Fluorescent quenching probes based SAA 1 genotyping with a fully automated system.

OBJECTIVE: The aim of the present study is to develop and validate a reliable and simple application for genotyping serum amyloid A1 (SAA1).
METHODS: The specific nested PCR was performed to amplify a product of SAA1 gene. Two quenching probes (QPs) were designed for detecting two single nucleotide polymorphism (SNP) sites, rs1136743(C/T) and rs1136747(C/T) respectively for SAA1 genotypes. The specific nested PCR and QPs of SAA1 genotying was introduced into a fully automated genotyping system (I-densy, ARKRAY, Inc.), which enables the genotyping of SAA1 from whole blood.
RESULTS: Six genotypes of SAA1 (α+/+, β+/+, γ+/+, αβ, αγ and βγ) could be determined by monitoring the fluorescence intensity of two QPs with melting temperature (TM) analysis. Total 121 clinical samples were SAA1 genotyped in the fluorescent quenching probes based method with a fully automated I-densy system and were further sequence confirmed with a PCR direct sequencing approach.
CONCLUSION: This fully automated system is a rapid and reliable strategy for the SAA1 genotyping and for its future clinical application.

Introduction

The serum amyloid A (SAA) is a family of differentially expressed apolipoproteins. Some of them are acute-phase SAAs (A-SAAs) which secrete and increase by as much as 1000-fold during the acute phase of inflammation, like SAA1 and SAA2; the other is constitutive SAAs (C-SAAs), which was induced minimally during the acute-phase response and have only been found in human and mouse, like SAA4 [1,2]. Although the liver synthesizes both A-SAA and C-SAA, accumulating epidemiological data suggest that A-SAAs associates strongly with developing amyloidosis and cardiovascular diseases (CVDs) [3, 4, 5]. Despite the high sequence identity (over 93%) among different A-SAA isoforms, SAA1 shows to be a major isoform and more pathogenic properties [6].

SAA1 is a 12KDa protein of 104 amino acids which is produced mainly from liver after stimulation by inflammatory cytokines, such as interleukin-1 (IL-1) and tumor necrosis factor (TNF) [7]. Two single nucleotide polymorphisms at exon 3 constitute three kinds of SAA1 allelic variants, resulting six genotype of SAA1 in human (α+/+, β+/+, γ+/+, αβ, αγ and βγ) [8, 9]. Polymorphisms in the gene coding for SAA1 have been identified as a risk factor of developing amyloidosis and estimate candidates for atherosclerosis [10, 11, 12, 13, 14]. The homozygous α+/+ is reported to be the most common genotype among patient group with amyloidosis in Caucasoid population, while homozygous γ+/+ in Japanese population. Furthermore, SAA1 genotype is significantly associated with a higher NPC (nasopharyngeal carcinoma) risk, as the frequency of the β+/+ genotype in NPC patients was 2-fold higher than in the healthy individuals [15].

As previously reported, the quenching probe (QP) method is extremely effective in detecting target genes using fluorescence quenching [9]. Through the addition specific primer sets, a gene amplification response is generated, after which QP was used to detect the specific gene arrangement quickly and easily by fluorometry. The present study reports a simple and reliable QP method for SAA1 genotyping, with which the six genotypes of the SAA1 were identified with a specific nested PCR and QPs to a fully automated genotyping system (I-densy, ARKRAY, Inc.). It could be a powerful tool for research study and future clinical application.

Material and methods

Genomic DNA extraction and construction of plasmids containing SAA1 allelic genomic DNA fragments

Ethical approval for this study and the use of human subjects was obtained from the research ethics committee of the Third People's Hospital of Zhenjiang, consistent with the ethical guidelines of the 1975 Declaration of Helsinki, and written informed consent was obtained from all patients.

Genomic DNA was extracted from peripheral blood in QIAGEN QIAcube (Qiagen, Germany) with QIAamp DNA Blood Mini kit (Qiagen, Germany) following the manufacturer's instructions. DNA concentration was examined with NanoDrop 2000 spectrometer (Thermo Scientific, USA).

The DNA fragments of SAA1 allelic variants were amplified from human genomic DNA by Primer 1 (TGGGAGGTGGAGGTTGCGATG) and Primer 2 (AGGAAGGAGGGATGAAAACACTGGG) (Sangon Biotech Co., Ltd., China) and were inserted to pBlueScript II (+) DNA vector at an EcoRV site as positive controls.

Specific nested PCR and detection of SAA1 genotype by QP method

Primer 1 and Primer 2 were designed and synthesized to specifically amplify SAA1 gene product theoretically, which was about 800 base pair long, shown in Figure 1. Additionally, another nested primer pair, Primer 3 (GGAACTATGATGCTGCCAAAA) and Primer 4 (GCTCGTCTCCCTCCTGACTG) (Sangon Biotech Co., Ltd., China), amplified an internal fragment covering the SNP region of SAA1, coupling with two QPs (QP1-FAM and QP2-TAMRA) (Sangon Biotech Co., Ltd., China) synthesized for detecting two SNP sites of SAA1, rs1136743 and rs1136747 respectively. After the PCR was complete, melting temperature (Tm) analyses were performed. The SNPs were identified by the difference in Tm, which could be used to identify the six genotypes of SAA1 (α+/+, β+/+, γ+/+, αβ, αγ and βγ).

Figure 1

Schematic diagram showing the sequences and locations of primers used for QP methods and DS for SAA1 genotyping. Primer 1 and 2 are used to specifically amplify SAA1 and DS. Primer 3 and 4 are nested primers for QP method. Two single nucleotide polymorphisms (rs1136743 and rs1136747) associated to SAA1 genotypes are framed in black boxes, which are identified by two QPs respectively. The QP1 was designed to be perfectly complementary to the thymine deoxynucleotide at rs1136743, and the QP2 was designed to be perfectly complementary to the thymine deoxynucleotide at rs1136747.

Detection of SAA1 genotype by PCR direct sequencing

The SAA1 genomic DNA sequence was amplified using the forward Primer 1 and Primer 2, shown above. The PCR products were subjected to direct sequencing (Sangon Biotech Co., Ltd., China).

Results

Establish a QP method to genotype SAA1 gene

Two single nucleotide polymorphisms at exon 3 of SAA1 gene, rs1136743 and rs1136747, constitute three different SAA1 allelic variants: SAA1α, SAA1β and SAA1γ. The genomic sequence of SAA1 and SAA2 were aligned to find out region with significant difference since high identity between SAA1 and SAA2 genes. According to DNA sequence alignment between SAA1 and SAA2, we designed and synthesized one pair of primers (Primer 1 and Primer 2) to specifically amplify SAA1 gene resulting in an around 800 base pair long product. On top of that, a quenching probe (QP) method was applied with another nested primer pair (Primer 3 and Primer 4) to amplify an internal fragment covering SNP region of SAA1 combined with two QPs labeled with two different fluorescent dyes (FAM and TAMRA) for detecting two SNP sites of SAA1, rs1136743(C/T) and rs1136747(C/T) respectively, as shown in Figure 1.

As shown in Table 1, theoretical melting patterns and peak temperatures of the six genotypes of SAA1 (α+/+, β+/+, γ+/+, αβ, αγ and βγ) were listed. Theoretically, the mismatched cytosine deoxynucleotide would be detected as a single fluorescent peak at a relatively lower temperature compared to the perfectly matched thymine deoxynucleotide where the QP1-FAM was designed to be perfectly complementary to the thymine deoxynucleotide at rs1136743 site. Similarly, the cytosine or the thymine deoxynucleotide at rs1136747 would be detected as single peak at low or high temperature, respectively. Thus, combining the detection results of the two SNP sites, we would be able to identify the six genotypes of SAA1 (α+/+, β+/+, γ+/+, αβ, αγ and βγ). Of particular notes, by QP method for SNP detection, SAA1αβ genotype will have two peaks of low and high temperature at each SNP site, because SAA1αβ is heterozygous at both SNP sites; SAA1αγ genotype will have two peaks at rs1136743, while SAA1βγ genotype will have two peaks at rs1136747.

Table 1

Theoretical melting temperature (TM) patterns of six SAA1 genotype by quenching probe method.

Genotypes	TM (rs1136743)			TM (rs1136747)
	Low	High	Allele	Low	High	Allele
α+/+	－	＋	T	＋		C
β+/+	＋	－	C	－	＋	T
γ+/+	＋	－	C	＋	－	C
αβ	＋	＋	C/T	＋	＋	C/T
αγ	＋	＋	C/T	＋	－	C
βγ	＋	－	C	＋	＋	C/T

TM, melting temperature; ＋, indicating a fluorescence peak at the corresponding temperature; －, indicating no peak existing.

To validate the QP method for SAA1 genotyping, three plasmids inserted SAA1 allelic variants were used to prepare six genotypes of SAA1, which had already been proved by direct sequencing. As expected, two SNPs of SAA1 could be identified by two QPs respectively in one reaction, which was able to identify the specific genotype of SAA1, shown in Figure 2. For homozygotes, SAA1α+/+ were detected as one peak at 61 °C for rs1136743 and one peak at 50 °C for rs1136747; SAA1β+/+ were detected as one peak at 52 °C for rs1136743 and one peak at 59 °C for rs1136747; SAA1γ+/+ were detected as one peak at 52 °C for rs1136743 and one peak at 50 °C for rs1136747. For heterozygotes, SAA1αβ were detected as two peaks for rs1136743 and two peaks for rs1136747; SAA1αγ were detected as two peaks for rs1136743 and one peaks at 50 °C for rs1136747; SAA1βγ were detected as one peak at 52 °C for rs1136743 and two peaks for rs1136747. Taken together, the fluorescent quenching probes based method with a fully automated I-densy system we reparted here could be used to identify the six genotypes of SAA1 (α+/+, β+/+, γ+/+, αβ, αγ and βγ).

Figure 2

Validation of the QP method by plasmids inserted different SAA1 allelic variants. For homozygotes, each genotype were detected as one peak at rs1136743 and one peak at rs1136747. For heterozygotes, SAA1αβ were detected as two peaks at rs1136743 and two peaks at rs1136747; SAA1αγ were detected as two peaks at rs1136743 and one peaks at rs1136747; SAA1βγ were detected as one peak at rs1136743 and two peaks at rs1136747.

Whole blood sample testing in a fully automated system

In order to evaluate the clinical application of our fluorescent quenching probes based method with a fully automated I-densy system, the peripheral blood from anonymous donors were directly analyzed. At the meanwhile, the genomic DNA extracted from anonymous donors’ peripheral blood was used for PCR direct sequencing, in which the forward Primer 1 and reverse-sequencing Primer 2 were used.

Total 121 clinical samples were tested by the fluorescent quenching probes based method with a fully automated I-densy system and PCR direct sequencing. The SAA1 genotyping results from two methods were shown in Table 2. As expected, the genotyping results derived from our system and the PCR direct sequencing methods was identical. indicating that our QP method is reliable for SAA1 genotyping. The samples were 12 (9.9%)α+/+, 2 (1.7%) β+/+, 23 (19.0%) γ+/+, 21 (17.4%) αβ, 31 (25.6%) αγ and 32 (26.4%) βγ, respectively. Taken together, the QP method on the fully automated I-densy system is a rapid and reliable strategy for the SAA1 genotyping and future clinical application.

Table 2

Comparison of the quenching probe method and direct sequencing for genotypes of SAA1.

genotypes	QP∗		DS∗∗
	n∗∗∗	%	n∗∗∗	%
α+/+	12	9.9	12	9.9
β+/+	2	1.7	2	1.7
γ+/+	23	19.0	23	19.0
αβ	21	17.4	21	17.4
αγ	31	25.6	31	25.6
βγ	32	26.4	32	26.4
Total	121	100	121	100

∗, quenching probe method; ∗∗, direct sequencing; ∗∗∗, number.

Discussion

Serum amyloid A 1 is produced mainly in liver after pro-inflammatory cytokines stimulation. Polymorphisms in the gene coding for SAA1 have been identified as a risk factor of developing amyloidosis. Caucasian patients with α+/+ genotype have a higher risk of developing amyloidosis, probably because SAA1 is more sensitive to degradation by MMP-1 [12].

To investigate SAA1 genotype, current methods such as PCR direct sequencing (DS), restriction fragment length polymorphism (RFLP) and allele-specific PCR applied for the detection of associated SNP sites are insufficient in terms of convenience, easy operation. a reliable detection method that combines simplicity and ease of use is desirable.

Our data show that the fluorescent quenching probes based method with a fully automated I-densy system described above is practicable and reliable, making it suitable for genotyping SAA1. The invention is based on specific nested PCR amplification of the targeting SNPs of SAA1 gene. The nested PCR could get rid of the interference of SAA2. The system we developed could determine the genotypes by monitoring the fluorescence intensity of two QPs. Furthermore, the fully automated system, I-densy, for whole blood samples testing, provides easy option for gene analysis.

In conclusion, we have determined that the nested PCR associated QP assay described here is a useful and reliable method for SAA1 genotyping. It would be a powerful tool for research study and clinical application.

Declarations

Author contribution statement

Jie Zhang: Conceived and designed the experiments; Performed the experiments; Analyzed and interpreted the data; Wrote the paper.

Changgen Shi: Conceived and designed the experiments; Performed the experiments.

Lei Zhang, Yan Zhang, Qing Lu: Analyzed and interpreted the data.

Rongfang Wang: Conceived and designed the experiments; Wrote the paper.

Funding statement

This work was supported by the grant (No. 18441906500 and No. 19441915100).

Data availability statement

Data included in article/supplementary material/referenced in article.

Declaration of interests statement

The authors declare no conflict of interest.

Additional information

No additional information is available for this paper.