The skeletal muscle mass has been shown to be affected by catecholamines, such as epinephrine (Epi), norepinephrine (NE), and isoproterenol (ISO). On the other hand, lipopolysaccharide (LPS), one of the causative substances of sepsis, induces muscle wasting via toll-like receptors expressed in skeletal muscle. Although catecholamines are frequently administered to critically ill patients, it is still incompletely understood how these drugs affect skeletal muscle during critical illness, including sepsis. Herein, we examined the direct effects of catecholamines on LPS-induced skeletal muscle wasting using the C2C12 myoblast cell line. Muscle wasting induced by catecholamines and/or LPS was analyzed by the use of the differentiated C2C12 myotubes, and its underlying mechanism was explored by immunoblotting analysis, quantitative reverse transcription polymerase chain reaction (qRT-PCR), enzyme-linked immunosorbent assay (ELISA), and the TransAM kit for p-65 NF-κB. Epi augmented myosin heavy chain (MHC) protein loss and reduction of the myotube diameter induced by LPS. LPS induced C/EBPδ protein, Atrogin-1 and inteleukin-6 (IL-6), and these responses were potentiated by Epi. An IL-6 inhibitor, LMT28, suppressed the potentiating effect of Epi on the LPS-induced responses. NF-κB activity was induced by LPS, but was not affected by Epi and recombinant IL-6, and the NF-κB inhibitor, Bay 11-7082, abolished Atrogin-1 mRNA expression induced by LPS with or without Epi. NE and ISO also potentiated LPS-induced IL-6 and Atroign-1 mRNA expression. Carvedilol, a nonselective β-adrenergic receptor antagonist, suppressed the facilitating effects of Epi on the Atrogin-1 mRNA induction by LPS, and abolished the effects of Epi on the MHC protein loss in the presence of LPS. It was concluded that Epi activates the β-adrenergic receptors in C2C12 myotubes and the IL-6-STAT3 pathway, leading to the augmentation of LPS-induced activation of the NF-κB- C/EBPδ-Atrogin-1 pathway and to the exacerbation of myotube wasting.
The skeletal muscle mass has been shown to be affected by catecholamines, such as epinephrine (Epi), norepinephrine (NE), and isoproterenol (ISO). On the other hand, lipopolysaccharide (LPS), one of the causative substances of sepsis, induces muscle wasting via toll-like receptors expressed in skeletal muscle. Although catecholamines are frequently administered to critically illpatients, it is still incompletely understood how these drugs affect skeletal muscle during critical illness, including sepsis. Herein, we examined the direct effects of catecholamines on LPS-induced skeletal muscle wasting using the C2C12 myoblast cell line. Muscle wasting induced by catecholamines and/or LPS was analyzed by the use of the differentiated C2C12 myotubes, and its underlying mechanism was explored by immunoblotting analysis, quantitative reverse transcription polymerase chain reaction (qRT-PCR), enzyme-linked immunosorbent assay (ELISA), and the TransAM kit for p-65 NF-κB. Epi augmented myosin heavy chain (MHC) protein loss and reduction of the myotube diameter induced by LPS. LPS induced C/EBPδ protein, Atrogin-1 and inteleukin-6 (IL-6), and these responses were potentiated by Epi. An IL-6 inhibitor, LMT28, suppressed the potentiating effect of Epi on the LPS-induced responses. NF-κB activity was induced by LPS, but was not affected by Epi and recombinant IL-6, and the NF-κB inhibitor, Bay 11-7082, abolished Atrogin-1 mRNA expression induced by LPS with or without Epi. NE and ISO also potentiated LPS-induced IL-6 and Atroign-1 mRNA expression. Carvedilol, a nonselective β-adrenergic receptor antagonist, suppressed the facilitating effects of Epi on the Atrogin-1 mRNA induction by LPS, and abolished the effects of Epi on the MHC protein loss in the presence of LPS. It was concluded that Epi activates the β-adrenergic receptors in C2C12 myotubes and the IL-6-STAT3 pathway, leading to the augmentation of LPS-induced activation of the NF-κB- C/EBPδ-Atrogin-1 pathway and to the exacerbation of myotube wasting.
Catecholamines, such as epinephrine (Epi), norepinephrine (NE), and isoproterenol (ISO), produce cellular effects through the adrenergic receptors expressed in a variety of tissues, including blood vessels, heart, adipose tissue, and skeletal muscle. Skeletal muscle predominantly expresses the β-adrenergic receptors, especially the β2-subtype [1]. Although several studies reported that stimulation of the β-receptors increased skeletal muscle mass [2], other studies have demonstrated that the blockade of the β receptor is beneficial for protein proteolysis and energy expenditure in skeletal muscle in sepsis [3, 4]. Furthermore, a recent clinical study reported that catecholamine may be one of the risk factors in the development of muscle wasting [5], which constitutes a serious clinical consequence associated with critical illness that results in significant morbidity and mortality [6, 7]. However, it remains to be clarified whether catecholamines can affect skeletal muscle mass in systemic inflammation that constitutes a common problem in critically illpatients.Mechanisms for skeletal muscle wasting have been explored from multiple aspects. Proteolysis in skeletal muscle was shown to be increased owing to the upregulation of the ubiquitin proteasomal pathway (UPP) in several animal sepsis models, including the administration of lipopolysaccharides (LPSs) [8, 9]. It was also reported that LPS induces wasting in myotubes differentiated from a mouse myoblast cell line C2C12 by upregulating UPP via toll-like receptors [10]. Furthermore, it was shown that two muscle-specific E3 ubiquitin ligases, Atrogin-1 and MuRF1, function as essential regulators of UPP, and the increase in their expressions precedes the loss of muscle weight [11]. On the other hand, the STAT3 pathway and NF-κB activation play critical roles in muscle wasting [12]. It was demonstrated that the conditioned media from colon and lung cancer cells induce STAT3 activation and CCAAT/enhancer-binding protein (C/EBP) δ expression in C2C12 cells, leading to an increase in Atrogin-1 expression [13]. C/EBPδ is a transcription factor that mediates stress response and is induced by LPS through NF-κB signaling [14]. There is abundant experimental evidence that proinflammatory cytokines released by innate immune cells and skeletal muscle cells in response to various stresses [15], such as interleukin-6 (IL-6) and tumor necrosis factor-α (TNF-α) in plasma levels which are often elevated in septicpatients [16, 17], are involved in muscle wasting [18].In the present study, we performed in vitro experiments using C2C12 myotubes to evaluate the effects of catecholamines on LPS-induced muscle wasting. We demonstrated that Epi exacerbated LPS-induced myotube wasting by potentiating the NF-κB-mediated activation of the C/EBPδ-Atrogin-1 pathway via the IL-6-STAT3 pathway through activation of the β-adrenergic receptors.
Materials and methods
Cell culture
C2C12 myoblast (ECACC, Salisbury, UK) was maintained in Dulbecco’s modified eagle medium (DMEM) that contained 10% fetal bovine serum at 37°C in 5% CO2. After the cells reached confluence, differentiation was induced by growing the cells in DMEM supplemented with 2% horse serum for 4 days.
Immunoblotting assays
Whole-cell lysates were prepared as described previously [19]. Briefly, whole-cell lysates were prepared by using ice-cold lysis buffer [0.1% SDS, 1% Nonidet P-40 (NP-40), 5 mM EDTA, 150 mM NaCl, 50 mM Tris-Cl (pH 8.0), 2 mM DTT, 1 mM sodium orthovanadate, complete protease inhibitorTM (Roche Diagnostics, Tokyo, Japan) and 1:100 phosphatase inhibitor cocktail (Nacalai Tesque, Kyoto, Japan) based on a protocol described previously [20]. Samples were centrifuged at 11,000 g to form a pellet from the cell debris. An equal amount of protein was fractionated by SDS-PAGE and subjected to an immunoblotting assay. Primary antibodies to phospho-STAT3 (T705) (1:2000; #9145), total-STAT3 (1:1000; #9132), and C/EBPδ (1:1,000; #2318), phospho-p70 S6K (The 389) (1:2000; #9205), total-p70 S6K (1:1000; #9202), phospho-4E-BP1 (The37/46) (1:2000; #2855), total-4E-BP (1:1000; #9644), phospho-CREB (Ser 133) (1:2000; #9198), total-CREB (1:1000; 9197S), were from Cell Signaling Technology (Beverly City, MA, USA). The antibody for myosin heavy chain (MHC) (1:4,000) was from R and D Systems (Minneapolis, MN, USA). Anti-β-actin mouse monoclonal antibody (Sigma-Aldrich, St Louis, MO, USA) was used as a control at 1:4000 dilution. Horseradish peroxidase-conjugated to sheep anti-mouse or donkey anti-rabbit IgG (GE Healthcare, Piscataway, NJ, USA) was used as a secondary antibody at a dilution of 1:2000. The signal was developed with enhanced chemiluminescence reagent (GE Healthcare). Experiments were repeated at least thrice. The intensity of each band was quantified with the software Image J (NIH, Bethesda, MD, USA) and used for subsequent statistical analyses.
First-strand synthesis and RT-PCR were performed using the one-step SYBR PrimeScript RT-PCR kit II (TAKARA, Ohtsu, Japan), according to the manufacturer’s protocol. Amplification and detection were performed using the Applied Biosystems 7300 Real-time PCR system (Applied Biosystems, Foster City, CA, USA). The change in expression of each target messenger ribonucleic acid (mRNA) was calculated relative to the level of 18S ribosomal RNA (rRNA).Primers for detection of mRNA are as follows:Atrogin-1 Forward: 5’—ATGCACACTGGTGCAGAGAG -3’,Reverse: 5’ -TGTAAGCACACAGGCAGGTC -3’,MuRF1 Forward: 5’—CACGAAGACGAGAAGATCAACATC -3’,Reverse: 5’—AGCCCCAAACACCTTGCA -3’,IL-6 Forward: 5’—ACAACCACGGCCTTCCCTACTT -3’,Reverse: 5’—CACGATTTCCCAGAGAACATGTG -3’,TNF-α Forward: 5’—TCAACAACTACTCAGAAACAC -3’,Reverse: 5’—AGAACTCAGGAATGGACAT -3’,IL-1β Forward: 5’—GTGATATTCTCCATGAGCTTTG -3’,Reverse: 5’—TCTTCTTTGGGTATTGCTTG -3’,18 S Forward: 5’—GTAACCCGTTGAACCCCATT -3’,Reverse: 5’—CCATCCAATCGGTAGTAGCG -3’.
Enzyme-linked immunosorbent assay (ELISA)
Conditioned media from C2C12 cells were collected after each treatment. MouseIL-6 in conditioned media was measured using the Mouse ELISA kit (cat. No. M6000B, R&D Systems) according to the manufacturer’s protocol.
Assays of transcription factor activity
To determine the amount of activated p-65 NF-κB, protein extracts were prepared using a nuclear extract kit (cat. No. 40010, ActiveMotif, Rixensart, Belgium). The aqueous amount of protein content was used for transcription factor activity analysis with TransAM kits for p-65 NF-κB (cat. No. 40097, ActiveMotif) according to the manufacturer’s protocol. The amount of active transcription factor was determined by measuring its binding capacity to a consensus binding sequence to assess the specificity of deoxyribonucleic acid (DNA) binding. Data are provided as relative units.
Immunofluorescence
C2C12 cells were cultured on glass coverslips coated with L-Lysine (Nacalai Tesque). On day four of differentiation, myotubes after each treatment were fixed in 4% paraformaldehyde/phosphate buffer solution (PBS). C2C12 myotubes were permeabilized in 0.25% Triton X-100/PBS and blocked in 1% bovine serum albumin/PBS (blocking solution) for 1 h at room temperature. Myotubes were washed with PBS and incubated for 1 h in anti-muscle MHC antibody at a dilution of 1:250, washed with PBS, and incubated in Alexa Flour 488 conjugated goat anti-mouse antibody (Cell Signaling Technology, #4408) for 1 h, and washed with PBS. Antibodies were diluted in blocking solution. The samples were mounted in a 4’, 6-diamidino-2-phenylindole (DAPI)-containing mounting medium. Images were captured with a BZ-9000 fluorescent microscope (Keyence, Osaka, Japan). Representative images for each treatment were selected. The myotube width was measured by BZ II Analyzer software (Keyence). One hundred myotubes per treatment were measured from ten non-overlapping fields-of-view, and were used to evaluate myotube atrophy.
Statistical analysis
Data were expressed as mean ± SEM and analyzed by one-way analysis of variance followed by the Newman–Keuls test using Prism (version x9, Graphpad Inc., La Jolla, CA, USA). P-values < 0.05 were considered significant.
To examine whether catecholamines can affect LPS-induced myotube wasting, we exposed C2C12 myotubes to Epi and/or LPS for 24 h. In the absence of LPS, Epi (1 μM) did not significantly affect MHC protein expression. On the other hand, LPS (50 ng/mL) decreased MHC protein slightly, and addition of Epi (1 μM) further decreased MHC protein expression (Fig 1A). Immunofluorescence staining of the myotubes with an MHC-specific antibody revealed that LPS (50 ng/ml) slightly reduced the diameter of the myotubes, which was augmented by Epi (1 μM) (Fig 1B and 1C). Thus, Epi exacerbated LPS-induced C2C12 myotube wasting.
Fig 1
Epinephrine (Epi) exacerbated lipopolysaccharide (LPS)-induced myotube wasting in C2C12 myotubes.
C2C12 myotubes were exposed to Epi (1 μM) and/or LPS (50 ng/ml) for 24 h. (A) Whole-cell lysates were analyzed for myosin heavy chain (MHC) and β-actin protein expression with immunoblotting assays. Representative immunoblots are shown (upper panel), and MHC protein expression quantified by densitometric analysis is shown as mean ± SEM (n = 5) of fold induction relative to the value of untreated control cells (lower panel). (B, C) Cells were immunostained with an MHC-specific antibody. Representative images (B), and myotube diameters measured from microscopic photographs (C) are shown. (†P < 0.05 and ††P < 0.005 compared with control, *P < 0.05 and **P < 0.005 for comparisons between the indicated groups).
Epinephrine (Epi) exacerbated lipopolysaccharide (LPS)-induced myotube wasting in C2C12 myotubes.
C2C12 myotubes were exposed to Epi (1 μM) and/or LPS (50 ng/ml) for 24 h. (A) Whole-cell lysates were analyzed for myosin heavy chain (MHC) and β-actin protein expression with immunoblotting assays. Representative immunoblots are shown (upper panel), and MHC protein expression quantified by densitometric analysis is shown as mean ± SEM (n = 5) of fold induction relative to the value of untreated control cells (lower panel). (B, C) Cells were immunostained with an MHC-specific antibody. Representative images (B), and myotube diameters measured from microscopic photographs (C) are shown. (†P < 0.05 and ††P < 0.005 compared with control, *P < 0.05 and **P < 0.005 for comparisons between the indicated groups).In view of the report that LPS induces C2C12 myotube wasting via activation of UPP [10], we analyzed the expression of Atrogin-1 and MuRF1, essential regulators of UPP in skeletal muscle, with qRT-PCR. Epi (1 μM) did not induce the Atrogin-1 mRNA expression, but augmented the LPS-induced Atrogin-1 mRNA expression in a concentration-dependent manner (Fig 2A and 2B). NE (1 μM) and ISO (1 μM), similarly to Epi, augmented LPS-induced Atrogin-1 mRNA expression (Fig 2C). Epi (1 μM) did not induce the MuRF1 mRNA expression in the absence of LPS, but increased MuRF1 mRNA levels in the presence of LPS (Fig 2D).
C2C12 myotubes were exposed for 3 h to LPS (50 ng/ml) and/or Epi (1 μM) (A and D), Epi of the indicated concentration (B) and NE (1 μM) or ISO (1 μM) (D). Atrogin-1 (A, B and C) and MuRF1 (D) mRNA expression levels were analyzed by quantitative reverse transcription polymerase chain reaction (qRT-PCR) (n = 4). Data are normalized to the 18S rRNA expression level, and fold induction relative to the value of the control condition is presented as mean ± SEM (n = 4). (†P < 0.05 and ††P < 0.005 compared with control, *P < 0.05 and **P < 0.005 for comparisons between the indicated groups).
C2C12 myotubes were exposed for 3 h to LPS (50 ng/ml) and/or Epi (1 μM) (A and D), Epi of the indicated concentration (B) and NE (1 μM) or ISO (1 μM) (D). Atrogin-1 (A, B and C) and MuRF1 (D) mRNA expression levels were analyzed by quantitative reverse transcription polymerase chain reaction (qRT-PCR) (n = 4). Data are normalized to the 18S rRNA expression level, and fold induction relative to the value of the control condition is presented as mean ± SEM (n = 4). (†P < 0.05 and ††P < 0.005 compared with control, *P < 0.05 and **P < 0.005 for comparisons between the indicated groups).Two key downstream substrates of the mTOR complex 1 signaling, p70S6 kinase (S6K) and eukaryotic translation initiation factor 4E-binding protein (4E-BP), have been linked to protein synthesis in skeletal muscle [21]. To evaluate whether Epi and LPS affects protein synthesis, we analyzed p70S6K and 4E-BP phosphorylation in whole-cell lysates obtained from C2C12 myotubes exposed to Epi and/or LPS. Epi and/or LPS did not affect the phosphorylation of p70S6K and 4E-BP (S1 Fig). Thus, these results suggest that the effect of Epi on the LPS-induced muscle wasting contributes to proteolysis through the upregulation of UPP.
STAT3 activation and C/EBPδ expression by LPS and Epi
STAT3 activated by phosphorylation on a tyrosine residue (Tyr 705) has been shown to be essential for muscle wasting in cachexia in cancer [13, 22]. Silva et al. clearly showed that C/EBPδ is involved in STAT3-dependent UPP upregulation in muscle wasting [13]. Therefore, to examine whether Epi affects STAT3 activation and C/EBPδ expression, we analyzed phospho-STAT3 (p-STAT3), total-STAT3 (t-STAT3), and C/EBPδ expression in whole-cell lysates obtained from C2C12 myotubes exposed to LPS and/or Epi. Immunoblotting assays showed that Epi (1 μM) and LPS (50 ng/ml) increased p-STAT3 (Fig 3A). Epi increased LPS-induced C/EBPδ expression, although C/EBPδ was not induced by Epi in the absence of LPS (Fig 3B). These results suggest that the augmenting effect of Epi on the LPS-induced myotube wasting may be mediated by UPP upregulation through STAT3 and C/EBPδ.
Fig 3
Activation of the STAT3-C/EBPδ pathway by LPS and Epi.
C2C12 myotubes were exposed to Epi (1 μM) and/or LPS (50 ng/ml) for 3 h. Whole-cell lysates were analyzed for p-STAT3, t-STAT3, C/EBPδ, and β-actin protein expressions with immunoblotting analysis. Representative immunoblots are shown. Expressions of p-STAT3 (A) and C/EBPδ (B) proteins were quantified by densitometric analysis, and were normalized to the expression level of t-STAT3 and β-actin, respectively. Fold induction relative to the value of the control condition is presented as mean ± SEM (n = 5). (†P < 0.05 and ††P < 0.005 compared with control, *P < 0.05 and **P < 0.005 for comparisons between the indicated groups).
Activation of the STAT3-C/EBPδ pathway by LPS and Epi.
C2C12 myotubes were exposed to Epi (1 μM) and/or LPS (50 ng/ml) for 3 h. Whole-cell lysates were analyzed for p-STAT3, t-STAT3, C/EBPδ, and β-actin protein expressions with immunoblotting analysis. Representative immunoblots are shown. Expressions of p-STAT3 (A) and C/EBPδ (B) proteins were quantified by densitometric analysis, and were normalized to the expression level of t-STAT3 and β-actin, respectively. Fold induction relative to the value of the control condition is presented as mean ± SEM (n = 5). (†P < 0.05 and ††P < 0.005 compared with control, *P < 0.05 and **P < 0.005 for comparisons between the indicated groups).
Involvement of IL-6 in STAT3 activation and C/EBPδ expression by LPS and Epi
Because IL-6 can be produced and released by skeletal muscle cells in response to various stresses [15], and can activate the canonical STAT3 signaling pathway [23], we hypothesized that myotube-derived IL-6 was involved in the myotube wasting process induced by LPS and Epi, and was mediated by the STAT3 signaling pathway. First, we examined whether Epi and LPS increased cytokine production in C2C12 myotubes. It was revealed that LPS (50 ng/ml) increased both IL-6 and TNF-α mRNA levels (Fig 4A and 4B). In the absence of LPS, Epi (1 μM) significantly increased IL-6 mRNA levels (2.7 ± 0.4 fold) (Fig 4A), but did not increase TNF-α mRNA levels (Fig 4B). In the presence of LPS, Epi remarkably increased IL-6 mRNA level in a concentration-dependent manner (Fig 4A and 4C), but decreased TNF-α mRNA levels (Fig 4B). Other catecholamines, namely, ISO (1 μM), and NE (1 μM), slightly induced IL-6 mRNA levels in the absence of LPS (NE, 1.9 ± 0.5 fold; ISO, 2.3 ± 0.4 fold), but remarkably increased LPS-induced IL-6 mRNA levels (Fig 4D). ELISA demonstrated that Epi (1 μM) significantly increased LPS-induced IL-6 protein secretion (Fig 4E). These results indicated that catecholamines and LPS synergized to increase IL-6 production and secretion. To examine whether IL-6 produced by Epi and LPS was involved in myotube wasting, we tested the effect of the IL-6 inhibitor LMT-28 [24]. Pretreatment of the myotube with LMT-28 (50 μM) remarkably suppressed Epi-induced STAT3 activation (Fig 5A and 5B), and Epi-induced expression of C/EBPδ and Atrogin-1 in the presence of LPS (Fig 5A, 5C and 5D), whereas LMT-28 partially suppressed the effect of LPS in the absence of Epi. These results suggest that the myotube-derived IL-6 produced by stimulation of LPS and Epi affects the myotubes in an autocrine or paracrine manner and induces myotube wasting.
C2C12 myotubes were exposed for 3 h to LPS (50 ng/ml) and/or Epi (1 μM) (A, B, and E), Epi of the indicated concentration (C) and NE (1 μM) or ISO (1 μM) (D). The mRNA expression levels of IL-6 (A, C, and D) and TNF-α (B), were analyzed by qRT-PCR. Data are normalized to the 18S rRNA expression level and fold induction relative to the value of the control condition is presented as mean ± SEM (n = 3). IL-6 concentration in the conditioned media was analyzed by the enzyme-linked immunosorbent assay (ELISA) assay (E). Data are presented as mean ± SEM (n = 4–6). (†P < 0.05 and ††P < 0.005 compared with control, *P < 0.05 and **P < 0.005 for comparisons between the indicated groups).
Fig 5
Effects of LMT-28 on the responses induced by Epi and LPS.
C2C12 myotubes were pretreated with the IL-6 inhibitor LMT-28 (50 μM) for 30 min, and were exposed to Epi (1 μM) and/or LPS (50 ng/ml) for 3 h. Whole-cell lysates were analyzed for p-STAT3, t-STAT3, and C/EBPδ with the immunoblotting assay (A, B, and C). Representative immunoblots are shown (A), and the expressions of p-STAT3 (B) and C/EBPδ protein (C) were quantified by densitometric analysis and normalized to the expression levels of t-STAT3 and β-actin, respectively. Fold induction relative to the value of the control condition is presented as mean ± SEM (n = 5). Atrogin-1 mRNA expression levels were analyzed by qRT-PCR (D). Data are normalized to the 18S rRNA expression levels, and fold induction relative to the value of the control condition is presented as mean ± SEM (n = 4). (†P < 0.05 and ††P < 0.005 compared with control, *P < 0.05 and **P < 0.005 for comparisons between the indicated groups).
C2C12 myotubes were exposed for 3 h to LPS (50 ng/ml) and/or Epi (1 μM) (A, B, and E), Epi of the indicated concentration (C) and NE (1 μM) or ISO (1 μM) (D). The mRNA expression levels of IL-6 (A, C, and D) and TNF-α (B), were analyzed by qRT-PCR. Data are normalized to the 18S rRNA expression level and fold induction relative to the value of the control condition is presented as mean ± SEM (n = 3). IL-6 concentration in the conditioned media was analyzed by the enzyme-linked immunosorbent assay (ELISA) assay (E). Data are presented as mean ± SEM (n = 4–6). (†P < 0.05 and ††P < 0.005 compared with control, *P < 0.05 and **P < 0.005 for comparisons between the indicated groups).
Effects of LMT-28 on the responses induced by Epi and LPS.
C2C12 myotubes were pretreated with the IL-6 inhibitor LMT-28 (50 μM) for 30 min, and were exposed to Epi (1 μM) and/or LPS (50 ng/ml) for 3 h. Whole-cell lysates were analyzed for p-STAT3, t-STAT3, and C/EBPδ with the immunoblotting assay (A, B, and C). Representative immunoblots are shown (A), and the expressions of p-STAT3 (B) and C/EBPδ protein (C) were quantified by densitometric analysis and normalized to the expression levels of t-STAT3 and β-actin, respectively. Fold induction relative to the value of the control condition is presented as mean ± SEM (n = 5). Atrogin-1 mRNA expression levels were analyzed by qRT-PCR (D). Data are normalized to the 18S rRNA expression levels, and fold induction relative to the value of the control condition is presented as mean ± SEM (n = 4). (†P < 0.05 and ††P < 0.005 compared with control, *P < 0.05 and **P < 0.005 for comparisons between the indicated groups).
NF-κB activation is necessary for myotube wasting induced by LPS and Epi
To further examine the involvement of IL-6 in myotube wasting via the STAT3-C/EBPδ-Atrogin-1 pathway, we tested the effects of mouse recombinant IL-6 (rIL-6). In the absence of LPS, rIL-6 (10 ng/ml) induced p-STAT3 (Fig 6A), but C/EBPδ protein and Atrogin-1 mRNA levels were not significantly changed by rIL6 at concentrations as high as 100 ng/ml (Fig 6A and 6B). In the presence of LPS (50 ng/ml), rIL-6 (10 ng/ml) remarkably increased p-STAT3 and C/EBPδ expression, and led to an increase of the LPS-induced Atrogin-1 mRNA level (Fig 6A and 6B). These results suggest that Atrogin-1 induction by LPS cannot be explained by the IL-6-STAT3 signaling pathway alone, and that another mechanism should be involved.
Fig 6
NF-κB activation is involved in myotube wasting induced by LPS and recombinant IL (rIL)-6.
(A) C2C12 myotubes were exposed to rIL-6 (10 and 100 ng/ml) and/or LPS (50 ng/ml) for 3 h. Whole-cell lysates were analyzed for p-STAT3, t-STAT3, C/EBPδ, and β-actin protein expressions by immunoblotting analysis. Representative immunoblots are shown. (B) C2C12 myotubes were exposed to rIL-6 (100 ng/ml) and/or LPS (50 ng/ml) for 3 h, and the Atrogin-1 mRNA levels were analyzed by qRT-PCR. Data are normalized to the 18S ribosomal RNA (rRNA) expression levels, and fold induction relative to the value of the control condition is presented (n = 4). (C) C2C12 myotubes were treated by Epi (1 μM) and/or LPS (50 ng/ml) for 3 h, and NF-κB (p65) binding activity was analyzed by a TranAM ELISA kit. Fold induction was calculated relative to the value of the untreated control cells (n = 5). (D, E) C2C12 myotubes, pretreated with the NF-κB inhibitor Bay 11–7082 (10 μM) for 30 min were exposed to rIL-6 (100 ng/ml) and/or LPS (50 ng/ml) for 3 h. Representative immunoblots for p-STAT3 (D) and C/EBPδ (E) protein are shown, and the expressions of p-STAT3 (D) and C/EBPδ protein (E) were quantified by densitometric analysis and normalized to the expression levels of t-STAT3 and β-actin, respectively. Fold induction relative to the value of the control condition is presented as mean ± SEM (n = 6). (F) Atrogin-1 mRNA was analyzed by qRT-PCR, and its expression level normalized to the 18S rRNA expression level is presented as mean ± SEM (n = 4) of fold induction relative to the value of the control condition. (†P < 0.05 and ††P < 0.005 compared with control, *P < 0.05 and **P < 0.005 for comparisons between the indicated groups).
NF-κB activation is involved in myotube wasting induced by LPS and recombinant IL (rIL)-6.
(A) C2C12 myotubes were exposed to rIL-6 (10 and 100 ng/ml) and/or LPS (50 ng/ml) for 3 h. Whole-cell lysates were analyzed for p-STAT3, t-STAT3, C/EBPδ, and β-actin protein expressions by immunoblotting analysis. Representative immunoblots are shown. (B) C2C12 myotubes were exposed to rIL-6 (100 ng/ml) and/or LPS (50 ng/ml) for 3 h, and the Atrogin-1 mRNA levels were analyzed by qRT-PCR. Data are normalized to the 18S ribosomal RNA (rRNA) expression levels, and fold induction relative to the value of the control condition is presented (n = 4). (C) C2C12 myotubes were treated by Epi (1 μM) and/or LPS (50 ng/ml) for 3 h, and NF-κB (p65) binding activity was analyzed by a TranAM ELISA kit. Fold induction was calculated relative to the value of the untreated control cells (n = 5). (D, E) C2C12 myotubes, pretreated with the NF-κB inhibitor Bay 11–7082 (10 μM) for 30 min were exposed to rIL-6 (100 ng/ml) and/or LPS (50 ng/ml) for 3 h. Representative immunoblots for p-STAT3 (D) and C/EBPδ (E) protein are shown, and the expressions of p-STAT3 (D) and C/EBPδ protein (E) were quantified by densitometric analysis and normalized to the expression levels of t-STAT3 and β-actin, respectively. Fold induction relative to the value of the control condition is presented as mean ± SEM (n = 6). (F) Atrogin-1 mRNA was analyzed by qRT-PCR, and its expression level normalized to the 18S rRNA expression level is presented as mean ± SEM (n = 4) of fold induction relative to the value of the control condition. (†P < 0.05 and ††P < 0.005 compared with control, *P < 0.05 and **P < 0.005 for comparisons between the indicated groups).LPS is known to induce the activity of NF-κB activity that constitutes an essential transcription factor in the development of muscle wasting [25]. Thus, we aimed to evaluate the possible involvement of NF-κB in the C2C12 myotube wasting. First, to test whether Epi and rIL-6 affect the activity of NF-κB, we performed an ELISA assay to a NF-κB (p65) DNA-binding activity. Although LPS (50 ng/ml) increased the activity of NF-κB, Epi (1 μM) or rIL-6 (10 ng/ml) did not affect the activity of NF-κB in the presence or absence of LPS (Fig 6C), thus indicating that Epi or rIL-6 could not directly induce NF-κB activation. To confirm the involvement of NF-κB activity in myotube wasting, the effect of the NF-κB inhibitor Bay 11–7082 was then tested. Bay 11–7082 (10 μM) slightly suppressed STAT3 activation induced by LPS (Fig 6D). This result suggests that NF-κB signaling might be involved in the LPS-induced STAT3 activation. On the other hand, Bay 11–7082 (10 μM) abolished not only the C/EBPδ protein, but also Atrogin-1 mRNA expression induced by LPS with or without rIL-6 (Fig 6E and 6F). Taken together, these results suggest that the myotube wasting induced by LPS and Epi requires activation of the NF-κB signaling pathway.
Given that NF-κB activated by LPS has been shown to be one of the main regulators of the IL-6 gene [26], we examined the effects of the NF-κB inhibitor on IL-6 synthesis. Bay 11–7082 suppressed remarkably LPS-induced IL-6 mRNA and protein expression (Fig 7A and 7B), but Epi (1 μM) augmented significantly LPS-induced IL-6 synthesis in the presence of Bay 11–7082, thus suggesting that Epi induces IL-6 production by a mechanism other than NF-κB activation. Because the activation of β adrenergic receptors induces adenylyl cyclase activation via the stimulatory G-protein, and thus results in an increase in intracellular cAMP [1], we examined whether Forskolin that directly activates adenylyl cyclase and raises intracellular cAMP can affect IL-6 synthesis. Forskolin (10 μM) slightly increased IL-6 mRNA levels and remarkably increases LPS-induced IL-6 mRNA levels (Fig 7C) in a manner similar to Epi (1 μM).
Fig 7
Involvement of NF-κB activation and cyclic adenosine monophosphate (cAMP) signaling in the IL-6 production induced by LPS and Epi.
(A, B) After pretreatment with the NF-κB inhibitor Bay 11–7082 (10 μM) or a vehicle for 30 min, C2C12 myotubes were exposed to Epi (1 μM) and/or LPS (50 ng/ml). IL-6 mRNA was analyzed by qRT-PCR, and its expression levels were normalized to the 18S rRNA expression levels and presented as mean ± SEM (n = 3) of fold induction relative to the value of the control condition (A). The IL-6 concentration in the conditioned media was analyzed with the ELISA assay, and is presented as mean ± SEM (n = 3–4) (B). (C) C2C12 myotubes were treated with Forskolin (10 μM) and/or LPS (50 ng/ml) for 3 h. IL-6 mRNA expression was analyzed by qRT-PCR, and its expression levels normalized to the 18S rRNA expression levels are presented as mean ± SEM (n = 3) of fold induction relative to the value of the control condition. (D) C2C12 myotubes were exposed to Epi (1 μM) and/or LPS (50 ng/ml) for 3 h. Whole-cell lysates were analyzed for p-CREB, t-CREB protein expressions with immunoblotting analysis. Representative immunoblots are shown. Expressions of p-CREB proteins were quantified by densitometric analysis, and were normalized to the expression level of t-CREB. Fold induction relative to the value of the control condition is presented as mean ± SEM (n = 3). (†P < 0.05 and ††P < 0.005 compared with control, *P < 0.05 and **P < 0.005 for comparisons between the indicated groups).
Involvement of NF-κB activation and cyclic adenosine monophosphate (cAMP) signaling in the IL-6 production induced by LPS and Epi.
(A, B) After pretreatment with the NF-κB inhibitor Bay 11–7082 (10 μM) or a vehicle for 30 min, C2C12 myotubes were exposed to Epi (1 μM) and/or LPS (50 ng/ml). IL-6 mRNA was analyzed by qRT-PCR, and its expression levels were normalized to the 18S rRNA expression levels and presented as mean ± SEM (n = 3) of fold induction relative to the value of the control condition (A). The IL-6 concentration in the conditioned media was analyzed with the ELISA assay, and is presented as mean ± SEM (n = 3–4) (B). (C) C2C12 myotubes were treated with Forskolin (10 μM) and/or LPS (50 ng/ml) for 3 h. IL-6 mRNA expression was analyzed by qRT-PCR, and its expression levels normalized to the 18S rRNA expression levels are presented as mean ± SEM (n = 3) of fold induction relative to the value of the control condition. (D) C2C12 myotubes were exposed to Epi (1 μM) and/or LPS (50 ng/ml) for 3 h. Whole-cell lysates were analyzed for p-CREB, t-CREB protein expressions with immunoblotting analysis. Representative immunoblots are shown. Expressions of p-CREB proteins were quantified by densitometric analysis, and were normalized to the expression level of t-CREB. Fold induction relative to the value of the control condition is presented as mean ± SEM (n = 3). (†P < 0.05 and ††P < 0.005 compared with control, *P < 0.05 and **P < 0.005 for comparisons between the indicated groups).Furthermore, we evaluated the phosphorylation of cAMP response element binding protein (CREB), a downstream effector of cAMP signaling. Not only Epi but also LPS activates CREB. These results suggest that cAMP signaling, but not NF-κB signaling, mediates synergistic IL-6 expression.
A β-blocker suppressed the potentiating effect of Epi on LPS-induced muscle wasting
The adrenergic receptor expressed on skeletal muscle predominantly belongs to the β-adrenergic receptor. To examine whether Epi affects LPS-induced myotube wasting via the β-adrenergic receptor, we tested the effect of pretreatment of C2C12 myotubes with the nonselective β-blocker Carvedilol for 30 min. As shown in Fig 8A and 8B, pretreatment of Carvedilol (5 μM) did not affect the effect of LPS, but suppressed the potentiating effect of Epi (1 μM) on LPS-induced IL-6 mRNA and protein induction. Carvedilol also suppressed the effect of Epi (1 μM) on the Atrogin-1 mRNA induction by LPS (50 ng/ml) (Fig 8C), and abolished the effect of Epi (1 μM) on the MHC protein loss in the presence of LPS (50 ng/ml) (Fig 8D and 8E). These results indicate that Epi exacerbates the LPS-induced muscle wasting through the β adrenergic receptor in C2C12 myotubes.
Fig 8
A β-blocker inhibited the effect of Epi in C2C12 myotubes.
(A, B, C) C2C12 myotubes were pretreated with the β-blocker Carvedilol (5 μM) for 30 min, and were then exposed to Epi (1 μM) and/or LPS (50 ng/ml) for 3 h. IL-6 (A) and Atrogin-1 (C) mRNA were analyzed with qRT-PCR, and their expression levels, normalized to the 18S rRNA expression level, are presented as mean ± SEM (n = 3) of fold induction relative to the value of the control condition. The IL-6 concentrations in the conditioned media were analyzed with the ELISA assay, and are presented as mean ± SEM (n = 3–4) (B). (D, E) After pretreatment with Carvedilol (5 μM) for 30 min, C2C12 myotubes were exposed to Epi (1 μM) and/or LPS (50 ng/ml) for 24 h. Whole-cell lysates were analyzed for MHC and β-actin protein expression by immunoblotting assays, and a representative immunoblot is shown (D). MHC protein expressions, quantified by densitometric analysis, were normalized to the expression level of β-actins, and fold induction relative to the control condition is presented as mean ± SEM (n = 5) (E). (†P < 0.05 and ††P < 0.005 compared with control, *P < 0.05 and **P < 0.005 for comparisons between the indicated groups).
A β-blocker inhibited the effect of Epi in C2C12 myotubes.
(A, B, C) C2C12 myotubes were pretreated with the β-blocker Carvedilol (5 μM) for 30 min, and were then exposed to Epi (1 μM) and/or LPS (50 ng/ml) for 3 h. IL-6 (A) and Atrogin-1 (C) mRNA were analyzed with qRT-PCR, and their expression levels, normalized to the 18S rRNA expression level, are presented as mean ± SEM (n = 3) of fold induction relative to the value of the control condition. The IL-6 concentrations in the conditioned media were analyzed with the ELISA assay, and are presented as mean ± SEM (n = 3–4) (B). (D, E) After pretreatment with Carvedilol (5 μM) for 30 min, C2C12 myotubes were exposed to Epi (1 μM) and/or LPS (50 ng/ml) for 24 h. Whole-cell lysates were analyzed for MHC and β-actin protein expression by immunoblotting assays, and a representative immunoblot is shown (D). MHC protein expressions, quantified by densitometric analysis, were normalized to the expression level of β-actins, and fold induction relative to the control condition is presented as mean ± SEM (n = 5) (E). (†P < 0.05 and ††P < 0.005 compared with control, *P < 0.05 and **P < 0.005 for comparisons between the indicated groups).
Discussion
In the present study, we demonstrated that catecholamine exacerbated LPS-induced muscle wasting in C2C12 myotubes. Fig 9 summarizes the proposed mechanism for muscle wasting induced by LPS and catecholamines. LPS can activate NF-κB and induce the expressions of C/EBPδ and Atrogin-1, and LPS-induced STAT3 activation through the NF-κB-mediated IL-6 production can facilitate their expressions. Catecholamine drastically increases LPS-induced IL-6 production, and leads to further activation of STAT3 and to the augmentation of the expressions of C/EBPδ and Atroign-1.
Fig 9
Schematic representation of the effects of catecholamines on LPS-induced myotube wasting.
NF-κB activated by LPS via toll-like receptor 4 (TLR4) induces the expressions of C/EBPδ and Atrogin-1. NF-κB also induces IL-6 production and STAT3 activation that further facilitates the induction of C/EBPδ and Atrogin-1, thus leading to muscle wasting. The β-adrenergic receptor (βAR) activated by catecholamines increases cAMP production, and drastically augments LPS-induced IL-6 production, thus leading to further activation of STAT3 and potentiation of the expressions of C/EBPδ and Atroign-1. This results in the exacerbation of muscle wasting. Reagents used in this study, LMT-28, Bay11-7082, Carvedilol, Forskolin, and rIL-6, are also shown in the scheme. The symbols (+) and (-) are used to indicate that the reagent promotes or inhibits the indicated mediator, respectively.
Schematic representation of the effects of catecholamines on LPS-induced myotube wasting.
NF-κB activated by LPS via toll-like receptor 4 (TLR4) induces the expressions of C/EBPδ and Atrogin-1. NF-κB also induces IL-6 production and STAT3 activation that further facilitates the induction of C/EBPδ and Atrogin-1, thus leading to muscle wasting. The β-adrenergic receptor (βAR) activated by catecholamines increases cAMP production, and drastically augments LPS-induced IL-6 production, thus leading to further activation of STAT3 and potentiation of the expressions of C/EBPδ and Atroign-1. This results in the exacerbation of muscle wasting. Reagents used in this study, LMT-28, Bay11-7082, Carvedilol, Forskolin, and rIL-6, are also shown in the scheme. The symbols (+) and (-) are used to indicate that the reagent promotes or inhibits the indicated mediator, respectively.Muscle wasting in sepsis is primarily the result of increased protein breakdown through UPP [8]. Because ubiquitin ligases Atrogin-1 and MuRF1 are induced early during the wasting process [11] and regulate UPP in skeletal muscle, we analyzed the expression of Atrogin-1 for the assessment of muscle wasting. The present study demonstrated that catecholamines increased LPS-induced Atrogin-1 expression, and Epi also slightly increased LPS-induced MuRF1 expression. This suggests that catecholamines can facilitate muscle wasting in septicpatients through UPP activation. It was previously reported that STAT3 signaling was involved in skeletal muscle wasting in cancer cachexia and sepsis [12, 22, 27], and recent studies showed that STAT3 activation causes C/EBPδ to promote muscle wasting [12, 13, 28]. Silva et al. demonstrated that C/EBPδ binding sites exist in the Atrogin-1 promoter, and overexpression of C/EBPδ in C2C12 cells can increase the promoter activity of the Atrogin-1 gene [13]. The finding in the present study that Epi increased the LPS-induced p-STAT3, C/EBPδ, and Atrogin-1 expressions, in conjunction with findings from previous reports, suggests that catecholamine can activate STAT3, thus leading to myotube wasting.As a mechanism for catecholamine-induced STAT3 activation, we focused on the involvement of IL-6 signaling, a representative activation mechanism of the STAT3 pathway. Several studies reported that IL-6 promoted skeletal muscle wasting in clinical and experimental cachexia [29-31], although it was also reported that low levels of IL-6 could promote activation of satellite cells and myotube regeneration [32, 33]. LPS induces systemic inflammation that leads to increased circulating proinflammatory cytokines, including TNF-α and IL-6 [18, 31, 34]. However, LPS can also directly affect skeletal muscle to produce cytokines [35]. Given that myotubes were not administered with exogenous proinflammatory cytokines in the present study, we hypothesized that myotube-derived cytokines were involved in the catecholamine-induced STAT3 activation. We demonstrated that catecholamines drastically increased LPS-induced IL-6 mRNA expression and IL-6 secretion by the myotubes. To examine whether the myotube-derived IL-6 was involved in the effects induced by Epi, we used the IL-6 inhibitor LMT-28 that functions through direct binding to gp130, a standard hub for transducing signals for IL-6 family cytokines [24]. It was shown that LMT-28 abolished the potentiating effect of Epi, thus suggesting that myotube-derived IL-6 was involved in Epi-induced myotube wasting. We also showed that rIL-6 increased LPS-induced STAT3 phosphorylation, and C/EBPδ and Atrogin-1 gene expression, thus supporting the involvement of IL-6 signaling in Epi-induced muscle wasting. On the other hand, LMT-28 only partially abolished LPS-induced STAT3 activation. Bonetto et al. also reported that administration of LPS in IL-6 knockout mice leads to STAT3 activation [22]. Thus, IL-6 can activate STAT3 by the IL-6 pathway and the other mechanism.In the presence of LPS, rIL-6 as well as Epi induced Atrogin-1 and C/EBPδ expressions, whereas in the absence of LPS, rIL-6 induced STAT3 phosphorylation, but did not induce Atrogin-1 or C/EBPδ expressions. Therefore, as a mechanism other than IL-6 signaling necessary for Epi-induced muscle wasting, we then focused on NF-κB, which was activated by LPS and was reported to be one of the essential transcription factors in the development of muscle wasting [25]. It has also been reported that NF-κB activates the expression of the ubiquitin ligase and C/EBP protein family including C/EBPδ [25, 36, 37]. In the present study, Epi or rIL-6 did not activate NF-κB in the presence or absence of LPS, but the NF-κB inhibitor Bay 11–7082 abolished C/EBPδ and Atrogin-1 induction by LPS with or without Epi. This suggested that NF-κB activation was an essential factor for myotube wasting caused by LPS and Epi. Several studies have proven that the STAT3 signaling can collaborate with NF-κB to promote pro-cachectic or inflammatory genes [38, 39]. Thus, although further work will need to examine how the STAT3 and NF-κB cooperate to promote the expression of pro-cachectic genes, we can conclude that the exacerbating effects of catecholamines on muscle wasting are limited to the inflammatory condition, such as sepsis, in which NF-κB is activated in skeletal muscle.NF-κB is one of the main regulators of the IL-6 gene [40]. However, we demonstrated that in contrast to LPS-induced IL-6 synthesis, Epi-induced IL-6 synthesis was not suppressed by Bay 11–7082. This suggested that Epi induced IL-6 synthesis through a mechanism other than NF-κB. IL-6 gene regulation in muscle was inherently organized to respond to a wide variety of signals [15, 26]. A previous report demonstrated that the combined stimulation of NF-κB and the cAMP response element binding protein (CREB) synergistically induced transcription at the IL-6 promoter in human astrocytes [41]. Song et al. also reported that LPS triggered cAMP signaling in addition to NF-kB signaling, leading to the production of IL-6 [42]. Activation of the β adrenergic receptor leads to adenylyl cyclase activation via the stimulatory G-protein, and increases intracellular cAMP [1]. We demonstrated that Forskolin increased IL-6 mRNA levels, and Forskolin and LPS synergized to increase the IL-6 levels. This indicated that Forskolin can emulate the effects of Epi on IL-6 production. Furthermore, we also showed that Epi and LPS phosphorylated the CREB, which is activated by cAMP signaling. Therefore, the IL-6 synthesis synergistically induced by LPS and Epi may be mediated by the NF-κB signaling pathway and cAMP signaling, respectively. In contrast, another proinflammatory cytokine, TNF-α, was induced by LPS in a manner similar to that of IL-6, but was not induced by cAMP.A significant proportion of the adrenergic receptors expressed in skeletal muscle belongs to the β-adrenergic receptor [1]. The suppressive effect of the nonselective β blocker Carvedilol on the potentiation of the LPS-induced muscle wasting by Epi, indicates that Epi exacerbates LPS-induced myotube wasting via the β adrenergic receptor. Therefore, to prevent exacerbation of skeletal muscle wasting by catecholamines in the presence of systematic inflammation, we should try to avoid activation of the β adrenergic receptor expressed in the skeletal muscle. In the clinical settings, it might be better to avoid the use of vasopressors with a strong β agonistic effect or coadminister catecholamines and β blockers in septicpatients.In conclusion, Epi exacerbates LPS-induced myotube wasting in C2C12 myotubes by potentiating the NF-κB-mediated activation of the C/EBPδ-Atrogin-1 pathway via the IL-6-STAT3 pathway. Further understanding of the molecular mechanism of skeletal muscle wasting is necessary to develop strategies for preventing muscle wasting and improving prognosis in critically illpatients.
Epi did not affect the phosphorylation of p70S6K and 4E-BP in the presence of LPS.
C2C12 myotubes were exposed to Epi (1 μM) and/or LPS (50 ng/ml) for 3 h. Whole-cell lysates were analyzed for p-p70S6K, t-p70S6K, p-4EBP, and t-4EBP protein expressions with immunoblotting analysis. Representative immunoblots are shown. Expressions of p-p70S6K (A) and p-4EBP (B) proteins were quantified by densitometric analysis, and were normalized to the expression level of t-p70S6K and t-4EBP, respectively. Fold induction relative to the value of the control condition is presented as mean ± SEM (n = 3). (†P < 0.05 and ††P < 0.005 compared with control, *P < 0.05 and **P < 0.005 for comparisons between the indicated groups)(TIFF)Click here for additional data file.
The raw images of all Western blot data.
(PDF)Click here for additional data file.(XLSX)Click here for additional data file.5 Mar 2021PONE-D-21-02018Activation of the β-adrenergic receptor exacerbates lipopolysaccharide-induced wasting of skeletal muscle cells by increasing interleukin-6 productionPLOS ONEDear Dr. Kai,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.Please submit your revised manuscript by Apr 19 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsWe look forward to receiving your revised manuscript.Kind regards,Atsushi Asakura, Ph.DAcademic EditorPLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf2. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability.Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized.Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access.We will update your Data Availability statement to reflect the information you provide in your cover letter.3. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.4. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQ
[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: PartlyReviewer #2: No**********2. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: YesReviewer #2: Yes**********3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: YesReviewer #2: Yes**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: YesReviewer #2: Yes**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: This manuscript written by Dr. Matsukawa et al. aimed to clarify the effects of catecholamines in LPS-treated myotubes, and found that the epinephrine accelerates the LPS-induced muscle wasting and their related signaling pathway. With several types of pharmacological inhibition, the authors clarified the link between the two different signaling pathways of LPS and b-AR, in relation to IL-6 and STAT signaling. These experiments were well designed, and the presented results were convincing. However, it is still unclear why the epinephrine could enhance the LPS-induced muscle wasting, while the epinephrine treatment without LPS-induction had no effect on myotubes. The reviewer raised some concerns that need to be addressed in order to strengthen the conclusions drawn by the authors.The critical concern was that it was not clear why epinephrine could accelerate the LPS-induced muscle wasting, and could activate relevant signal genes, namely STAT3, Atrogin-1 and NF-kB. One possibility is that the number of b-AR or the binding affinity to epinephrine were increased by LPS-treatment, and those augmentation enhanced the muscle wasting. Did the authors evaluate the expressions or the sensitivity of b-AR after LPS treatment? Did LPS-induced IL-6 affected them? Clarification of these would strongly support the hypothesis.In Fig. 2, the authors evaluated the proteolysis related gene expressions including Atrogin-1 and MURF, but did not describe about the protein synthesis. Since the activation of b-AR increases skeletal muscle mass as previously described, it is a question whether the treatment with both LPS and epinephrine would affect the protein synthesis.In Fig. 5, IL-6 inhibitor suppressed LPS-induced STAT3 activation and Atrogin-1 expression. The reviewer wonders if IL-6 inhibitor could prevent the myotube atrophy in vitro along with the alteration of these signaling molecules.In addition, since NF-kB inhibitor also decreased these expressions, I wonder if the loss of MHC protein after LPS-treatment could be attenuated by Bay11-7082, as well.In Fig. 6A and B, the results indicated that rIL-6 treatment (without LPS-induction) do not affect C/EBP� and Atrogin-1 expression even under the situation of p-STAT3 elevation, which implies that IL-6/STAT3 signaling is independent of C/EBPd-Atrogin1 signaling. However, in Fig. 9, the authors showed that C/EBPd was the downstream of IL-6/STAT3 pathway, which was inconsistent with other results shown in the manuscript. Explanations are required for these issues. In addition, please explain why LPS+IL-6 treatment could enhance C/EBPd-Atrogin1 signaling while rIL-6 did not affect these expressions.In Fig. 6D and E, NF-kB inhibitor could abolish C/EBPd, Atrogin-1 and IL-6 expression as shown in Fig. 6 and 7, while it is still not clear whether this would affect the pSTAT3 signaling. Validation on the activation levels of STAT3 in Bay11-7082-treated myotubes is necessary.Since epinephrine without LPS-treatment did not have any effects on myotube, it was unclear if b-AR mediated IL-6 signaling could directly affect Atrogin-1 expression and MHC protein amount as shown in Fig. 8. To answer this question,, experiments using b-AR overexpressed C2C12 might be required.Reviewer #2: This paper is an exciting manuscript by Matsukawa et al. on sepsis's hot topic and its therapeutical strategies such as catecholamines. The idea of the rationale of the experiments is correct. However, the data showed is low-quality, especially those based in western blots that should contribute to the conclusions to a high degree. Thus, this reviewer thinks that the findings are not entirely based on the manuscript results.Specific: the western blot of the Figures 1A, 2A, 2B, 5A do not represent the changes between LPS and LPS+ Epi depicted in the graphics. Also, Figure 6D does not show the differences between LPS and LPS+IL6. Why does LPS not increase the pSTAT3 in figure 5B?Fluorescence microscopy in figure 1B presents high levels of background and complicated to see the myotubes delimitation.**********6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.22 Apr 2021Thank you for giving us the opportunity to strengthen our manuscript with your valuable comments and queries. We have incorporated changes that reflect the detailed suggestions you have graciously provided. Please see "Response to Reviewers" and "Manuscript" for the details. We also hope that our edits and the responses we provide below satisfactorily address all the issues and concerns you and the reviewers have noted.Submitted filename: Response to Reviewers_0419.docxClick here for additional data file.6 May 2021Activation of the β-adrenergic receptor exacerbates lipopolysaccharide-induced wasting of skeletal muscle cells by increasing interleukin-6 productionPONE-D-21-02018R1Dear Dr. Kai,We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.Kind regards,Atsushi Asakura, Ph.DAcademic EditorPLOS ONEAdditional Editor Comments (optional):Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.Reviewer #1: All comments have been addressed**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: Yes**********3. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: Yes**********4. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: Yes**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: Yes**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: (No Response)**********7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: No10 May 2021PONE-D-21-02018R1Activation of the β-adrenergic receptor exacerbates lipopolysaccharide-induced wasting of skeletal muscle cells by increasing interleukin-6 productionDear Dr. Kai:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.If we can help with anything else, please email us at plosone@plos.org.Thank you for submitting your work to PLOS ONE and supporting open access.Kind regards,PLOS ONE Editorial Office Staffon behalf ofDr. Atsushi AsakuraAcademic EditorPLOS ONE
Authors: Krysta S Wolfe; Bhakti K Patel; Erica L MacKenzie; Shewit P Giovanni; Anne S Pohlman; Matthew M Churpek; Jesse B Hall; John P Kress Journal: Chest Date: 2018-09-11 Impact factor: 9.410
Authors: Dongsheng Cai; J Daniel Frantz; Nicholas E Tawa; Peter A Melendez; Byung-Chul Oh; Hart G W Lidov; Per-Olof Hasselgren; Walter R Frontera; Jongsoon Lee; David J Glass; Steven E Shoelson Journal: Cell Date: 2004-10-15 Impact factor: 41.582