a was also upregulated in the CVP of ccm2 CRISPR embryos (Figure 4—figure supplement 1). We used a klf2a reporter line, Tg(klf2a:H2AEGFP), together with an endothelial cell-specific marker line (Tg(kdrl:mcherry)) to observe the activity of the klf2a promoter. Ccm2 morphants displayed a generalized increase in klf2a reporter expression (Figure 4—figure supplement 2A and A’), whereas the absence of blood flow in the tnnt morphant caused much reduced reporter expression in endothelial cells (Figure 4—figure supplement 2B and B’; Figure 4—figure supplement 2C and C’). Consistent with previous reports (Parmar, 2006; Renz et al., 2015), these opposing changes confirm that ccm2 and flow can regulate expression of KLF2a. In 23 hpf ccm2 CRISPR embryos, examined prior to onset of blood flow, a patchy increase in klf2a reporter expression was observed in ccm2 CRISPR endothelial cells (Figure 4D), whereas reporter expression was uniformly low in control embryos at the same stage (Figure 4E). A quantitative analysis revealed a subpopulation of high KLF2a-expressing endothelial cells in ccm2 CRISPR embryos that was absent in control embryos (Figure 4F). Furthermore, in tnnt morphant 2 dpf ccm2 CRISPR embryos, there was also a striking mosaic increase in endothelial klf2a reporter expression (Figure 4G). Thus, dilation was associated with the patchy upregulation of a flow-sensitive transcription factor, KLF2, in the ccm2 CRISPR CVP. Taken together, these results suggest that patchy KLF2 expression in combination with blood flow leads to formation of these dilated RBC-filled multi-cavernous lesions in the CVP.
Figure 4—figure supplement 1.

Whole mount in situ hybridization showed mosaic upregulation of klf2a expression in ccm2 CRISPR embryos (left) compared to that of control (right).

Figure 4—figure supplement 2.

Klf2a expression is regulated by ccm2 expression and by blood flow.

(A and A’) A ccm2 morphant displayed an increase of endothelial nuclear EGFP KLF2a reporter expression, whereas a tnnt morphant displayed a decrease of endothelial nuclear EGFP KLF2a reporter expression compared with a control morpholino-injected embryo (C and C’). EGFP expression was driven by klf2a promoter in Tg(klf2a:H2b-EGFP), and endothelial cells were labeled by mcherry in Tg(kdrl:mcherry). Arrows indicated the endothelial cell nucleus. Scale bar: 50 µm.

Mosaic upregulation of KLF2a is sufficient for cavernoma formation in CVP

The patchy increase in KLF2a expression in the CVP endothelial cells of ccm2 CRISPR embryos and requirement for blood flow suggested the possibility that these two factors led to the formation of cavernomas in the CVP. To address the role of KLF2, we injected klf2a and klf2b morpholinos and observed reversal of both CVP dilation and heart dilation in the ccm2 CRISPR embryos (Figure 5A). Furthermore, ccm2 CRISPR treatment of klf2a embryos caused no CVP dilation (Figure 5—figure supplement 1). Thus, klf2a is required for the CVP dilation phenotype.
Figure 5.

Mosaic KLF2a expression caused caudal venous plexus (CVP) dilation.

(A) Both the CVP dilation and heart dilation were rescued by injection of klf2 morpholinos in 2 days post fertilization (dpf) ccm2 CRISPR embryos. **p<0.01. Error bars indicate SD. (B) pCS2-KLF2a linearized DNA-injected 2.5 dpf embryos displayed CVP dilation, whereas injection of a DNA fragment containing a DNA binding domain deleted ΔKLF2a mutant showed normal development. Arrow indicates the CVP dilation and retained erythrocytes. Scale bar: 1 mm. (C) Quantification of the prevalence of CVP dilation following KLF2a or ΔKLF2a overexpression. The mean and SD are shown. (D) Representative images show the honeycombed lumen and dilated CVP in 1.5 dpf KLF2a-injected embryo and normal CVP of ΔKLF2a-injected embryo. Arrow indicates honeycombing. Scale bar: 100 µm.

Total number of embryos in each group is indicated on the graph. ***p<0.0001. Two-tailed Fisher’s exact test was used for comparisons.

Figure 5—figure supplement 1.

Reduced caudal venous plexus (CVP) dilation in ccm2 CRISPR klf2a embryos.

Total number of embryos in each group is indicated on the graph. ***p<0.0001. Two-tailed Fisher’s exact test was used for comparisons.

Mosaic KLF2a expression caused caudal venous plexus (CVP) dilation.

(A) Both the CVP dilation and heart dilation were rescued by injection of klf2 morpholinos in 2 days post fertilization (dpf) ccm2 CRISPR embryos. **p<0.01. Error bars indicate SD. (B) pCS2-KLF2a linearized DNA-injected 2.5 dpf embryos displayed CVP dilation, whereas injection of a DNA fragment containing a DNA binding domain deleted ΔKLF2a mutant showed normal development. Arrow indicates the CVP dilation and retained erythrocytes. Scale bar: 1 mm. (C) Quantification of the prevalence of CVP dilation following KLF2a or ΔKLF2a overexpression. The mean and SD are shown. (D) Representative images show the honeycombed lumen and dilated CVP in 1.5 dpf KLF2a-injected embryo and normal CVP of ΔKLF2a-injected embryo. Arrow indicates honeycombing. Scale bar: 100 µm.

Reduced caudal venous plexus (CVP) dilation in ccm2 CRISPR klf2a embryos.

Total number of embryos in each group is indicated on the graph. ***p<0.0001. Two-tailed Fisher’s exact test was used for comparisons. In ccm2 CRISPR embryos, KLF2a was both upregulated in a mosaic fashion and required for CVP dilation; we therefore asked whether mosaic upregulation of KLF2a expression per se causes cavernoma formation. Mosaic overexpression was accomplished by injecting a plasmid encoding KLF2a into Tg(fli1:EGFP) embryos; ~6% of such embryos displayed CVP dilation compared to control embryos injected with ΔKLF2a plasmid expressing KLF2a with a deleted DNA binding domain (Oates et al., 2001; Figure 5B and C). Affected embryos exhibited intussusceptions within the CVP lumen accompanied by dilation (Figure 5D). These observations show that mosaic upregulation of KLF2a expression is sufficient for cavernoma formation when blood is flowing.

Mosaic expression of ccm2 causes KLF2a-dependent cavernoma formation

ccm2 CRISPR caused mosaic inactivation of ccm2 and the dilated CVP phenotype, whereas global inactivation of ccm2 in ccm2 null mutants or ccm2 morphants does not. We therefore questioned whether mosaicism, per se, played a role in the CVP dilation. To test this idea, we globally reduced ccm2 expression by co-injecting a sublethal dose of ccm2 morpholino with the ccm2 gRNA CRISPR mixture. The chosen morpholino dose did not increase the frequency of observable heart defects; however, the percentage of embryos displaying CVP dilation decreased dramatically (Figure 6A). We then reasoned that because ccm2 acts as a scaffold connecting krit1 to ccm3 (Stahl et al., 2008), the overexpression of ccm2 might have a dominant negative effect. Indeed, when we injected linearized DNA containing ccm2 fused to m-Orange, ccm2 mosaic overexpression led to CVP dilation and aberrant intussusceptions similar to those observed in ccm2 CRISPR embryos in ~8% of embryos (Figure 6B and B’). In sharp contrast, injection of a plasmid encoding a loss of krit1 binding function ccm2(L197R) mutant (Kleaveland et al., 2009) resulted in of embryos displaying a normal vascular development (Figure 6C and C’). Importantly, mosaic overexpression of ccm2 caused significantly less CVP dilation in klf2a embryos (Figure 6—figure supplement 1). Thus, mosaicism for ccm2 expression causes klf2a-dependent formation of multi-cavernous erythrocyte-filled structures in the CVP. Combined with the capacity of mosaic expression of klf2a to cause CVP dilation, these results show that mosaic expression of CCM2 leads to mosaic KLF2a expression and abortive intussusceptive angiogenesis that obstructs the lumen to form these cavernoma-like lesions.
Figure 6.

Mosaic ccm2 expression caused caudal venous plexus (CVP) dilation.

(A) Low-dose ccm2 morpholino reduced the incidence of CVP dilation but did not significantly increase heart dilation in ccm2 CRISPR embryos. (B and C) Mosaic ccm2 but not inactive ccm2(L197E) overexpression caused CVP dilation. Arrows indicate pillars in the CVP. (B’ and C’) Mosaic expression of mOrange-tagged ccm2 or ccm2(L197E). Scale bar: 100 µm. Error bars are ± SD.

The 200 ng/μl linearized DNA fragment containing CMV promoter, ccm2 coding sequence, and SV40 was injected into one-cell stage embryos. Total number of embryos in each group is indicated on the graph. The klf2aembryos exhibited a significant (p=0.0218) reduction in CVP dilation. Two-tailed Fisher’s exact test was used for comparisons.

Figure 6—figure supplement 1.

Reduced caudal venous plexus (CVP) dilation in CCM2 over expressing klf2a embryos.

The 200 ng/μl linearized DNA fragment containing CMV promoter, ccm2 coding sequence, and SV40 was injected into one-cell stage embryos. Total number of embryos in each group is indicated on the graph. The klf2aembryos exhibited a significant (p=0.0218) reduction in CVP dilation. Two-tailed Fisher’s exact test was used for comparisons.

Mosaic ccm2 expression caused caudal venous plexus (CVP) dilation.

(A) Low-dose ccm2 morpholino reduced the incidence of CVP dilation but did not significantly increase heart dilation in ccm2 CRISPR embryos. (B and C) Mosaic ccm2 but not inactive ccm2(L197E) overexpression caused CVP dilation. Arrows indicate pillars in the CVP. (B’ and C’) Mosaic expression of mOrange-tagged ccm2 or ccm2(L197E). Scale bar: 100 µm. Error bars are ± SD.

Reduced caudal venous plexus (CVP) dilation in CCM2 over expressing klf2a embryos.

The 200 ng/μl linearized DNA fragment containing CMV promoter, ccm2 coding sequence, and SV40 was injected into one-cell stage embryos. Total number of embryos in each group is indicated on the graph. The klf2aembryos exhibited a significant (p=0.0218) reduction in CVP dilation. Two-tailed Fisher’s exact test was used for comparisons.

CCMs in adult zebrafish

The foregoing data indicated that mosaic inactivation of ccm2 results in a multi-cavernous lesion in the embryonic CVP that resembles mammalian CCM in gross architecture and dependence on KLF2. We then asked if authentic CCM would develop in the ~50% of ccm2 CRISPR embryos that developed with a normal gross morphology and survived to adulthood. Brain vascular lesions were observed in virtually all of these adult ccm2 CRISPR zebrafish (Figure 7A and C) and not in control fish (Figure 7E and G). In order to image the lesions at the whole brain level, clear, unobstructed brain imaging cocktails and computational analysis (CUBIC) was applied to these brains, and the transparent brains were scanned by light sheet microscopy (Figure 7B,D,F and H). The distribution of lesions included cerebrum, cerebellum, brain stem, and, in some fish, the spinal cord (Figure 7I). This distribution pattern is similar to that found in patients (Goldstein and Solomon, 2017). Hematoxylin and eosin stained sections showed dilated multi-cavernous vascular channels filled with nucleated erythrocytes and lacking mature vessel wall angioarchitecture (Figure 7J). Perl’s Prussian blue staining indicated prior hemorrhage adjacent to the lesions (Figure 7K). These histological findings were absent in control fish (Figure 7L and M) and resemble those in CCM patients (Figure 7N and O; Cox et al., 2017). A dramatic reduction in CCM was seen in ccm2 CRISPR in klf2a zebrafish (Steed et al., 2016; Figure 7P) consistent with previous murine studies in which inactivation of Klf2 prevented CCM formation (Zhou et al., 2016). In addition, similar to humans, these adult zebrafish also developed extracranial lesions (Figure 7—figure supplement 1).
Figure 7.

Adult ccm2 CRISPR zebrafish develop typical cerebral cavernous malformation (CCM) lesions.

The ~50% of ccm2 CRISPR fish that survived developed highly penetrant CCMs (A and C). Arrows indicate superficial lesions on dorsal (A) and ventral (C) surface of the brain. Note hemorrhage into the ventricles. Lesions are absent in control embryos (E and G). Clear, unobstructed brain imaging cocktails and computational analysis (CUBIC) clearing (B, D, F, H) enables visualization of CCM burden by light sheet microscopy. Arrows indicate the lesions that corresponded to those seen in bright field, and arrowhead indicates a deeper lesion. L: left, R: right. Scale bar: 1 mm. (I) Cavernomas were dispersed throughout the central nervous system including cerebrum, cerebellum, brain stem, and spinal cord. (J) Hematoxylin and eosin (H&E) stained brain section reveals nucleated erythrocytes filling a dilated vessel with adjacent Prussian blue stained iron deposition (K) in ccm2 CRISPR fish and the absence of lesions or iron deposition in control fish (L, M). (N, O) A CCM from a patient stained with H&E (N) or Prussian blue (O). Note similar appearance to the zebrafish lesion shown in (J, K). Arrow indicates dilated vessel. Scale bar: 50 µm. (P) CCMs were significantly reduced in ccm2 CRISPR adult fish on klf2a background compared to that on klf2a background. Total number of embryos in each group is indicated. p=0.0076. Two-tailed Fisher’s exact test was used for comparison.

Casper fish embryos were injected with ccm2 CRISPR and raised to 2.5 months. Arrows indicated the dilated vessels in the body wall. Scale bar: 1 cm.

At 24 hpf, ccm2 CRISPR embryos were treated with 45 μM Y-27632(Tocris) in egg water as described by Uehata et al. (Nature: 389 (1997) pp. 990–994) and controls were treated with 1% DMSO. At 2 days post fertilization (dpf), in contrast to DMSO-treated embryos, no embryos treated with Y-27632 exhibited CVP dilation (**p=0.0098) or other obvious developmental anomalies. Total number of embryos in each group is indicated above the bars. Two-tailed Fisher’s exact test was used for comparisons.

Figure 7—figure supplement 1.

Ccm2 CRISPR adult fish displayed body wall lesions.

Casper fish embryos were injected with ccm2 CRISPR and raised to 2.5 months. Arrows indicated the dilated vessels in the body wall. Scale bar: 1 cm.

Adult ccm2 CRISPR zebrafish develop typical cerebral cavernous malformation (CCM) lesions.

The ~50% of ccm2 CRISPR fish that survived developed highly penetrant CCMs (A and C). Arrows indicate superficial lesions on dorsal (A) and ventral (C) surface of the brain. Note hemorrhage into the ventricles. Lesions are absent in control embryos (E and G). Clear, unobstructed brain imaging cocktails and computational analysis (CUBIC) clearing (B, D, F, H) enables visualization of CCM burden by light sheet microscopy. Arrows indicate the lesions that corresponded to those seen in bright field, and arrowhead indicates a deeper lesion. L: left, R: right. Scale bar: 1 mm. (I) Cavernomas were dispersed throughout the central nervous system including cerebrum, cerebellum, brain stem, and spinal cord. (J) Hematoxylin and eosin (H&E) stained brain section reveals nucleated erythrocytes filling a dilated vessel with adjacent Prussian blue stained iron deposition (K) in ccm2 CRISPR fish and the absence of lesions or iron deposition in control fish (L, M). (N, O) A CCM from a patient stained with H&E (N) or Prussian blue (O). Note similar appearance to the zebrafish lesion shown in (J, K). Arrow indicates dilated vessel. Scale bar: 50 µm. (P) CCMs were significantly reduced in ccm2 CRISPR adult fish on klf2a background compared to that on klf2a background. Total number of embryos in each group is indicated. p=0.0076. Two-tailed Fisher’s exact test was used for comparison.

Ccm2 CRISPR adult fish displayed body wall lesions.

Casper fish embryos were injected with ccm2 CRISPR and raised to 2.5 months. Arrows indicated the dilated vessels in the body wall. Scale bar: 1 cm.

Inhibiting Rho kinase blocks caudal venous plexus (CVP) cavernoma formation in ccm2 CRISPR zebrafish.

At 24 hpf, ccm2 CRISPR embryos were treated with 45 μM Y-27632(Tocris) in egg water as described by Uehata et al. (Nature: 389 (1997) pp. 990–994) and controls were treated with 1% DMSO. At 2 days post fertilization (dpf), in contrast to DMSO-treated embryos, no embryos treated with Y-27632 exhibited CVP dilation (**p=0.0098) or other obvious developmental anomalies. Total number of embryos in each group is indicated above the bars. Two-tailed Fisher’s exact test was used for comparisons.

Discussion

Familial CCM lesions form as a consequence of mosaic complete inactivation of CCM1, -2, or -3. Here, we have used Cas9-CRISPR mutagenesis to create such a mosaicism for ccm2 in zebrafish and show that surviving adult ccm2 CRISPR animals develop brain and extracranial lesions that closely resemble those observed in humans with CCM. In ~30% of embryos, we observed a novel phenotype, the formation of segmental dilatation of the caudal vein associated with slowed blood flow and formation of multiple markedly dilated blood-filled chambers, resembling a multi-cavernous CCM. These lesions are caused by intussusceptive intraluminal pillars that obstruct the passage or erythrocytes resulting in the development of multiple dilated blood-filled chambers. These pillars form as a consequence of a combination of blood flow and mosaic overexpression of a flow-dependent transcription factor, KLF2a, leading to aberrant flow sensing in the developing CVP. In sum, our studies describe a zebrafish model for CCM and provide a new mechanism that can explain the formation of the characteristic multi-cavernous lesions seen in humans.

The role of blood flow in CVP dilation

The segmental dilation of the CVP is due to intussusceptive pillars that fail to fuse normally, thus honeycombing the vein lumen and obstructing the free flow of erythrocytes. Evidence for the role of obstruction includes the marked slowing of blood flow within the lesions, dependence of dilation on blood flow and erythrocytes, and the relief of dilation by spontaneous or induced regression of the pillars. Intussusceptive angiogenesis differs from sprouting angiogenesis by splitting the existing vessel intraluminally as a response to increased blood flow (Djonov et al., 2003; Egginton et al., 2001). Recent elegant studies have shown that localized reduction in fluid shear stress occurs adjacent to intussusceptive pillars and is associated with the formation of new pillars that align with existing pillars (Karthik et al., 2018). These observations suggested that these blood flow patterns are responsible for the formation of the aligned pillars required for orderly fusion to split the vessel in two (Karthik et al., 2018). Similar to physiological intussusceptive angiogenesis, the hallmark pits and intraluminal pillars were also observed in the CVP of ccm2 CRISPR embryos; however, these pillars failed to undergo orderly fusion to split the vessel. We propose that this failure to undergo orderly fusion and CVP arborization is due to mosaic overexpression of klf2a, a flow-sensitive transcription factor, thus disrupting the required orderly flow signaling (Karthik et al., 2018). The meshwork formed by these intraluminal endothelial pillars partitions the patent lumen into multiple blood-filled chambers (Figure 3I and J, Videos 2 and 3). As more and more RBCs accumulate, the CVP becomes dilated (Video 1). In contrast to the necessity of blood flow for formation of the multi-cavernous CVP lesions, in ccm2 CRISPR zebrafish, blood flow suppresses endothelial proliferation and simple vessel dilation in krit1 global null zebrafish (Rödel et al., 2019). As shown here, vessels mosaic for expression of a CCM gene require blood flow to form the intravascular pillars that obstruct blood flow and cause multi-cavernous lesions. Previous studies termed dilated capillaries Stage 1 CCM and multi-cavernous lesions Stage 2 CCM (Zeineddine et al., 2019). The differential flow requirements for formation of dilated vessels and multi-cavernous lesions in zebrafish suggest that the Stage 1 and Stage 2 forms of CCM can employ distinct pathogenetic mechanisms.

Ccm2 mosaicism causes multi-cavernous malformations

Initially we ascribed the absence of segmental CVP dilation in ccm2 null fish (Mably et al., 2006; Renz et al., 2015) solely to the reduced blood flow caused by the dilated heart. This explanation is insufficient because rescue of the heart phenotype in global krit1 (ccm1) null fish was not reported to cause segmental CVP dilation or CCMs (Rödel et al., 2019). Normal intussusceptive angiogenesis requires an orderly patterning of high and low flow signaling (Karthik et al., 2018). Ccm2 mosaicism causes a random upregulation of klf2a, a key effector of flow signaling, thereby disrupting this orderly patterning of flow signaling. In contrast, the global knockout uniformly upregulates klf2a so that the patterning of other flow-sensitive signals can guide the completion of the intussusceptive arborization. The dilated multi-cavernous CVP lesions described here resemble multi-cavernous CCM (McDonald et al., 2011) and their formation required mosaicism. Recent studies found that multi-cavernous murine CCMs are mosaic for inactivation of Ccm3 (Detter et al., 2018; Malinverno et al., 2019). The mouse studies emphasized that simply dilated vessels are not mosaic and contained only Ccm3 null endothelial cells (Detter et al., 2018; Malinverno et al., 2019). Mosaicism in multi-cavernous murine CCM was ascribed to recruitment of wild-type cells to the clonal CCM (Detter et al., 2018; Malinverno et al., 2019). Importantly, the mouse studies did not address the mechanism by which multi-cavernous lesions form. Here, we have shown that mosaicism is a prerequisite for formation of multi-cavernous CVP lesions because it disorganizes the flow signaling required for orderly sprouting and intussusceptive angiogenesis that remodel the CVP.

Ccm2 CRISPR zebrafish are an authentic CCM model

As in humans (Akers et al., 2009; McDonald et al., 2011), the fish CCM lesions arise as a consequence of mosaic inactivation of CCM genes. Second, as in humans, chronic bleeding leads to iron deposition; this finding contrasts with the lack of iron deposition seen in acute mouse CCM models (Zeineddine et al., 2019). Third, similar to humans, histologically typical lesions are distributed throughout the CNS in contrast to the hindbrain-restricted lesions in acute mouse models (Zeineddine et al., 2019). Fourth, as is true in mouse models (Cuttano et al., 2016; Zheng et al., 2014), the development of CCM depends on klf2a, the orthologue of murine Klf2 and paralogue of Klf4, indicating that they form by the same pathogenetic mechanism. That said, in contrast to the KLF2 dependence of CVP dilation, injection of a KLF4 morpholino (Li et al., 2011) did not rescue this lesion (our unpublished data). There are chronic sensitized mouse models which do exhibit hemosiderin deposits and lesions throughout the CNS (McDonald et al., 2011); however, these models require cumbersome breeding schemes and mice of more than 3 months of age. That said, a recent report that postnatal induction of brain endothelial cell-specific ablation of the Ccm2 gene using the inducible Slco1c1-CreERT2 mouse results in iron deposits around CCM throughout the murine brain at 3 months of age has great promise (Cardoso et al., 2020). In contrast to existing mouse models, the present model uses CRISPR-Cas9 to generate highly penetrant typical lesions throughout the CNS, requires about 2 months, and can be induced in mutant strains without additional breeding. Thus, this model should be a useful tool in future studies to assess the effect of the many genetic manipulations possible in zebrafish (Gore et al., 2018) on the pathogenesis of CCM and to provide a complement to pharmacological screens directed at the dilated heart phenotype of ccm1 or ccm2 mutant fish (Otten et al., 2018). In sum, the present work reveals a new embryonic vascular malformation, a multi-cavernous dilation of the CVP that resembles multi-cavernous Stage 2 CCM. The CVP malformation requires blood flow and mosaic inactivation of ccm2 and is caused by abortive intussusceptive angiogenesis as a consequence of imbalanced flow signaling. The high penetrance and resemblance of the embryonic CVP malformation to multi-cavernous CCM suggest that it will be a useful phenotype for pharmacological or morpholino-based analyses. That said, the CVP does lack CNS accessory cells, such as astrocytes (Lopez-Ramirez et al., 2021), that promote CCM development. Indeed, we recently reported that propranolol blocks the embryonic CVP malformation by β1 adrenergic receptor antagonism (Li et al., 2021), a result that comports with the beneficial effects of propranolol in murine CCM models (Li et al., 2021; Oldenburg et al., 2021) and in anecdotal reports in humans (Lanfranconi et al., 2020; Reinhard et al., 2016). We have found that blockade or Rho kinase also ameliorates the CVP lesion (Figure 7—figure supplement 2) as it does murine CCM (McDonald et al., 2012). In addition, we report a tractable zebrafish model of CNS CCM that mimics the mammalian disease in mosaicism, lesion histology and distribution, and dependence on KLF2 transcription factors. A particularly appealing feature of these two new zebrafish models is that disease pathogenesis can be studied on mutant backgrounds without the need for additional breeding. Manipulations that ameliorate the embryonic lesion can then readily be tested for effects on the formation of brain CCMs that occur in the 50% of ccm2 CRISPR embryos that survive to adulthood.
Figure 7—figure supplement 2.

Inhibiting Rho kinase blocks caudal venous plexus (CVP) cavernoma formation in ccm2 CRISPR zebrafish.

At 24 hpf, ccm2 CRISPR embryos were treated with 45 μM Y-27632(Tocris) in egg water as described by Uehata et al. (Nature: 389 (1997) pp. 990–994) and controls were treated with 1% DMSO. At 2 days post fertilization (dpf), in contrast to DMSO-treated embryos, no embryos treated with Y-27632 exhibited CVP dilation (**p=0.0098) or other obvious developmental anomalies. Total number of embryos in each group is indicated above the bars. Two-tailed Fisher’s exact test was used for comparisons.

Materials and methods

Zebrafish lines and husbandry

Zebrafish were maintained and with approval of Institutional Animal Care and Use Committee of the University of California, San Diego. The following mutant and transgenic lines were maintained under standard conditions: ccm2 (Mably et al., 2006), klf2a (Steed et al., 2016), Tg(fli1:EGFP) (Lawson and Weinstein, 2002), Tg(gata1:dsred) (Traver et al., 2003), Tg(fli1:negfp) (Roman et al., 2002), Tg(klf2a:H2b-EGFP) (Heckel et al., 2015), Tg(kdrl:mcherry) (Jin et al., 2005), and casper (White et al., 2008). See Expanded Materials and Methods for morpholino injections. Morpholinos sequences are shown in Supplementary file 1 (Morpholino sequences). Plasmids pCS2-nls-zCas9-nls (47929) and pT7-gRNA (46759) were bought from Addgene. Crispr RNA (crRNA) sequences were listed in Supplementary file 2 (crRNA sequences for zebrafish ccm2). Target gRNA constructs were generated as described before (Jao et al., 2013). PCS2-morangeccm2, pCS2-morangeccm2 mutant(L197R), pCS2-morangeklf2a, pCS2-morangeΔklf2a were cloned by infusion (Clontech) as follows: mOrange was cloned into ClaI, and linker sequence (5’-ggcagcgcgggcagcgcggcgggcagcggcgaattt-3’) between ClaI and EcoRI. Then ccm2, L197R mutant, klf2a or Δklf2a sequence were cloned into EcoRI, respectively. These plasmids were then double-digested by SalI and NotI (NEB), and the fragment containing CMV promoter and coding sequence were purified and 0.5 nl of a 200 ng/μl solution was injected into single cell embryos. Primer sequences are listed in Supplementary file 3 (Primers for template DNA synthesis).

RNA synthesis

For cas9 mRNA, pCS2-nls-zCas9-nls was digested by NotI and then purified by column (Macherey-Nagel) as template. Capped nls-zCas9-nls RNA was synthesized using mMESSAGE mMACHINE SP6 Transcription Kit (Thermo Fisher Scientific) and purified through lithium chloride precipitation described in the same kit. For gRNA synthesis, gRNA constructs were linearized by BamHI digestion and purified by column (Macherey-Nagel). gRNA was synthesized by in vitro transcription using MEGAshortscript T7 Transcription kit (Thermo Fisher Scientific) and purified by alcohol precipitation described in the same kit. The concentration of nls-zCas9-nls RNA and gRNA were measured by NanoDrop 1000 Spectrophotometer (Thermo Fisher Scientific), and their quality was confirmed by electrophoresis through a 1% (wt/vol) agarose gel. The final concentrations for RNA injection are as follows: cas9 750 ng/μl, gRNA 120 ng/μl, and injection volume is 0.5 nl.

Whole mount in situ hybridization

Zebrafish embryos were collected at 48 hpf and fixed with 4% paraformaldehyde overnight. In situ hybridization was performed as described before (Thisse and Thisse, 2008). The hybridization temperature is 68°C, and the probe concentration is 1 ng/μl. For primers used to amplify the template DNA for probe synthesis, see Expanded Materials and Methods. The images for in situ hybridization were captured by Olympus MVX10, Macro-view.

Airyscan imaging and 3D reconstruction

Embryos for imaging were anesthetized with egg water containing 0.016% tricaine (3-amino benzoic acid ethyl ester, Sigma-Aldrich) and then embedded in 1% low melting point agarose (Invitrogen 16520050). Imaging was performed with Zeiss 880 Airyscan confocal under the standard Airyscan mode, and a 20×/NA 0.8 objective was used. Maximum projection was performed with ZEN (Zeiss). 3D reconstruction was performed with Volocity (PerkinElmer).

Laser ablation of intravascular pillars

Laser ablation of intravascular pillars was performed using targeted ultrafast laser pulses that were generated with a multi-pass Ti:Al2O3 amplifier of local construction that followed a previously published design (Nishimura et al., 2006) and operated at a 5 kHz pulse rate. The ablation beam and the imaging beam were combined with a polarizing beamsplitter (Nishimura et al., 2006) prior to the microscope objective. The two beams were focused in the same focal plane and the ablation beam was centered in the area that is raster-scanned by the imaging beam so that ablation occurred at the center of the TPLSM imaging field. The energy per pulse of the ablation beam was tuned with neutral density filters and the quantity of pulses was controlled by a mechanical shutter (Uniblitz LS3Z2 shutter and VMM-D1 driver; Vincent). The energy and number of pulses was adjusted based on damage evaluated from the real-time TPLSM images and ranged between 0.2 and 0.4 μJ.

Live imaging of endothelial pillar ablation

Live images of the fish vessels were obtained with a two-photon laser scanning microscope of local design (Nishimura et al., 2006), which was adapted to include an ablation beam. Low-energy, 100 fs, 76 MHz pulses for TPLSM were generated by a Titanium:Sapphire laser oscillator (Mira F-900; Coherent Inc) that was pumped by a continuous wave laser (Verdi V-10 Nd:YVO4 laser; Coherent Inc). The imaging laser pulses were scanned in a raster pattern by galvanometric mirrors that are relay-imaged to the rear aperture of the objective. The two-photon excited fluorescence is reflected by a dichroic mirror and transmitted to a photomultiplier tube. To produce laser pulses for ablation while imaging, we employed a Pockels cell (QS-3 with NVP-525D driver and DD1 timing circuit; Quantum Technologies) to reroute 1 in 76,000 pulses from the oscillator pulse train to seed a multipass Titanium:Sapphire amplifier that is pumped by a Q-switched laser (Corona; Coherent). A half-wave plate (λ/2) rotates the polarization of the amplified pulses to lie perpendicular to that of the laser oscillator and thus permits both the ablation beam and the imaging beam to be routed to the microscope objective with a polarizing beamsplitter. We used a 25×/NA 0.95, water immersion objective (Olympus) for imaging and ablation.

Histology

Hematoxylin and eosin stain and Perl’s Prussian blue stain were performed as described (Zeineddine et al., 2019).

Zebrafish brain dissection, CUBIC treatment, and light sheet imaging

Zebrafish brain dissection was performed as previously described (Gupta and Mullins, 2010). CUBIC was optimized on the basis of previous report (Susaki et al., 2015). The brains were fixed with pH 7.5 4% PFA for 24 hr and then washed with PBS for 24 hr. After PBS wash, CUBICR1 treatment was then performed at 37°C in water bath for 42 hr. Samples were imaged in CUBICR2 as medium with ZEISS Lightsheet Z.1. Scanning was performed with 5× dual illumination optics and 5× objective.

Statistical analysis

Statistical analysis was performed with GraphPad Prism. p-Values were calculated by paired two-tailed Student’s t-test unless otherwise specifically indicated. The mean and SD were shown in the bar graphs. In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses. Thank you for submitting your article "Abortive Intussusceptive Angiogenesis Causes Multi-Cavernous Vascular Malformations" for consideration by eLife. Your article has been reviewed by 4 peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by Edward Morrisey as the Senior Editor. The following individuals involved in review of your submission have agreed to reveal their identity: Victoria L Bautch (Reviewer #2); Brent Derry (Reviewer #3). The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission. All the reviewers agree that the paper has potential but they also ask for relevant revision. More specifically: 1. A detailed discussion on the working hypothesis on the role of flow and mosaicism on CCM lesion development. 2. The use of the fish model presented here for a high throughput screening of thousands of drugs looks indeed a very difficult if not impossible task. Would the authors be able to answer to this criticism? 3. Statistic is also poor and, in many cases, missing. This is a crucial aspect of the study and should be better reported and described. The paper therefore warrants publication in eLife but revision is needed. Please see the full reviews below for further comments. As the editors have judged that your manuscript is of interest, but as described below that additional experiments are required before it is published, we would like to draw your attention to changes in our revision policy that we have made in response to COVID-19 (https://elifesciences.org/articles/57162). First, because many researchers have temporarily lost access to the labs, we will give authors as much time as they need to submit revised manuscripts. We are also offering, if you choose, to post the manuscript to bioRxiv (if it is not already there) along with this decision letter and a formal designation that the manuscript is "in revision at eLife". Please let us know if you would like to pursue this option. (If your work is more suitable for medRxiv, you will need to post the preprint yourself, as the mechanisms for us to do so are still in development.) Reviewer #1: Li et al. present a new model of CCM in Z.fish using mosaic inactivation of ccm2 through Crisp technique. Vascular malformations develop in the Caudal venous plexus in the embryos and in the central nervous system of the embryos surviving to adulthood. These malformations in the Caudal venous plexus form for aberrant intussusception and depend on flow, accumulation of erythrocytes and mosaic upregulation of klf2. The authors propose this model for large pharmacological screening of CCM phenotype-correcting drugs. The first step would test compounds on malformations in the Caudal venous plexus of Z. fish embryos. The following validation step would test the malformations in the CNS of the mutant adults. The model is skillfully presented. However, the interpretation of the mechanism is not fully supported by the experimental data which appear often more suggestive than conclusive. 1. The morphological features and some of the mechanisms directing the formation of vascular malformations in Z. fish embryos are studied in details, while those in the central nervous system of adults are only shown to depend on the expression of klf2. To which extent is the mechanism driving the lesions in the Caudal venous plexus modeling that in the CNS? Are the lesions in the CNS depending on blood flow and erythrocyte accumulation and do they show abortive intussusception as in the Caudal venous plexus? In addition, do vascular malformations in the Caudal venous plexus show increased permeability and hemorrhages as those in the CNS? Organ-specific microenvironment strongly influences endothelial responses. Therefore, the issues above should be defined for comprehensively describe the biology of the model and for supporting the validity of the two-step screening proposed. Most importantly, the limits of the intussusceptive mechanism of lesion formation in Z. fish Caudal venous plexus as a model for human cavernomas in the CNS are neither tested nor demonstrated. 2. While the advantages of using Z. fish for direct and rapid in vivo analysis of CCM lesions is appealing some caveats are evident. Is Z. fish equally sensitive to mosaic deletion of ccm1 and ccm3 as to ccm2? The literature about the effects of mutation of CCM genes in Z. fish, well summarized by the authors, indicates that Z. fish could react in a peculiar way to the mutation of different CCM genes. This can limit the use of Z. fish as a model of human cavernomas. 3. 'Mosaic upregulation of KLF2a is sufficient for cavernoma formation in CVP'. Mosaic upregulation of klf2 induces malformation in the Caudal venous plexus in 6% of the embryos. This is a small percentage compared to 30% ccm2 Crisp embryos developing malformations in Caudal venous plexus. This different efficiency should be explained. Is the level of overexpressed klf2 in the range reached by klf2 after ccm2 deletion? Where is this overexpressed klf2 actually localized? Is this overexpressed klf2 localized in the pillars of the vascular malformation? Is the endogenous klf2 upregulated in the pillars of the vascular malformations of ccm2 Crisp embryos? This is not visible in Figure 4D. In addition, is the mosaic increase of klf2 able to induce malformations in the CNS in the adult? 4. Do the malformations contain ccm2 null endothelial cells? No direct evidence is presented, besides the rescuing of the dilated CVP phenotype by ccm2-mRNA. Do the lesion-free areas of the Caudal venous plexus contain equal density of ccm2 null endothelial cells as in lesion areas? 5. Statistical analysis needs be shown to support the reproducibility of the data presented in Figure 3 E and F. Which was the range of reduction of vein diameter after pillar ablation and how many embryos were used to reproduce this result? This aspect needs to be strengthened has much of the model interpretation is based on the role of intraluminal pillar in obstructing blood flow and causing vessel dilation. 6. In several figures presenting morphologic data statistical analysis is missing and should be added. Figure 6A, B, C quantification of the immunofluorescence results is lacking. How many endothelial cells show upregulation of klf2 in ccm2 Crisp? No control of Figure 6B is shown. 7. How would erythrocytes contribute to the formation/dilation of the cavernae? Would this be a mechanical effect or would erythrocytes convey other signals to endothelial cells? Are erythrocytes present in the cavernae ccm2 null? 8. It is not clear what come first: both erythrocyte null and heart-silenced ccm2 crisp show reduction of dilated CVP. Do erythrocytes circulate in silenced heart Z. fish? In addition, how is klf2 regulated in erythrocytes null and heart-silenced ccm2 Crisp Z. fish? 9. Are the embryos developing malformations in the CVP surviving? If yes, are the cavernoma in the Caudal venous plexus persisting? 10. When and how do the cavernomas form in the brain of the surviving fishes? This is a significant aspect to define in this model, as cavernomas in the central nervous system are the malformations with pathological consequences in humans. How long do these mutant adults survive? 11. In murine models klf4 is also required for cavernoma formation. Is the same true for Z. fish? Reviewer #2: The paper by Li et al. investigates the effects of mosaic manipulation of CCM2 in zebrafish embryos and adult fish, and describes a CVP dilation linked to intussusceptive angiogenesis in embryos and neurovascular lesions in adult fish. The primary finding is that mosaic deletion of CCM2 leads to differences in flow-mediated responses of EC that lead to the embryonic phenotype, and that it occurs in the context of intussusceptive angiogenesis. These findings are well-supported by genetic, morpholino (MO) and pharmacological analysis and overall careful and rigorous analysis. The novelty is substantial in both findings and experimental approach (CRISPR/Cas induced mosaicism) and provides explanations for some of the disease phenotypes. However, there are some issues that, if addressed, would substantially improve the work: 1. I understand why the adult phenotype is presented, and it does show validity of the adult fish as a model. However, in terms of mechanism, it raises interesting questions that were not adequately addressed – for example, how do lesions form in a tissue that is not known to undergo intussusceptive angiogenesis? Is Klf2 expression also mosaic in the adult fish brains? Can the fish be used to generate mosaic Klf2 over-expression and determine effects in the adult independent of CCM2 manipulation? 2. Many of the statements regarding the data in the Results and Discussion are stated as facts rather than presented as conclusions – there are too many to enumerate, but examples: p. 18: "first zebrafish model of CCM"; p. 19: "pillars failed…to split due to mosaic over-expression of klf2a….". The work is very rigorous but all experiments have caveats. The Discussion is also very focused on why the adult fish is a good model for clinical CCM, and many interesting aspects of the bulk of the work presented in the embryo are not addressed. For example, why is mosaic loss but not global loss of flow-sensing proposed to lead to the phenotype? Are the mechanisms the same in vessel beds that do not undergo intussusceptive angiogenesis? What is the effect of the CCM complex vs. CCM2 alone? 3. The work is quite novel and exciting; however, it is difficult to keep track of the different manipulations and combination of manipulations, and this is exacerbated by very poor labeling of figures and descriptions in figure legends. Many of the Y-axis labels merely say "% phenotype" with no context for complex combinations of manipulations. Images are not well labeled for stains/reporters. There is no documentation that most experiments were mosaic for deletion, which is central to the model put forward – the labels suggest global LOF. Suggest use (or figure out if this is new) a nomenclature for mosaic deletion and use consistently. Please be clear about GOF vs. LOF manipulations. Reviewer #3: This manuscript describes a mosaic model of ccm2 deletion in zebrafish. The authors report defects in the vasculature including dilations in the caudal venous plexus (CVP) and cranial vessels (CV), as well as previously described vascular and heart defects. Confocal imaging and 3D reconstruction showed defective lumenization of endothelial pillars, resulting in multiple chambers that accumulate blood and suggest incomplete intussusceptive angiogenesis. Laser ablation of defective pillars relieved dilation and restored blood flow, suggesting that the pillars caused dilated CVP and flow defects. They demonstrate that blood flow is required for the dilation of CVP and intussusceptive pillar formation in mosaic ccm2 mosaics, which casts doubt on a recent study showing that blood flow actually suppresses vascular anomalies in zebrafish harboring a germline krit1 (CCM1) knockout (PMID: 31495257). Furthermore, they show that erythrocyte accumulation in defective CVP drives their dilation. They convincingly demonstrate that mosaicism accounts for CVP dilation by co-injection of a sublethal dose of ccm2 morpholino with the CRISPR mix. They go on to show that upregulation of the Klf2 transcription factor, which acts downstream of Ccm2, accounts for dilation of CVP in ccm2 mosaic mutants. This impedes the flow signaling required for intussusceptive angiogenesis that remodels the CVP and likely explains how these lesions form in human CCM patients. Finally, ccm2 mosaic fish that did not exhibit vascular anomalies eventually develop lesions in their brain vasculature and spinal cords by adulthood. This study shows that mosaicism is a pre-requisite for formation of multi-cavernous lesions and provides the first zebrafish model that accurately recapitulates the disease in humans. This is an important advance in our understanding of the genesis of CCM lesions that should be suitable for publication after a few concerns are addressed. 1. Do actin stress fibers form and/or does pMLC increase in endothelial cells of lesions? This would highlight conservation of CCM lesion mechanisms between fish and human. 2. Since the authors have previously shown that inhibition of Rho kinase can suppress lesion formation in mouse models it would be nice to see if this is also true in their mosaic zebrafish model. 3. While the authors show that mosaic overexpression of klf2a is responsible for the formation of vascular defects in the CVP of ccm2 mosaic fish, they do not show this when Ccm2 is overexpressed (Figure 5B). Therefore, they should inject linearized ccm2 fused to mOrange into the klf2a mutants to see if these embryos also fail to develop CVP dilations. 4. In the text the authors state that CCM lesions were not observed when ccm2 was edited in klf2a-/- mutants, but in Figure 7P they report 1/10 embryos with lesions. The text should be amended to reflect this result, as it misrepresents their conclusions. 5. There has been a bit of controversy in the zebrafish community regarding the use of "Crispants" and morpholinos versus germline mutants that the authors should acknowledge (ie PMID: 32968253). I have no issues with the interpretation of data in this study since they performed rescue experiments but given the differences in phenotypes compared with germline mutants this needs to be discussed. Reviewer #4: Wenqing Li et al. introduce a novel mechanism that may cooperate in the formation of malberry vascular development in CCM2 deficient Zebra fish. These authors claim that in the caudal venous plexus, mosaic inactivation of CCM2 together with a patchy upregulation of klf2a results in the formation of pillars that create a partial obstruction of the blood flow due to red cell accumulation in the lumen. Morphologically, the pillars mimic intussusceptive angiogenesis and this alters the correct development of the vasculature. In CCM deficient fish the pillars are unable to fully cross the lumen and create multi-cavernous malberry-like malformations. Overall, these morphological observations are of interest and introduce partially novel concepts. However: – I am not convinced that this model is better than the mouse models available. It is a complex, time limited and variable condition. The percentage of fish resulting affected is relatively low and this prevents the use of this model for high throughput screening of thousands of compounds, as proposed by the authors. – Not all the conclusions are substantiated by previous work in the mouse. For instance, the authors underline that klf2a is the major effector of cavernoma formation in the fish, while in mice klf4 is equally or even more important. – Most importantly, there are no data showing that the formation of pillars and abortive angiogenesis also occur in CCM2 deficient mammals. Reviewer #1: […] The model is skillfully presented. However, the interpretation of the mechanism is not fully supported by the experimental data which appear often more suggestive than conclusive. 1. The morphological features and some of the mechanisms directing the formation of vascular malformations in Z. fish embryos are studied in details, while those in the central nervous system of adults are only shown to depend on the expression of klf2. To which extent is the mechanism driving the lesions in the Caudal venous plexus modeling that in the CNS? Our data show that both CNS and CVP lesions arise following mosaic inactivation of a CCM gene and depend on klf2a. We agree that there are important differences between the environment of the brain and the CVP and have inserted the following comment to emphasize this point: “That said, the CVP does lack CNS accessory cells, such as astrocytes,(Lopez-Ramirez et al., 2021) that promote CCM development.” We have also cited a recently published report that development of the CVP lesion, like the brain CCM, is inhibited by propranolol. Our previous work showed that blocking Rho Kinase would decrease CCM in a mouse model and, in an experiment suggested by referee 3, we now show that blocking Rho Kinase inhibits the CVP lesion (Figure 7—figure supplement 2). Are the lesions in the CNS depending on blood flow and erythrocyte accumulation and do they show abortive intussusception as in the Caudal venous plexus? In addition, do vascular malformations in the Caudal venous plexus show increased permeability and hemorrhages as those in the CNS? Organ-specific microenvironment strongly influences endothelial responses. Therefore, the issues above should be defined for comprehensively describe the biology of the model and for supporting the validity of the two-step screening proposed. Most importantly, the limits of the intussusceptive mechanism of lesion formation in Z. fish Caudal venous plexus as a model for human cavernomas in the CNS are neither tested nor demonstrated. Addressing this concern would require imaging the human disease at high resolution as it develops, which is presently not technically feasible. 2. While the advantages of using Z. fish for direct and rapid in vivo analysis of CCM lesions is appealing some caveats are evident. Is Z. fish equally sensitive to mosaic deletion of ccm1 and ccm3 as to ccm2? The literature about the effects of mutation of CCM genes in Z. fish, well summarized by the authors, indicates that Z. fish could react in a peculiar way to the mutation of different CCM genes. This can limit the use of Z. fish as a model of human cavernomas. We have not been able to identify candidate guide RNAs for ccm3. Five candidate ccm1 guide RNAs (Reviewer Table) failed to produce sufficient indels. We were therefore unable to do these experiments; however, we note that CCM1 and CCM2 function as a complex and the phenotypic effects of their loss in mammals and zebrafish have been indistinguishable. 3. 'Mosaic upregulation of KLF2a is sufficient for cavernoma formation in CVP'. Mosaic upregulation of klf2 induces malformation in the Caudal venous plexus in 6% of the embryos. This is a small percentage compared to 30% ccm2 Crisp embryos developing malformations in Caudal venous plexus. This different efficiency should be explained. The degree and sites of mosaicism in the KLF2a over expression and ccm2 CRISPR experiments are random. Similarly, the abundance of over-expressed KLF2a per cell is also random. Thus, frequencies of CVP dilation can vary between the two approaches. Is the level of overexpressed klf2 in the range reached by klf2 after ccm2 deletion? As mentioned above, there is considerable variability in the quantity of KLF2a over-expressed in each cell. Furthermore, there is no easy way to compare the over-expression of mOrange-KLF2a with the increase in KLF2a promoter-driven GFP expression in the ccm2 CRISPR experiment. Where is this overexpressed klf2 actually localized? Is this overexpressed klf2 localized in the pillars of the vascular malformation? Is the endogenous klf2 upregulated in the pillars of the vascular malformations of ccm2 Crisp embryos? We have no access to an antibody against fish KLF2a that could be used for this purpose. 4. Do the malformations contain ccm2 null endothelial cells? No direct evidence is presented, besides the rescuing of the dilated CVP phenotype by ccm2-mRNA. Do the lesion-free areas of the Caudal venous plexus contain equal density of ccm2 null endothelial cells as in lesion areas? In the transient over-expression of KLF2a and in ccm2 CRISPR experiments, we did not have antibodies available to visualize the CCM2 and KLF2. 5. Statistical analysis needs be shown to support the reproducibility of the data presented in Figure 3 E and F. Which was the range of reduction of vein diameter after pillar ablation and how many embryos were used to reproduce this result? This aspect needs to be strengthened has much of the model interpretation is based on the role of intraluminal pillar in obstructing blood flow and causing vessel dilation. We report: “In 3 such independent experiments, severing these pillars resulted in a 29± 4% reduction in vessel diameter (p=0.0004, two-tailed T test).” 6. In several figures presenting morphologic data statistical analysis is missing and should be added. Figure 6A, B, C quantification of the immunofluorescence results is lacking. How many endothelial cells show upregulation of klf2 in ccm2 Crisp? No control of Figure 6B is shown. We have added statistical analysis throughout the paper. In response to referee 2 we have relocated the KLF2a reporter data to Figure 4 in the revised paper. In Figure 4F we now show a quantitative analysis of reporter expression that documents the mosaic upregulation of KLF2a in ccm2 CRISPR fish relative to controls. 7. How would erythrocytes contribute to the formation/dilation of the cavernae? Would this be a mechanical effect or would erythrocytes convey other signals to endothelial cells? Are erythrocytes present in the cavernae ccm2 null? Nucleated erythrocytes, ~8μm in diameter, are trapped in the meshwork of intussusceptive pillars, wherein plasma can still circulate. In addition, by increasing the viscosity of blood, erythrocytes can contribute to the shear forces that drive intussusception. 8. It is not clear what come first: both erythrocyte null and heart-silenced ccm2 crisp show reduction of dilated CVP. Do erythrocytes circulate in silenced heart Z. fish? When the heart is stopped, blood circulation ceases. 9. Are the embryos developing malformations in the CVP surviving? If yes, are the cavernoma in the Caudal venous plexus persisting? We note (e.g. Abstract line 3) that we are describing a “novel lethal multi-cavernous lesion in the embryonic caudal venous plexus (CVP).” 10. When and how do the cavernomas form in the brain of the surviving fishes? This is a significant aspect to define in this model, as cavernomas in the central nervous system are the malformations with pathological consequences in humans. How long do these mutant adults survive? Lesions form in the brain by 6 weeks post fertilization. Unfortunately, at the stage, the zebrafish are no longer transparent so we cannot easily observe the process in real time. 11. In murine models klf4 is also required for cavernoma formation. Is the same true for Z. fish? We found that a published KLF4 morpholino did not prevent CVP dilation in ccm2 CRISPR fish (Reviewer Figure) and mention this result in the discussion. Reviewer #2: […] 1. I understand why the adult phenotype is presented, and it does show validity of the adult fish as a model. However, in terms of mechanism, it raises interesting questions that were not adequately addressed – for example, how do lesions form in a tissue that is not known to undergo intussusceptive angiogenesis? Is Klf2 expression also mosaic in the adult fish brains? Can the fish be used to generate mosaic Klf2 over-expression and determine effects in the adult independent of CCM2 manipulation? We agree that the question of whether the mechanism we have observed in the CVP occurs in the brain is of great interest. That said, because we cannot visualize development of the brain lesions in real time, we cannot establish this point. Similarly, generating a mosaic KLF2a expressing adult fish would be a useful experiment. That said, since the loss of klf2a, completely inhibited adult CCM formation, this time consuming experiment is not urgent and is beyond the present scope. 2. Many of the statements regarding the data in the Results and Discussion are stated as facts rather than presented as conclusions – there are too many to enumerate, but examples: p. 18: "first zebrafish model of CCM". We have removed any reference to “the first” (e.g. in the Abstract). p. 19: "pillars failed…to split due to mosaic over-expression of klf2a….". The work is very rigorous but all experiments have caveats. The Discussion is also very focused on why the adult fish is a good model for clinical CCM, and many interesting aspects of the bulk of the work presented in the embryo are not addressed. For example, why is mosaic loss but not global loss of flow-sensing proposed to lead to the phenotype? We have addressed this important question at several point in the Discussion with respect to perturbed flow signaling and with respect to mosaicism. Are the mechanisms the same in vessel beds that do not undergo intussusceptive angiogenesis? What is the effect of the CCM complex vs. CCM2 alone? We indirectly addressed this issue by showing that over-expression of wild type ccm2 but not ccm2(L197R) cause CVP dilation (Figure 6B and B’). CCM2(L197R) does not bind KRIT1 and is therefore not incorporated into the CCM complex. 3. The work is quite novel and exciting; however, it is difficult to keep track of the different manipulations and combination of manipulations, and this is exacerbated by very poor labeling of figures and descriptions in figure legends. Many of the Y-axis labels merely say "% phenotype" with no context for complex combinations of manipulations. Images are not well labeled for stains/reporters. There is no documentation that most experiments were mosaic for deletion, which is central to the model put forward – the labels suggest global LOF. Suggest use (or figure out if this is new) a nomenclature for mosaic deletion and use consistently. Please be clear about GOF vs. LOF manipulations. Thank you for this comment. We have revised the paper and changed all of the ordinates to clearly state the phenotype.. Reviewer #3: […] 1. Do actin stress fibers form and/or does pMLC increase in endothelial cells of lesions? This would highlight conservation of CCM lesion mechanisms between fish and human. 2. Since the authors have previously shown that inhibition of Rho kinase can suppress lesion formation in mouse models it would be nice to see if this is also true in their mosaic zebrafish model. We now report (Figure 7—figure supplement 2) that, like mammalian CCM, inhibiting Rho kinase blocks development of the zebrafish CVP lesion. 3. While the authors show that mosaic overexpression of klf2a is responsible for the formation of vascular defects in the CVP of ccm2 mosaic fish, they do not show this when Ccm2 is overexpressed (Figure 5B). Therefore, they should inject linearized ccm2 fused to mOrange into the klf2a mutants to see if these embryos also fail to develop CVP dilations. We report that there is a marked reduction CVP dilation when ccm2 is over expressed in klf2a mutants (Figure 6—figure supplement 1) 4. In the text the authors state that CCM lesions were not observed when ccm2 was edited in klf2a-/- mutants, but in Figure 7P they report 1/10 embryos with lesions. The text should be amended to reflect this result, as it misrepresents their conclusions. Done. 5. There has been a bit of controversy in the zebrafish community regarding the use of "Crispants" and morpholinos versus germline mutants that the authors should acknowledge (ie PMID: 32968253). I have no issues with the interpretation of data in this study since they performed rescue experiments but given the differences in phenotypes compared with germline mutants this needs to be discussed. We agree that this is an important issue and stress that the klf2a loss of function experiments were performed on both mutants and morphants. Secondly, the CVP dilation phenotype was rescued by re-expression of CCM2 (Figure 1G), thus controlling for off target effects of CRISPR. Reviewer #4: […] – I am not convinced that this model is better than the mouse models available. It is a complex, time limited and variable condition. The percentage of fish resulting affected is relatively low and this prevents the use of this model for high throughput screening of thousands of compounds, as proposed by the authors. We have now modified the final paragraph of the discussion to remove any implication that this phenotype could be used for high throughput screening while emphasizing its potential utility in targeted genetic or pharmacological analyses. We suggest that the fish model has unique virtues as argued in the last paragraph of the discussion. – Not all the conclusions are substantiated by previous work in the mouse. For instance, the authors underline that klf2a is the major effector of cavernoma formation in the fish, while in mice klf4 is equally or even more important. We have not been able to substantiate a role for KLF4 in the zebrafish CVP lesion (Reviewer Figure) and have so stated in the paper. We were unaware of data showing that KLF4 in more important than KLF2 in the mammalian CCM or that either was essential for human CCM. – Most importantly, there are no data showing that the formation of pillars and abortive angiogenesis also occur in CCM2 deficient mammals. True, since the paper is describing zebrafish models.
Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Gene (Danio rerio)ccm2http://www.ensembl.org/ENSDARG00000013705
Gene (Danio rerio)klf2ahttp://www.ensembl.org/ENSDARG00000042667
Strain, strain background (Danio rerio)ccm2m201zfin.orgZDB-ALT-980203–523
Strain, strain background (Danio rerio)klf2aig4zfin.orgZDB-ALT-161103–5
Strain, strain background (Danio rerio)Tg(fli1:EGFP)y1zfin.orgZDB-ALT-011017–8
Strain, strain background (Danio rerio)Tg(gata1:dsred)sd2zfin.orgZDB-ALT-051223–6
Strain, strain background (Danio rerio)Tg(klf2a:H2b-EGFP)zfin.orgZDB-ALT-161017–10
Strain, strain background (Danio rerio)Tg(fli1:negfp)y7zfin.orgZDB-ALT-060821–4
Strain, strain background (Danio rerio)Tg(kdrl:mcherry)is5zfin.orgZDB-ALT-110127–25
Recombinant DNA reagentpCS2-nls-zCas9-nlsaddgene.org47929
Recombinant DNA reagentpT7-gRNAaddgene.org46759
Commercial assay or kitmMESSAGE mMACHINE SP6 Transcription KitThermo Fisher Scientific Wlatham, MAAM1340
Commercial assay or kitMEGAshortscript T7 Transcription kitThermo Fisher Scientific, Waltham, MAAM1333
Sequence-based reagentcrRNA-1This paperccm2 gRNAGGTGTTTCTGAAAGGGGAGA
Sequence-based reagentcrRNA-2This paperccm2 gRNAGGAGAAGGGTAGGGATAAGA
Sequence-based reagentcrRNA-3This paperccm2 gRNAGGGTAGGGATAAGAAGGCTC
Sequence-based reagentcrRNA-4This paperccm2 gRNAGGACAGCTGACCTCAGTTCC
Chemical compound, drugccm2-MOzfin.orgZDB-MRPHLNO-060821–3GAAGCTGAGTAATACCTTAACTTCC
Chemical compound, drugtnnt-MOzfin.orgZDB-MRPHLNO-060317–4CATGTTTGCTCTGATCTGACACGCA
Chemical compound, druggata1-MOzfin.orgZDB-MRPHLNO-050208–10CTGCAAGTGTAGTATTGAAGATGTC
Chemical compound, drugtif1γ -MOafin.orgZDB-MRPHLNO-110321–1GCTCTCCGTACAATCTTGGCCTTTG
Chemical compound, drugklf2a-MOafin.orgZDB-MRPHLNO-100610–8GGACCTGTCCAGTTCATCCTTCCAC
Chemical compound, drugklf2b-MOzfin.orgZDB-MRPHLNO-150427–1AAAGGCAAGGTAAAGCCATGTCCAC
SoftwareVolocityPerkinElmer Waltham, MAVolocity
SoftwareZENZeiss, Oberkochen, GermanZEN 2.3 SP1
SoftwareImageJ softwareImageJ (http://imagej.nih.gov/ij/)RRID:SCR_003070
SoftwareGraphPad Prism softwareGraphPad Prism (https://graphpad.com)Prism five for WindowsVersion 5.01
  54 in total

1.  Unorthodox angiogenesis in skeletal muscle.

Authors:  S Egginton; A L Zhou; M D Brown; O Hudlická
Journal:  Cardiovasc Res       Date:  2001-02-16       Impact factor: 10.787

2.  Fasudil decreases lesion burden in a murine model of cerebral cavernous malformation disease.

Authors:  David A McDonald; Changbin Shi; Robert Shenkar; Rebecca A Stockton; Feifei Liu; Mark H Ginsberg; Douglas A Marchuk; Issam A Awad
Journal:  Stroke       Date:  2011-10-27       Impact factor: 7.914

3.  A novel mouse model of cerebral cavernous malformations based on the two-hit mutation hypothesis recapitulates the human disease.

Authors:  David A McDonald; Robert Shenkar; Changbin Shi; Rebecca A Stockton; Amy L Akers; Melanie H Kucherlapati; Raju Kucherlapati; James Brainer; Mark H Ginsberg; Issam A Awad; Douglas A Marchuk
Journal:  Hum Mol Genet       Date:  2010-10-11       Impact factor: 6.150

4.  Cerebral Cavernous Malformations Develop Through Clonal Expansion of Mutant Endothelial Cells.

Authors:  Matthew R Detter; Daniel A Snellings; Douglas A Marchuk
Journal:  Circ Res       Date:  2018-10-26       Impact factor: 17.367

5.  The cerebral cavernous malformation pathway controls cardiac development via regulation of endocardial MEKK3 signaling and KLF expression.

Authors:  Zinan Zhou; David R Rawnsley; Lauren M Goddard; Wei Pan; Xing-Jun Cao; Zoltan Jakus; Hui Zheng; Jisheng Yang; J Simon C Arthur; Kevin J Whitehead; Dean Li; Bin Zhou; Benjamin A Garcia; Xiangjian Zheng; Mark L Kahn
Journal:  Dev Cell       Date:  2015-01-26       Impact factor: 12.270

6.  Developmental timing of CCM2 loss influences cerebral cavernous malformations in mice.

Authors:  Gwénola Boulday; Noemi Rudini; Luigi Maddaluno; Anne Blécon; Minh Arnould; Alain Gaudric; Françoise Chapon; Ralf H Adams; Elisabetta Dejana; Elisabeth Tournier-Lasserve
Journal:  J Exp Med       Date:  2011-08-22       Impact factor: 14.307

7.  Propranolol inhibits cavernous vascular malformations by β1 adrenergic receptor antagonism in animal models.

Authors:  Wenqing Li; Robert Shenkar; Mathew R Detter; Thomas Moore; Christian Benavides; Rhonda Lightle; Romuald Girard; Nicholas Hobson; Ying Cao; Yan Li; Erin Griffin; Carol Gallione; Joseph M Zabramski; Mark H Ginsberg; Douglas A Marchuk; Issam A Awad
Journal:  J Clin Invest       Date:  2021-02-01       Impact factor: 19.456

8.  Disruption of acvrl1 increases endothelial cell number in zebrafish cranial vessels.

Authors:  Beth L Roman; Van N Pham; Nathan D Lawson; Magdalena Kulik; Sarah Childs; Arne C Lekven; Deborah M Garrity; Randall T Moon; Mark C Fishman; Robert J Lechleider; Brant M Weinstein
Journal:  Development       Date:  2002-06       Impact factor: 6.868

9.  Propranolol Reduces the Development of Lesions and Rescues Barrier Function in Cerebral Cavernous Malformations: A Preclinical Study.

Authors:  Joppe Oldenburg; Matteo Malinverno; Maria Ascencion Globisch; Claudio Maderna; Monica Corada; Fabrizio Orsenigo; Lei Liu Conze; Charlotte Rorsman; Veronica Sundell; Maximiliano Arce; Ross O Smith; Anthony C Y Yau; Gry Hulsart Billström; Caroline Öhman Mägi; Galina V Beznoussenko; Alexander A Mironov; Dinesh Fernando; Geoffrey Daniel; Davide Olivari; Francesca Fumagalli; Maria Grazia Lampugnani; Elisabetta Dejana; Peetra U Magnusson
Journal:  Stroke       Date:  2021-02-23       Impact factor: 7.914

10.  Cerebral cavernous malformations arise from endothelial gain of MEKK3-KLF2/4 signalling.

Authors:  Zinan Zhou; Alan T Tang; Weng-Yew Wong; Sharika Bamezai; Lauren M Goddard; Robert Shenkar; Su Zhou; Jisheng Yang; Alexander C Wright; Matthew Foley; J Simon C Arthur; Kevin J Whitehead; Issam A Awad; Dean Y Li; Xiangjian Zheng; Mark L Kahn
Journal:  Nature       Date:  2016-03-30       Impact factor: 49.962

View more
  1 in total

Review 1.  Cerebral Cavernous Malformation Pathogenesis: Investigating Lesion Formation and Progression with Animal Models.

Authors:  Chelsea M Phillips; Svetlana M Stamatovic; Richard F Keep; Anuska V Andjelkovic
Journal:  Int J Mol Sci       Date:  2022-04-30       Impact factor: 6.208

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.