Guang-Ping Chang1, Xin-Lu Yang2, Wen Liu1, Shuai Lin3, Song-Liu Yang1, Ming-Yan Zhao1. 1. Department of Critical Care Medicine, The First Affiliated Hospital of Harbin Medical University, Harbin 150001, Heilongjiang Province, P.R. China. 2. Maternity Ward, Harbin Red Cross Centre Hospital, Harbin 150076, Heilongjiang Province, P.R. China. 3. Maternity Ward, The First Affiliated Hospital of Harbin Medical University, Harbin 150001, Heilongjiang Province, P.R. China.
Abstract
Preeclampsia (PE) is one of the leading causes of maternal death worldwide. Elevated fatty acid binding protein 4 (FABP4) levels have been observed in patients with PE, however, the mechanism by which FABP4 contributes to the pathogenesis of PE remains unclear. In this study, we compared the levels of FABP4 and cytokines between 20 PE patients and 10 healthy pregnant women by using ELISA, immunohistochemistry (IHC) analysis, and flow cytometry (fluorescence-activated cell sorting, FACS). Elevated FABP4 was accompanied by regulatory T (Treg)/T helper type 17 (Th17) imbalance in PE. Knockdown of FABP4 attenuated lipopolysaccharide (LPS)-induced NLR family pyrin domain containing 3 (NLRP3) inflammasome activation and interleukin-17A (IL-17A) production in primary macrophages. In addition, silencing of FABP4 also suppressed Th17 differentiation via paracrine signaling. Overexpression of FABP4 promoted Th17 differentiation via increasing IL-17A/IL-23 release. Reciprocally, IL-17A upregulated FABP4 and activated the NLRP3 inflammasome in vitro and in vivo. The in vivo studies revealed that FABP4 inhibitor BMS309403 ameliorated PE clinical phenotypes, the Treg/Th17 imbalance, and NLRP3 inflammasome activation in PE mice model. In conclusion, FABP4 facilitates inflammasome activation to induce the imbalance of Treg/Th17 in PE via forming a positive feedback with IL-17A.
Preeclampsia (PE) is one of the leading causes of maternal death worldwide. Elevated fatty acid binding protein 4 (FABP4) levels have been observed in patients with PE, however, the mechanism by which FABP4 contributes to the pathogenesis of PE remains unclear. In this study, we compared the levels of FABP4 and cytokines between 20 PE patients and 10 healthy pregnant women by using ELISA, immunohistochemistry (IHC) analysis, and flow cytometry (fluorescence-activated cell sorting, FACS). Elevated FABP4 was accompanied by regulatory T (Treg)/T helper type 17 (Th17) imbalance in PE. Knockdown of FABP4 attenuated lipopolysaccharide (LPS)-induced NLR family pyrin domain containing 3 (NLRP3) inflammasome activation and interleukin-17A (IL-17A) production in primary macrophages. In addition, silencing of FABP4 also suppressed Th17 differentiation via paracrine signaling. Overexpression of FABP4 promoted Th17 differentiation via increasing IL-17A/IL-23 release. Reciprocally, IL-17A upregulated FABP4 and activated the NLRP3 inflammasome in vitro and in vivo. The in vivo studies revealed that FABP4 inhibitor BMS309403 ameliorated PE clinical phenotypes, the Treg/Th17 imbalance, and NLRP3 inflammasome activation in PE mice model. In conclusion, FABP4 facilitates inflammasome activation to induce the imbalance of Treg/Th17 in PE via forming a positive feedback with IL-17A.
Preeclampsia (PE) is one of the most common pregnancy complications and the principal cause of maternal death worldwide, affecting approximately 3%–10% of all pregnancies. The symptoms of PE appear during the second and third trimesters of pregnancy, including hypertension, proteinuria, and excessive maternal inflammatory response. Growing evidence suggests that inappropriate activation of the immune system contributes to the pathogenesis of PE. For instance, regulatory T (Treg)/T helper type 17 (Th17) cells imbalance plays critical roles in PE pathogenesis. It is well-known that Tregs contribute to maintenance of tolerance via direct cell contact mechanism or indirect cytokine secretion., Th17 cells are implicated in autoimmune diseases and inflammatory responses. During normal pregnancy, Tregs and Th17 cells are found at high and low levels, respectively. By contrast, the patients with PE exhibited decreased Treg levels and increased Th17 levels., In addition, PE is recognized as a multifactorial syndrome, which is associated with changes of immune cells in the placenta, including macrophages. The altered counts of placental macrophages and their polarization are associated with defective trophoblast invasion and impaired spiral artery remodeling in PE.7, 8, 9 However, the underlying mechanism involved in the imbalance of Treg/Th17 in macrophages and in vivo PE model remains elusive.Fatty acid binding protein 4 (FABP4) is known to play a crucial role in lipid transportation. FABP4 functions as a transmitter linking lipid metabolism to inflammation and has been shown to be associated with risk factors of PE, including hypertension, obesity, and diabetes., Emerging studies have illustrated that PE patients exhibited elevated levels of FABP4;14, 15, 16 however, the mechanism by which FABP4 contributes to the pathogenesis of PE remains uninvestigated. Recently, FABP4 has been reported to regulate NLR family pyrin domain containing 3 (NLRP3) inflammasome activation in macrophages. In addition, excessive activation of the NLRP3 inflammasome is implicated in the pathophysiology of PE. It is worth noting that NLRP3 has been shown to regulate Th17 differentiation, raising a possibility that FABP4 may regulate the Treg/Th17 balance via activating NLRP3 inflammasome in PE.In this study, we demonstrated that elevated FABP4 was accompanied by Treg/Th17 imbalance in PE. Knockdown of FABP4 attenuated lipopolysaccharide (LPS)-induced NLRP3 inflammasome activation and interleukin-17A (IL-17A) production. In addition, silencing of FABP4 also suppressed Th17 differentiation of naive T cells through paracrine mechanisms. FABP4 promoted Th17 differentiation via increasing IL-17A/IL-23 release. On the other hand, we found that IL-17A upregulated FABP4 expression and activated the NLRP3 inflammasome in vitro and in vivo. The in vivo studies revealed that FABP4 inhibitor BMS309403 ameliorated PE clinical phenotypes, Treg/Th17 imbalance, and NLRP3 inflammasome activation in PE mice model.
Results
Elevation of FABP4 is accompanied by Treg/Th17 imbalance in PE
In order to investigate the biological function of FABP4 in PE, we first examined the serum level of FABP4 in healthy pregnant women and patients with PE. As presented in Figure 1A, the patients with PE exhibited a significantly higher serum level of FABP4 compared to healthy pregnant women as detected by enzyme-linked immunosorbent assay (ELISA). This observation was confirmed by immunohistochemistry (IHC) analysis, which demonstrated that FABP4 was strongly expressed in placental tissues from PE patients (Figure 1B). It has been reported that Treg/Th17 imbalance is involved in PE pathogenesis., Consistently, IHC analysis showed that the Th17-associated surface marker IL-17A was highly expressed in placental tissues from PE patients, whereas the expression of Treg marker FOXP3 was much lower than that in healthy pregnant women (Figure 1B). Fluorescence-activated cell sorting (FACS) was then used to determine the percentage of CD4+CD25+FOXP3+ Tregs and CD4+IL-17A+ Th17 cells. As presented in Figures 1C and 1D, PE patients exhibited a decreased percentage of Tregs, whereas Th17 cells increased dramatically in the peripheral blood. Additionally, elevated serum level of IL-17A was also observed in PE patients (Figure 1E). Pearson’s correlation indicated that IL-17A positively correlated with FABP4 in PE patients (Figure 1F). Taken together, these findings suggested that upregulated FABP4 might be associated with Treg/Th17 imbalance in PE.
Figure 1
Elevation of FABP4 is accompanied with Treg/Th17 imbalance in PE
(A) The serum level of FABP4 was determined by ELISA (normal pregnant women, n = 10; PE, n = 20). (B) The immunoreactivities of FABP4, IL-17A, and FOXP3 in placental tissues were monitored by IHC analysis. (C and D) The percentages of Treg (C) and Th17 cells (D) in peripheral blood were assessed by FACS (normal pregnant women, n = 10; PE, n = 20). (E) The serum level of IL-17A was determined by ELISA (normal pregnant women, n = 10; PE, n = 20). (F) Pearson’s correlation analysis between IL-17A and FABP4 expression. Data were representative images. ∗p < 0.05.
Elevation of FABP4 is accompanied with Treg/Th17 imbalance in PE(A) The serum level of FABP4 was determined by ELISA (normal pregnant women, n = 10; PE, n = 20). (B) The immunoreactivities of FABP4, IL-17A, and FOXP3 in placental tissues were monitored by IHC analysis. (C and D) The percentages of Treg (C) and Th17 cells (D) in peripheral blood were assessed by FACS (normal pregnant women, n = 10; PE, n = 20). (E) The serum level of IL-17A was determined by ELISA (normal pregnant women, n = 10; PE, n = 20). (F) Pearson’s correlation analysis between IL-17A and FABP4 expression. Data were representative images. ∗p < 0.05.
Knockdown of FABP4 attenuates LPS-induced NLRP3 inflammasome activation and IL-17A production
To elucidate the potential mechanism(s) by which FABP4 modulated the imbalance of Treg/Th17 in PE, we performed knockdown experiments. Among the four different short hairpin RNAs (shRNAs) targeting FABP4, shFABP4#1, shFABP4#2, and shFABP4#3 led to a marked reduction of FABP4 in primary macrophages (Figure 2A). The most effective, shFABP4#2, was thus selected for subsequent experiments. As expected, western blot also showed that shFABP4#2 remarkably decreased FABP4 protein level in primary macrophages (Figure 2B). Emerging evidence indicates that NLRP3 inflammasome is involved in the pathophysiology of PE, and lipopolysaccharide (LPS) has been found to activate NLRP3 inflammasome in trophoblast cells and monocytes from PE patients., It has been illustrated that FABP4 regulates NLRP3 inflammasome activation in macrophages. We next examined the effect of FABP4 on LPS-activated NLRP3 inflammasome signaling. As shown in Figure 2C, silencing of FABP4 attenuated LPS-induced induction of NLRP3, apoptosis-associated speck-like protein containing a CARD (ASC), and pro- and cleaved caspase-1 in primary macrophages. In accordance with these results, qRT-PCR and ELISA showed that knockdown of FABP4 reversed LPS-induced expression and secretion of inflammasome-related cytokines IL-1β and IL-18 (Figures 2D and 2E), respectively. Interestingly, we also observed that LPS-induced expression and secretion of IL-17A were also significantly attenuated in FABP4-knockdown cells (Figures 2D and 2E). These data indicated that knockdown of FABP4 attenuated LPS-induced NLRP3 inflammasome activation and IL-17A production.
Figure 2
Silencing of FABP4 attenuates LPS-induced NLRP3 inflammasome activation and IL-17A production
(A) The mRNA level of FABP4 was determined by qRT-PCR. (B) The protein level of FABP4 was determined by western blot. (C) The protein levels of NLRP3 inflammasome components were determined by western blot. (D) The mRNA levels of IL-1β, IL-18, and IL-17A were detected by qRT-PCR. (E) The secretion of IL-1β, IL-18, and IL-17A were assessed by ELISA. GAPDH and β-actin were used for normalization in qRT-PCR and western blot, respectively. Data are expressed as the mean ± SD of n = 3 experiments. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001.
Silencing of FABP4 attenuates LPS-induced NLRP3 inflammasome activation and IL-17A production(A) The mRNA level of FABP4 was determined by qRT-PCR. (B) The protein level of FABP4 was determined by western blot. (C) The protein levels of NLRP3 inflammasome components were determined by western blot. (D) The mRNA levels of IL-1β, IL-18, and IL-17A were detected by qRT-PCR. (E) The secretion of IL-1β, IL-18, and IL-17A were assessed by ELISA. GAPDH and β-actin were used for normalization in qRT-PCR and western blot, respectively. Data are expressed as the mean ± SD of n = 3 experiments. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001.
Knockdown of FABP4 in macrophages suppresses Th17 differentiation of naive T cells through paracrine mechanisms
To study the effect of FABP4 on naive T cell differentiation, we subjected FABP4-knockdown primary macrophages to LPS treatment and collected the conditioned medium (CM). Naive T cells were cultured under Treg-polarization condition with or without primary macrophages-CM. As shown in Figure 3A, CM derived from sh-negative control transfected primary macrophages, namely CM (LPS+shNC), suppressed naive T cell differentiation into Tregs, while knockdown of FABP4 abolished this effect. For the naive T cell cultured under Th17 cell-polarizing condition with or without primary macrophages-CM, CM (LPS+shNC) promoted Th17 differentiation of naive T cells, whereas CM (LPS+shFABP4)-cultured naive T cells showed no significant changes in percentage of Th17 cells, compared to control cells (Figure 3B). To further confirm whether naive T cell differentiation was regulated via a paracrine signaling, we substituted primary macrophages-CM by recombinant human FABP4 (rhFABP4). Under either Treg or Th17 cell-polarizing condition, rhFABP4 had no significant effect on Treg or Th17 percentage, respectively (Figures 3C and 3D). Collectively, these findings suggested that knockdown of FABP4 suppressed Th17 differentiation of naive T cells through paracrine mechanisms.
Figure 3
Knockdown of FABP4 suppresses Th17 differentiation of naive T cells through paracrine mechanisms
Naive T cells were cultured under Treg or Th17 cell-polarizing conditions with or without primary macrophages-CM. (A and B) The percentage of Tregs (A) or Th17 cells (B) was assessed by FACS. Naive T cells were cultured under Treg or Th17 cell-polarizing conditions with or without rhFABP4. (C and D) The percentage of Tregs (C) or Th17 cells (D) was assessed by FACS. Data are expressed as representative images or the mean ± SD of n = 3 experiments. ns, not significant, ∗∗p < 0.01, ∗∗∗p < 0.001.
Knockdown of FABP4 suppresses Th17 differentiation of naive T cells through paracrine mechanismsNaive T cells were cultured under Treg or Th17 cell-polarizing conditions with or without primary macrophages-CM. (A and B) The percentage of Tregs (A) or Th17 cells (B) was assessed by FACS. Naive T cells were cultured under Treg or Th17 cell-polarizing conditions with or without rhFABP4. (C and D) The percentage of Tregs (C) or Th17 cells (D) was assessed by FACS. Data are expressed as representative images or the mean ± SD of n = 3 experiments. ns, not significant, ∗∗p < 0.01, ∗∗∗p < 0.001.
Overexpression of FABP4 in macrophages promotes Th17 differentiation of naive T cells via increasing IL-17A/IL-23 release
We further delineate the mechanism by which FABP4 regulated Th17 differentiation of naive T cells by gain-of-function experiments. Primary macrophages were transfected with vector or FABP4 overexpression construct, and Th17-related cytokines were examined by qRT-PCR. As expected, FABP4 was significantly increased in FABP4-overexpressing primary macrophages at both mRNA and protein levels (Figures 4A and 4B). Compared to control groups, IL-17A and IL-23 were highly expressed in FABP4-overexpressing primary macrophages, and IL-1β was slightly induced by FABP4 overexpression. In contrast, the levels of IL-6 and IL-21 exhibited no significant changes (Figure 4A). Consistently, FABP4-mediated upregulation of IL-17A and IL-23 in cell culture supernatant were also detected by ELISA (Figure 4C). In addition, western blot revealed that overexpression of FABP4 remarkably increased NLRP3, pro- and cleaved caspase-1 expression, but had no effect on ASC protein level (Figure 4D), suggesting that FABP4 might regulate Th17 differentiation via modulating IL-17A and IL-23 production. To test this hypothesis, we cultured naive T cells under Treg-polarization condition with or without primary macrophages-CM. As shown in Figures 4E and 4F, overexpression of FABP4 decreased the percentage of Tregs, while neutralization assay showed that anti-IL-17A and anti-IL-23 antibodies reversed this effect on Treg differentiation. By contrast, FABP4 overexpression promoted Th17 differentiation when naive T cells were cultured under Th17 cell-polarization condition with primary macrophages-CM. IL-17A and IL-23 neutralizing antibodies blocked the effect of FABP4 on Th17 differentiation (Figures 4G and 4H). Together, these data suggested that FABP4 promoted Th17 differentiation of naive T cells via increasing IL-17A/IL-23 release.
Figure 4
FABP4 promotes Th17 differentiation of naive T cells via increasing IL-17A/IL-23 release
(A) The mRNA levels of cytokines were determined by qRT-PCR. (B) The protein level of FABP4 was detected by western blot. (C) The IL-17A and IL-23 levels in cell culture supernatant were assessed by ELISA. (D) The protein levels of NLRP3 inflammasome components were determined by western blot. Naive T cells were cultured under Treg or Th17 cell-polarizing conditions with or without primary macrophages-CM and neutralizing antibody. (E–H) The percentage of Tregs (E and F) or Th17 cells (G and H) was assessed by FACS. GAPDH and β-actin were used for normalization in qRT-PCR and western blot, respectively. Data are expressed as representative images or the mean ± SD of n = 3 experiments. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001.
FABP4 promotes Th17 differentiation of naive T cells via increasing IL-17A/IL-23 release(A) The mRNA levels of cytokines were determined by qRT-PCR. (B) The protein level of FABP4 was detected by western blot. (C) The IL-17A and IL-23 levels in cell culture supernatant were assessed by ELISA. (D) The protein levels of NLRP3 inflammasome components were determined by western blot. Naive T cells were cultured under Treg or Th17 cell-polarizing conditions with or without primary macrophages-CM and neutralizing antibody. (E–H) The percentage of Tregs (E and F) or Th17 cells (G and H) was assessed by FACS. GAPDH and β-actin were used for normalization in qRT-PCR and western blot, respectively. Data are expressed as representative images or the mean ± SD of n = 3 experiments. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001.
IL-17A upregulates FABP4 and activates the NLRP3 inflammasome in vitro and in vivo
Previous study has illustrated that IL-17A exacerbates atherosclerosis through activating FABP4-induced ER stress in macrophages, indicating the possible existence of positive feedback loop. We next tested the effects of IL-17A on the expression of FABP4 and NLRP3 inflammasome by western blot. As presented in Figure 5A, IL-17A increased FABP4 expression time dependently, and the protein levels of NLRP3, ASC, and pro- and cleaved caspase-1 were also induced by IL-17A in a time-dependent manner (Figure 5A). We further screened multiple signaling pathways involved in this process. Western blot showed that p-p65 and p-IKKβ were remarkably increased by IL-17A time dependently (Figure 5B), indicating that IL-17A activated the nuclear factor κB (NF-κB) signaling pathway. Moreover, extracellular signal-related kinase (ERK) and p38 mitogen-activated protein kinase (MAPK) signaling pathways were also activated by IL-17A in which p-ERK and p-p38 were upregulated upon IL-17A treatment (Figure 5C). Furthermore, the ER stress-related molecules were also examined. IL-17A upregulated p-protein kinase R-like ER kinase (p-PERK), p-eukaryotic translation initiation factor 2α (p-eIF2α), and C/EBP-homologous protein (CHOP) in primary macrophages time dependently (Figure 5D). In line with the results of western blot, immunofluorescence (IF) staining also revealed that IL-17A increased NLRP3 and ASC expression in primary macrophages (Figure 5E). Moreover, neutralization experiments were performed in a PE mice model. As shown in Figure 5F, intraperitoneal administration of IL-17A neutralizing antibody significantly abrogated L-NAME-mediated upregulation of FABP4, NLRP3, ASC, and pro- and cleaved caspase-1 in placental tissues. IHC analysis further confirmed that L-NAME-increased intensity of FABP4 in placental tissues was remarkably attenuated by IL-17A neutralizing antibody (Figure 5G). These findings indicated that IL-17A upregulated FABP4 and activated the NLRP3 inflammasome and induced activation of NF-κB, ERK, p38 MAPK signaling pathways and ER stress in primary macrophages. IL-17A upregulated FABP4 and activated the NLRP3 inflammasome in vivo.
Figure 5
IL-17A upregulates FABP4 and activates the NLRP3 inflammasome
(A) The protein levels of FABP4 and NLRP3 inflammasome components were determined by western blot. (B) The protein levels of NF-κB signaling components were detected by western blot. (C) The protein levels of ERK and p38 MAPK signaling components were determined by western blot. (D) The protein levels of ER stress-related proteins were examined by western blot. β-actin served as a loading control. (E) IF staining of NLRP3 (green) and ASC (red). Nuclei was visualized by DAPI (blue). (F) The protein levels of FABP4 and NLRP3 inflammasome components in placental tissues were determined by western blot. (G) The immunoreactivities of FABP4 in placental tissues were monitored by IHC analysis. Data are expressed as representative images or the mean ± SD of n = 3 experiments.
IL-17A upregulates FABP4 and activates the NLRP3 inflammasome(A) The protein levels of FABP4 and NLRP3 inflammasome components were determined by western blot. (B) The protein levels of NF-κB signaling components were detected by western blot. (C) The protein levels of ERK and p38 MAPK signaling components were determined by western blot. (D) The protein levels of ER stress-related proteins were examined by western blot. β-actin served as a loading control. (E) IF staining of NLRP3 (green) and ASC (red). Nuclei was visualized by DAPI (blue). (F) The protein levels of FABP4 and NLRP3 inflammasome components in placental tissues were determined by western blot. (G) The immunoreactivities of FABP4 in placental tissues were monitored by IHC analysis. Data are expressed as representative images or the mean ± SD of n = 3 experiments.
FABP4 inhibitor BMS309403 ameliorates PE clinical phenotypes and the imbalance of Treg/Th17 in vivo
To validate the effect of FABP4 in vivo, we established a PE mice model using L-NAME. After treatment with FABP4 inhibitor BMS309403, the PE-related clinical indicators were examined, including blood pressure, proteinuria, and numbers of fetuses. As expected, the PE mice (L-NAME+vehicle group) exhibited higher blood pressure, urine protein level, and lower number of fetuses compared to control group (Figures 6A–6C), suggesting the successful establishment of PE mice model. BMS309403 treatment decreased the L-NAME-induced blood pressure and urine protein level in PE mice model but caused a rebound of the number of fetuses in comparison with L-NAME+vehicle group (Figures 6A–6C). Moreover, BMS309403 rescued Treg/Th17 imbalance in PE mice model in which the decrease of Tregs and increase of Th17 cells were reversed by BMS309403 (Figures 6D and 6E). The levels of IL-17A and IL-23 in placental tissues and serum were further assessed by IHC analysis and ELISA, respectively. As shown in Figure 6F, the immunoreactivities of IL-17A and IL-23 in L-NAME group were remarkably higher than that of control group, while BMS309403 attenuated the L-NAME-induced upregulation of IL-17A and IL-23 in placental tissues. Consistently, L-NAME-induced elevation of IL-17A and IL-23 in serum were also reversed by BMS309403 (Figures 6G and 6H). Furthermore, western blot revealed that L-NAME-activated NLRP3 inflammasome was also attenuated by BMS309403 (Figure 6I). Taken together, these data indicated that FABP4 inhibitor BMS309403 ameliorated PE clinical phenotypes, Treg/Th17 imbalance, and NLRP3 inflammasome activation in PE mice model, possibly via regulating IL-17A and IL-23 release.
Figure 6
FABP4 inhibitor BMS309403 ameliorates PE clinical phenotypes and Treg/Th17 imbalance of in vivo
(A) The blood pressure of control and PE mice (control, n = 6; L-NAME+vehicle, n = 10; L-NAME+BMS309403 n = 10). (B) The urine protein levels of control and PE mice (control, n = 6; L-NAME+vehicle, n = 10; L-NAME+BMS309403, n = 10). (C) The fetus numbers of control and PE mice (control, n = 6; L-NAME+vehicle, n = 10; L-NAME+BMS309403, n = 10). (D and E) The percentage of Tregs (D) or Th17 cells (E) was assessed by FACS. (F) The immunoreactivities of IL-17A and IL-23 in placental tissues were detected by IHC analysis. (G and H) The serum levels of IL-17A (G) and IL-23 (H) were determined by ELISA. (I) The protein levels of NLRP3 inflammasome components were determined by western blot. Data are expressed as representative images or the mean ± SD of n = 3 experiments. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001.
FABP4 inhibitor BMS309403 ameliorates PE clinical phenotypes and Treg/Th17 imbalance of in vivo(A) The blood pressure of control and PE mice (control, n = 6; L-NAME+vehicle, n = 10; L-NAME+BMS309403 n = 10). (B) The urine protein levels of control and PE mice (control, n = 6; L-NAME+vehicle, n = 10; L-NAME+BMS309403, n = 10). (C) The fetus numbers of control and PE mice (control, n = 6; L-NAME+vehicle, n = 10; L-NAME+BMS309403, n = 10). (D and E) The percentage of Tregs (D) or Th17 cells (E) was assessed by FACS. (F) The immunoreactivities of IL-17A and IL-23 in placental tissues were detected by IHC analysis. (G and H) The serum levels of IL-17A (G) and IL-23 (H) were determined by ELISA. (I) The protein levels of NLRP3 inflammasome components were determined by western blot. Data are expressed as representative images or the mean ± SD of n = 3 experiments. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001.
Discussion
In the current study, we reported that FABP4 was significantly increased in serum and placental tissues from PE patients, compared to healthy pregnant women. Interestingly, the upregulation of FABP4 was accompanied by Treg/Th17 imbalance in PE. Knockdown studies revealed that FABP4 activated NLRP3 inflammasome and induced IL-17A/IL-23 production, thereby regulating Treg/Th17 differentiation of naive T cells. On the contrary, we found that IL-17A upregulated FABP4 expression and activated the NLRP3 inflammasome in primary macrophages, indicating the possible existence of IL-17A-triggered positive feedback loop. Therefore, PE was exacerbated by the imbalance of Treg/Th17.Tregs are implicated in the establishment of maternal immune tolerance toward the fetus during pregnancy. Besides Tregs, naive T cells could also differentiate into Th17 cells, which produce a number of chemokines and cytokines, such as IL-17A, tumor necrosis factor alpha (TNF-α), IL-6, IL-21, and IL-22., During normal pregnancy, high levels of Tregs and low levels of Th17 cells are observed. However, PE has been found to be associated with Treg/Th17 imbalance., In accordance with previous studies, a lower proportion of Tregs and higher proportion of Th17 cells were observed in the peripheral blood of PE patients in this study. The markers of Tregs and Th17 cells were also dysregulated in placental tissues from PE patients. Several studies support a critical role of macrophages in the regulation of Treg/Th17 balance. For instance, synovial macrophages promote Th17 differentiation by producing cytokines. During experimental P. brasiliensis infection, bone-marrow-derived macrophages play a crucial role in promoting Th17 differentiation via production of IL-6. Our findings showed that CM derived from FABP4-overexpressing primary macrophages promoted Th17 differentiation of naive T cells via increasing IL-17A/IL-23 release. These data suggested that primary macrophages are involved in the regulation of Treg/Th17 balance via paracrine signaling, and FABP4 plays an important role in this process. In addition, a recent study has reported that trophoblasts also contribute to the imbalance of Treg/Th17 in PE. To get a broader view of the pathogenesis, the role of trophoblasts in PE merits continued investigation in the future.Inflammasomes are multiprotein complexes that mediate immune responses to inflammation-inducing stimuli, such as cellular damage and pathogen infection. NLRP3 inflammasome comprises NLRP3, ASC, and caspase-1. In response to the stimuli, NLRP3 triggers inflammasome assembly and pro-caspase-1 recruitment, leading to its cleavage and activation. Active caspase-1 further cleaves pro-IL-1β and pro-IL-18 into mature active IL-1β and IL-18, respectively., In recent years, growing evidence suggests that NLRP3 inflammasome is implicated in pregnancy complications, including PE. More important, it has been demonstrated that FABP4 regulates macrophages redox signaling and NLRP3 inflammasome activation via modulating uncoupling protein 2 (UCP2). Consistently, gain- and loss-of-function experiments unequivocally illustrated that FABP4 was involved in NLRP3 inflammasome activation and increased production of IL-17A and IL-23 in primary macrophages. These results were in agreement with previous reports, which illustrated the IL-17A and/or IL-23 production following NLRP3 inflammasome activation.31, 32, 33 On the other hand, IL-17A was found to accelerate atherosclerosis via promoting FABP4-mediated ER stress in macrophages. In the current study, we reported that IL-17A upregulated FABP4, activated the NLRP3 inflammasome, and activated NF-κB, ERK, p38 MAPK signaling pathways and ER stress in primary macrophages. It is worth noting that IL-17A is known as a Th17-associated cytokine. These findings suggest that IL-17A, which is produced following NLRP3 inflammasome activation and/or by Th17 cells, might upregulate FABP4 expression, thereby activating NLRP3 inflammasome in primary macrophages.Apart from the imbalance of Treg/Th17 and NLRP3 inflammasome activation, macrophage polarization is also implicated in the pathogenesis of PE., The decidual macrophages phenotype shifts from alternatively activated M2 to classically activated M1 phonotype in PE. FABP4 might also contribute to the pathogenesis of PE via modulating macrophage polarization. Further investigation is needed to test this hypothesis.In conclusion, FABP4 facilitates NLRP3 inflammasome activation to induce Treg/Th17 imbalance in PE via forming a positive feedback with IL-17A.
Materials and methods
Clinical sample collection
The whole-blood samples and placental tissues from patients with PE (n = 20) and normal pregnant women (n = 10) were collected in The First Affiliated Hospital of Harbin Medical University. The placental tissues were collected after delivering babies as previously described., Informed consents were obtained from all patients and healthy women. This study was approved by the Ethics Committee of The First Affiliated Hospital of Harbin Medical University.
ELISA
Serum FABP4 level was assessed using human FABP4 ELISA kit (DFBP40, R&D systems, Minneapolis, MN, USA). Human IL-1β (BMS224-2), IL-18 (BMS267-2), IL-23 (BMS2023-3), and IL-17A ELISA kits (BMS2017) were from Invitrogen (Thermo Fisher Scientific, Waltham, MA, USA). ELISA was conducted following the manufacturer’s instructions.
IHC
Placental tissues were fixed and subjected to paraffin embedding and sectioning. Sections were then subjected to deparaffinization, rehydration, and antigen retrieval. Slides were blocked with 10% normal goat serum (ab7481, Abcam, Cambridge, UK) and incubated with primary antibody at 4°C overnight. The immunoreactivity was visualized using mouse- and rabbit-specific horseradish peroxidase (HRP)/AEC (3-Amino-9-Ethylcarbazole) detection IHC kit (ab93705, Abcam). The following primary antibodies were used in IHC: anti-FABP4 (MA5-29255, Invitrogen; 1:1,000), anti-IL-17A (PA5-109218, Invitrogen; 1:100), anti-FOXP3 (ab20034, Abcam; 1:100), and anti-IL-23 (ab45420, Abcam; 1:100).
Peripheral blood mononuclear cells (PBMCs) isolation and culture
PBMC were isolation from peripheral blood of PE patients and normal pregnant women as previously described. In brief, PBMCs were isolated using standard Ficoll Paque (17144002, GE Healthcare, Piscataway, NJ, USA) gradient centrifugation. After being rinsed with RPMI 1640 (11875119, Gibco, Thermo Fisher Scientific), PBMCs were maintained in RPMI 1640 with 10% FBS (10099141, Gibco), 100 μg/mL streptomycin, 100 U/mL penicillin (15140148, Gibco), 200 mM L-glutamine (25030081, Gibco), and 10 ng/mL PMA (P8139, Sigma-Aldrich, St. Louis, MO, USA). PBMCs were grown at 37°C/5% CO2 in humidified air. CD4+ naive T cells were separated from PBMCs using magnetic-activated cell sorting (19654, StemCell Technologies, New York, NY, USA) according to the manufacturer’s protocols. The purified CD4+ naive T cells were grown in anti-CD3 and anti-CD28 coated plates in RPMI 1640 supplemented with 10% FBS, 100 μg/mL streptomycin, and 100 U/mL penicillin (Gibco).
Primary human macrophages culture, transfection, and LPS stimulation
CD14+ monocytes were separated with 95% purity from PBMCs using magnetic CD14+ beads (130-050-201, Miltenyi Biotech, Cologne, Germany). CD14+ monocytes were then cultured in DMEM (Gibco) containing 100 μg/mL streptomycin and 100 U/mL penicillin. After 2 h, medium was replaced with DMEM containing 50 ng/mL recombinant human macrophage colony-stimulating factor (rhM-CSF; PHC9504, Gibco) and 10% FBS for macrophages differentiation. After 7 days, cells were collected and subjected to flow cytometry analysis or transfection. Transfection of primary v was performed using the Neon transfection system (Invitrogen). shFABP4 and scramble shRNA (sh-negative control) were obtained from GenePharma (Shanghai, China). FABP4 overexpression construct was cloned into pcDNA3.1 vector (Invitrogen) as previous described. For LPS stimulation, primary macrophages were treated with LPS (L2630, Sigma-Aldrich; 1 μg/mL) for 24 h. The identity of primary macrophages was confirmed by flow cytometry by detecting surface expression of CD14, CD68, and HLA-DR as previously described. For IL-17A treatment, primary macrophages were incubated with IL-17A (78032, StemCell Technologies; 20 ng/mL). Cells were harvested and subjected to western blot analysis at designated time points.
Culture of naive and differentiating T cells in macrophage-conditioned medium
Primary macrophages were cultured for 24 h, as aforementioned. The media were collected and filtered using 0.22 μm filters and was defined as CM. Purified CD4+ naive T cells were cultured under Th17 cell-polarizing conditions (2 ng/mL TGF-β1, T7039, Sigma-Aldrich) or Treg-polarizing conditions (10 ng/mL IL-2, SRP6170, Sigma-Aldrich; 20 ng/mL TGF-β1, T7039, Sigma-Aldrich), combined with or without macrophages-CM (normal medium: CM = 2:1). For recombinant human FABP4 (rhFABP4) treatment, 10 μg/mL rhFABP4 (ab133145, Abcam) was added in the culture system. For neutralization experiments, 10 μg/mL anti-IL-17A (16-7178-81, eBioscience, Thermo Fisher Scientific) or anti-IL-23 antibody (16-7222-82, eBioscience) was added in the culture system
FACS
For detection of Treg cells, PBMCs were stained with surface markers anti-CD4-fluorescein isothiocyanate (FITC; 11-0049-80, eBioscience) and anti-CD25-APC (17-0259-42, eBioscience). After fixation and permeabilization, intracellular FOXP3 staining was conducted using anti-FOXP3-PE (12-4776-42, eBioscience). For detection of Th17 cells, PBMCs were stimulated with cell stimulation cocktail (plus protein transport inhibitors; 00-4975-93, Invitrogen) for 4 h. Cells were then harvested and rinsed with PBS. Cell viability was detected by FVS780 staining (565388, BD Biosciences, San Jose, CA, USA), followed by surface staining with anti-CD3-PE (12-0038-42, eBioscience) and anti-CD4-FITC (11-0049-80, eBioscience). Subsequently, cells were stained with anti-IL17A-APC (17-7179-42, eBioscience) following fixation and permeabilization. FACS was performed using BD Aria II (BD Biosciences), and data were analyzed using FlowJo software (Tree Star, Ashland, OR, USA).
Western blot
Primary macrophages were lysed using radioimmunoprecipitation assay (RIPA) lysis buffer (89900, Pierce, Thermo Fisher Scientific). Protein concentration was quantified using Bradford kit (23236, Pierce). Proteins were then separated by SDS-PAGE electrophoresis and transferred onto a polyvinylidene fluoride (PVDF) membrane. After blocking with 5% non-fat milk, the blots were incubated with primary antibodies at 4°C overnight and a goat anti-mouse HRP-conjugated secondary antibody (31430, Invitrogen; 1:5,000) or goat anti-rabbit HRP-conjugated secondary antibody (31460, Invitrogen; 1:5,000). Signal was visualized using enhanced chemiluminescence (ECL) detection (RPN2105, GE Healthcare). The primary antibodies used in western blot: anti-FABP4 (#2120; 1:1,000), anti-NLRP3 (#15101; 1:1,000), anti-ASC (#67824; 1:1,000), anti-caspase-1 (#3866; 1:1000), anti-cleaved caspase-1 (#4199; 1:1,000), anti-p-p65 (#3033; 1:1,000), anti-p65 (#8242; 1:1000), anti-p-IKKβ (#2697; 1:1,000), anti-IKKβ (#8943; 1:1,000), anti-p-ERK (#4370; 1:2,000), anti-ERK (#4695; 1:1000), anti-p-p38 (#4511; 1:1,000), anti-p38 (#8690; 1:1,000), anti-p-PERK (#3179; 1:1,000), anti-PERK (#5683; 1:1,000), anti-p-eIF2a (#3398; 1:1,000), anti-eIF2a (#5324; 1:1000), and anti-CHOP (#2895; 1:1,000) were obtained from Cell Signaling Technologies (CST, Beverly, MA, USA). Anti-β-actin (ab8227; 1:2,000) was from Abcam.
RNA isolation and qRT-PCR
Total RNA was extracted from primary macrophages using Trizol reagent (15596018, Invitrogen) and reverse-transcribed using QuantiTect Reverse Transcription Kit (205311, QIAGEN, Chatsworth, CA, USA). qRT-PCR was conducted using SYBR Green PCR Master Mix (4344463, Applied Biosystems, Thermo Fisher Scientific). GAPDH functioned as an internal control for normalization. The relative expression was calculated using 2–ΔΔCT method. The primers used in qRT-PCR are listed in Table 1.
Table 1
List of primers
Primer
Sequence 5′-3′
FABP4 sense
CATACTGGGCCAGGAATTTG
FABP4 anti-sense
GTGGAAGTGACGCCTTTCAT
IL-β sense
CGATGCACCTGTACGATCAC
IL-β anti-sense
TCTTTCAACACGCAGGACAG
IL-18 sense
TGGCTGCTGAACCAGTAGAA
IL-18 anti-sense
ATAGAGGCCGATTTCCTTGG
IL-17A sense
GCCCAAATTCTGAGGACAAG
IL-17A anti-sense
GGGGACAGTTCATGTGGT
IL-6 sense
CCTTCCAAAGATGGCTGAAA
IL-6 anti-sense
CAGGGGTGGTTATTGCATCT
IL-21 sense
TCCAGTCCTGGCAACATGGAGA
IL-21 anti-sense
GGCGATCTTGACCTTGGGAGC
IL-23 sense
AGTGGAAGTGGGCAGAGATTC
IL-23 anti-sense
CAGCAGCAACAGCAGCATTAC
List of primers
IF analysis
Primary macrophages on coverslips were fixed in 4% paraformaldehyde (PFA), premetallized with 0.1% Triton X-100, and blocked with 1% BSA. The slides were then incubated with anti-NLRP3 (ab4207, Abcam, 1:100) and anti-ASC antibodies (#67824, CST, 1:500) at 4°C overnight. The Alexa Fluor 488 donkey anti-goat (A-11055, Invitrogen, 1:500) and Alexa Fluor 555 donkey anti-rabbit (A-31572, Invitrogen, 1:500) secondary antibodies were then incubated at room temperature for 1 h. The IF images were obtained using confocal laser scanning microscope (Nikon, Tokyo, Japan).
Establishment of PE-like mice model
Adult pregnant Wistar mice (n = 60; body weight [b.w.] 200–250 g) were purchased from Hunan SJA Laboratory Animal (Hunan, China). All procedures for animal study were approved by The First Affiliated Hospital of Harbin Medical University. PE-like mice model was generated through the intraperitoneal injection of L-NAME (N5751, Sigma-Aldrich, 125 mg/kg b.w.). The pregnant mice were randomly divided into three groups: control (n = 10), L-NAME+vehicle (n = 10), and L-NAME+BMS309403 groups (n = 10). BMS309403 (5258, R&D, 1 mg/kg b.w.) was administered intraperitoneally. Saline was used as the vehicle control of BMS309403. For neutralization experiments, mice were randomly divided into three groups: control (n = 10), L-NAME+normal immunoglobulin G (IgG; n = 10), and L-NAME+IL-17A Ab groups (n = 10). Anti-IL-17A antibody (16-7178-81, eBioscience) was injected intraperitoneally at dose. On the gestational day 18.5 (GD 18.5), the mice were sacrificed. Blood and placenta samples were collected and subjected to subsequent analysis. Blood pressure and urine protein level were detected as previously described.
Statistical analysis
Data were presented as means ± SD. For differences between two groups, statistical analysis was carried out using two-tailed Student’s t test. For multiple comparison, differences were assessed by one-way ANOVA. Pearson’s correlation analysis was used to assess the degree of linear relationship between IL-17A and FABP4. Statistical analysis was conducted using the GraphPad Prism 8.0. p <0.05 was considered to be statistically significant.
Authors: Bo Wang; Jun Xu; Qian Ren; Lu Cheng; Fan Guo; Yan Liang; Letian Yang; Zhouke Tan; Ping Fu; Liang Ma Journal: Cell Death Dis Date: 2022-04-11 Impact factor: 8.469