Jian Chen1, Risi Na2, Chao Xiao3, Xiao Wang4, Yupeng Wang5, Dongwang Yan6, Guohe Song5, Xueni Liu6, Jiayi Chen6, Huijun Lu7, Chunyan Chen8, Huamei Tang9,10, Guohong Zhuang11, Guangjian Fan12, Zhihai Peng13,14. 1. Department of Thoracic Surgery, Shanghai Pulmonary Hospital, School of Medicine, Tong Ji University, Shanghai, China. 2. Department of General Surgery, Xiang An Hospital of Xiamen University, School of Medicine, Xiamen University, Xiamen, China. 3. Department of General Surgery, Hua Shan Hospital, School of Medicine, Fu Dan University, Shanghai, China. 4. Department of Gastrointestinal Surgery, The Fifth Affiliated Hospital of Sun Yat-Sen University, Zhuhai, China. 5. Department of General Surgery, Zhong Shan Hospital, School of Medicine, Fu Dan University, Shanghai, China. 6. Translational Medicine Center, Shanghai General Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai, China. 7. Department of Pathology, Guigang City People's Hospital, Guigang, Guangxi, China. 8. Department of Pathology, Shanghai Jiao Tong University Affiliated Sixth People's Hospital, Shanghai, China. 9. Department of General Surgery, Xiang An Hospital of Xiamen University, School of Medicine, Xiamen University, Xiamen, China. tanghuamei2014@163.com. 10. Organ Transplantation Institute of Xiamen University, Fujian Provincial Key Laboratory of Organ and Tissue Regeneration, School of Medicine, Xiamen University, Xiamen, China. tanghuamei2014@163.com. 11. Organ Transplantation Institute of Xiamen University, Fujian Provincial Key Laboratory of Organ and Tissue Regeneration, School of Medicine, Xiamen University, Xiamen, China. zhgh@xmu.edu.cn. 12. Translational Medicine Center, Shanghai General Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai, China. ytfan@126.com. 13. Department of General Surgery, Xiang An Hospital of Xiamen University, School of Medicine, Xiamen University, Xiamen, China. pengzhihai1958@163.com. 14. Organ Transplantation Institute of Xiamen University, Fujian Provincial Key Laboratory of Organ and Tissue Regeneration, School of Medicine, Xiamen University, Xiamen, China. pengzhihai1958@163.com.
Abstract
5-Fluorouracil (5-FU)-based chemotherapy is the first-line treatment for colorectal cancer (CRC) but is hampered by chemoresistance. Despite its impact on patient survival, the mechanism underlying chemoresistance against 5-FU remains poorly understood. Here, we identified serine hydroxymethyltransferase-2 (SHMT2) as a critical regulator of 5-FU chemoresistance in CRC. SHMT2 inhibits autophagy by binding cytosolic p53 instead of metabolism. SHMT2 prevents cytosolic p53 degradation by inhibiting the binding of p53 and HDM2. Under 5-FU treatment, SHMT2 depletion promotes autophagy and inhibits apoptosis. Autophagy inhibitors decrease low SHMT2-induced 5-FU resistance in vitro and in vivo. Finally, the lethality of 5-FU treatment to CRC cells was enhanced by treatment with the autophagy inhibitor chloroquine in patient-derived and CRC cell xenograft models. Taken together, our findings indicate that autophagy induced by low SHMT2 levels mediates 5-FU resistance in CRC. These results reveal the SHMT2-p53 interaction as a novel therapeutic target and provide a potential opportunity to reduce chemoresistance.
5-Fluorouracil (5-FU)-based chemotherapy is the first-line treatment for colorectal cancer (CRC) but is hampered by chemoresistance. Despite its impact on patient survival, the mechanism underlying chemoresistance against 5-FU remains poorly understood. Here, we identified serine hydroxymethyltransferase-2 (SHMT2) as a critical regulator of 5-FU chemoresistance in CRC. SHMT2 inhibits autophagy by binding cytosolic p53 instead of metabolism. SHMT2 prevents cytosolic p53 degradation by inhibiting the binding of p53 and HDM2. Under 5-FU treatment, SHMT2 depletion promotes autophagy and inhibits apoptosis. Autophagy inhibitors decrease low SHMT2-induced 5-FU resistance in vitro and in vivo. Finally, the lethality of 5-FU treatment to CRC cells was enhanced by treatment with the autophagy inhibitor chloroquine in patient-derived and CRC cell xenograft models. Taken together, our findings indicate that autophagy induced by low SHMT2 levels mediates 5-FU resistance in CRC. These results reveal the SHMT2-p53 interaction as a novel therapeutic target and provide a potential opportunity to reduce chemoresistance.
Colorectal cancer (CRC) is the third leading cause of cancer mortality worldwide due to its metastatic properties and resistance to current treatments [1]. 5-Fluorouracil (5-FU)-based adjuvant chemotherapy is a widely accepted systemic therapeutic option for CRC patients; however, there is an urgent need to better understand the underlying chemoresistance mechanism of CRC to this treatment and identify tumor cell-specific therapeutic targets for drug discovery or “repositioning” of known therapies [2, 3].Autophagy, a catabolic process, is thought to buffer metabolic stress, thereby promoting cell survival [4, 5]. In the context of cancer, autophagy plays a puzzling role, serving as a tumor suppressor during the initial stages but later protecting tumor cells from chemo- and radioresistance, hypoxia and the immune defense system [6-11]. Various cellular stressors, including the tumor suppressor p53, can stimulate autophagy [4]. On the other hand, pharmacological interference and the knockout or knockdown of p53 can also induce autophagy [12, 13]. Therefore, p53 has a dual effect on autophagy. Cytosolic but not nuclear p53 is responsible for inhibiting autophagy [12, 13]. However, despite the critical role of cytosolic p53 in autophagy, the upstream signals controlling this protein remain unknown. In addition, the mechanism by which cytosolic p53 influences chemoresistance through autophagy requires exploration.Because of the rapid proliferation of CRC cells, moderate serine amounts must be converted to glycine to support nucleotide biosynthesis and proliferation [14-19]. Serine hydroxymethyltransferase 2 (SHMT2) plays a regulatory role in the conversion of serine to glycine [20, 21]. SHMT2 is upregulated in cancers to support tumor cell proliferation [22-25]. It is required for glioma cell survival and renders these cells sensitive to inhibition of the glycine cleavage system [18]. SHMT2 is, therefore, a potential oncogene promoting colorectal carcinogenesis [23, 26]. SHMT2 can be deacetylated by SIRT3 and SIRT5 at Lys 95 and 280, respectively, increasing enzymatic activity and driving cancer cell proliferation [26, 27]. In addition, SHMT2 functions as a component of the BRISC-SHMT2 complex to deubiquitinate type 1 interferon (IFN) receptor chain 1 (IFNAR1) and HIV-1 Tat in the cytoplasm [28, 29]. Thus, SHMT2 not only functions as a methyltransferase but also plays a role in protein degradation, implying that its role in oncotherapy is complicated and requires further investigation.In this study, we found via Gene Expression Omnibus (GEO) and TCGA database analysis that SHMT2 is tightly related to CRC progression [30, 31]. Strikingly, CRC patient samples with lower levels of SHMT2 exhibited greater 5-FU resistance than those with higher levels of SHMT2. We further found that SHMT2 binds to cytosolic p53 and suppresses its degradation, which in turn inhibits autophagy. Consistent with this result, the autophagy inhibitor chloroquine (CQ) increased the 5-FU chemosensitivity of CRC samples with low levels of SHMT2. Our study thus reveals a new function of SHMT2 in autophagy through the maintenance of cytosolic p53 stability instead of metabolism and suggests a potential anticancer chemotherapeutic strategy.
Materials and methods
Patients, cohorts, and tissue microarrays
Fifty paired fresh-frozen samples of primary colorectal carcinoma (CRC) and adjacent normal colon tissues were collected from the Department of Surgery at Shanghai General Hospital, School of Medicine, Shanghai Jiaotong University. A total of 378 paraffin-embedded samples of stage II–III primary colorectal carcinoma were collected between 2003 and 2011. Tissue microarrays were constructed from these samples. All the samples were obtained during surgery. This research was approved by the Ethics Committee of Shanghai General Hospital (2016KY069), and written informed consent was obtained from all patients before enrollment in the study.
Nude mouse xenograft models
CRC xenografts were established in 5-week-old female BALB/c nude mice purchased from the Institute of Zoology, Chinese Academy of Sciences, Shanghai. Tumor-bearing and the calculation of tumor volumes were performed as previously described [32]. Briefly, SHMT2-sh and control cells (3 × 106) were injected subcutaneously into the flanks of nude mice. 5-FU (20 mg/kg/day) was injected intraperitoneally weekly for 3 weeks. CQ (10 mg/kg) was administered as a daily oral gavage. All animal procedures were conducted in accordance with the Hospital Animal Care guidelines of Shanghai General Hospital. All efforts were made to minimize animal suffering.
Establishment of the PDX model
Fresh tissues from 4 CRC patients (two with high SHMT2 expression and two with low SHMT2 expression) undergoing surgical treatment were obtained and implanted subcutaneously into the flanks of female NOD-Prkdcscid Il2rgtm1/Bcgen (B-NSG) mice (Biocytogen) with a 10-gauge trocar needle. Once established, solid tumor xenografts were serially passaged using the same technique. A primary tissue sample was anonymized and obtained by the Shanghai General Hospital (Shanghai, China) Institutional Review Board.
Cell lines, plasmids, and reagents
The human cell lines HCT116, SW480 and 293 T were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). All the cell lines were maintained in DMEM supplemented with 10% FBS (Gibco, USA) at 37°C, 95% humidity and 5% CO2. The SHMT2, HDM2, p53 and p53 mutant (NLS- and NES-) sequences [13] were cloned into the pCDNA 3.0 vector or the pLVX-IRES lentiviral vector by standard cloning methods. To construct mCherry–GFP–LC3 reporter, the mCherry sequence and the cDNA sequence of LC3B were into the 5ʹ and 3ʹ regions of EGFP, respectively. The sequences of the pLKO.1-shRNAs targeting SHMT2 double-stranded oligonucleotides were as follows: 5ʹCCGGACAAGTACTCGGAGGGTTATCCTCGAGGATAACCCTCCGAGTACTTGTTTTTTG (SHMT2-sh-1), 5ʹCCGGTAGGGCAAGAGCCAGGTATAGCTCGAGTAGGGCAA-GAGCCAGGTATAGTTTTTG (SHMT2-sh-2), and 5ʹCCGGGTCTGACGTCAAGCGGAT-ATCCTCGAGGATATCCGCTTGACGTCAGACTTTTTTG (SHMT2-sh-3).The sequence of the shRNA targeting p53 was as follow: 5ʹCCGGCGGCGCACAGAGGAAGAGAATCTCGAGATTCTCTTCCTCTGTGC-GCCGTTTTTG (p53-Sh) (all target sequences are underlined). 3-MA, CQ and sodium formate (71539, Sigma) were obtained from Sigma. Antibodies specific for LC3 (ABC929, Sigma; ab48394, Abcam), SHMT2 (NBP1-80755, Novus Biologicals, USA), p62 (p0017, Sigma), p53 (DO-1, Santa Cruz; ab32389, Abcam) and actin (A1978, Sigma) were used.
CRISPR/Cas9 knockout cell lines
The sgRNA sequences targeting SHMT2 were designed with CRISPR Designer (http://crispr.mit.edu/). The guide sequences targeting human SHMT2 were 5ʹ- CACCGCGAGTACTTGTTGTTCAGAC-3ʹ and 5ʹ-CACCGGTTGCTGTGCTGAGC-CCGAA-3ʹ.
Immunohistochemistry
Immunohistochemistry was performed as previously described [32]. The intensity and extent of staining were evaluated independently by two pathologists blinded to the patient outcomes. The staining score was calculated by multiplying the intensity score by the extent score. The patients with CRC were stratified by the final staining score into two groups: 0–8, lower expression; 9–12, higher expression.
Western blot analysis and immunofluorescence
Cell lysate preparation, western blot analysis, and Immunofluorescence were performed as previously described [33, 34].
Transmission electron microscopy
Cells were fixed with 2.5% glutaraldehyde containing 0.1 mol/L sodium cacodylate and treated with 1% osmium tetroxide. After dehydration, samples were embedded in Araldite and were then cut into thin sections that were stained with uranyl acetate and lead citrate. Digital images were obtained with a Philips CM-120 transmission electron microscope at 60 kV. Autophagosomes (APs) can be identified through their contents and double bilayers with narrow electron-lucent clefts. Autolysosomes (ALs) can be identified by their partially degraded, electron-dense contents.
Proximity ligation assay (PLA)
Cells were permeabilized and treated with primary antibodies. Duolink® In Situ PLA probes and Duolink® In Situ detection reagents (Cat. No: DUO92101) were obtained from Sigma-Aldrich (Munich, Germany). The PLA assay was performed according to the manufacturer’s instructions. Cells were incubated with PLA probes for 1 h. Cells were then incubated with the ligation mix for 30 min, and the Cy3 amplification mix was applied to the slides for 100 min at 37°C. The samples were mounted using Duolink® In Situ Mounting Medium with DAPI.
mCherry-GFP-LC3 reporter assay
0.5 μg of the mCherry-GFP-LC3B plasmid and 1.5 μg of pLKO.1-shRNA plasmids expressing Scramble-sh or SHMT2-sh were cotransfected into HCT116 cells. The cells were incubated in mock medium or medium containing 100 μM CQ for 8 h and were then fixed with 4% paraformaldehyde (Sigma-Aldrich). The cells were subsequently stained with DAPI, and the formation of intracellular puncta was monitored with a Leica TCS SP8 microscope.
Sodium formate treatment and metabolic rescue experiments
Cells were treated with sodium formate (Sigma–Aldrich) at the indicated concentrations and collected as previously described after 12 h for western blotting. WT SHMT2 plasmids and plasmids carrying the sequences for the SHMT2 K95Q [26], K280Q and E98L/Y106F [35] catalytically inactive mutants were transfected into HCT116 SHMT-sh cells (clone-2) and collected as previously described after 24 h for western blotting.
Quantification of GFP–LC3 puncta
Cellular autophagic activities were assessed by determining the formation of GFP-LC3 aggregates in HCT116 cells and were quantified by counting the percentage of cells exhibiting the accumulation of GFP-LC3 in dots or vacuoles (GFP-LC3vac). Puncta were counted in a minimum of 100 cells per sample in three replicates. Cells exhibiting a mostly diffusive distribution of GFP-LC3 in the cytoplasm and nucleus were considered nonautophagic, whereas cells showing several intense punctate GFP-LC3 aggregates but no nuclear GFP-LC3 were classified as autophagic. Each GFP-LC3 stained sample was evaluated by two independent investigators.
GC–MS analysis
The GC–MS experiments were conducted as previously described [36]. In total, six biological replicates per group were subjected to GC/MS analysis. Metabolites with variable influence on projection values greater than 1.0 and P < 0.05 were included.
Statistical analysis
Student’s two-tailed t test and GraphPad Prism were used for statistical analysis. A P < 0.05 was considered to indicate a significant difference.
Results
Analysis of CRC via high-throughput database screening reveals that SHMT2 is pivotal in CRC
Currently, the GEO (Gene Expression Omnibus) database harbors the most comprehensive datasets for the gene expression profiles of all cancer types. To identify key genes that might significantly contribute to the prognosis of CRC, we first analyzed differentially expressed genes (DEGs) between CRC and adjacent normal tissues (control) using a machine learning approach based on five algorithms (diagonal linear discriminant analysis, Bayesian CCP, nearest neighbor, nearest centroid and support vector machines). A total of 66 genes were identified using the GSE9348 datasets [37] as the training cohort, which contained 72 CRC and 12 control cases (Fig. S1A–B). These genes were further validated in another two independent cohorts (GSE44076 [38] and GSE44861 [39]) containing 154 CRC and 153 control cases (Fig. S1C–E). In addition to some well-established oncogenes (e.g., MYC and MET), SHMT2 emerged among many DEGs that might potentially contribute to prognosis. Next, we analyzed the prognostic effect of these 66 genes by a Cox regression model in 532 tissue samples with prognostic information (GSE14333 [40], GSE17536 [41], and GSE29621 [42]) and applied the random forest test to further characterize the most valuable factors that could predict CRC prognosis (Fig. S1F–G). Five core genes that contributed most to the risk score were identified as survival predictors of CRC: risk score = −0.370 × CPM − 0.122 × GUCA2B + 0.332 × MET + 0.088 × SCN9A + 0.827 × SHMT2. Among these genes, SHMT2, which encodes one of the most prominent enzymes in cancer metabolism, has been little studied in CRC, which inspired us to investigate further.
SHMT2 interacts with cytosolic p53
Although SHMT2 is an essential enzyme in one-carbon metabolism, it is found in complex with many other important proteins, including BRISC [28, 29]. Herein, a proteomic analysis was carried out to identify potential SHMT2-interacting partners through IP/MS. As shown in Figs. 1A, B, p53 was identified as a novel SHMT2 binding protein, along with KIAA0157, a known SHMT2 binding protein (Fig. 1B). In HCT116 cells, SHMT2-Flag coimmunoprecipitated with p53 (Fig. 1C). Furthermore, we separated endogenous nuclear and cytosolic p53 and found that SHMT2 seemed to predominantly interact with the cytosolic fraction of endogenous p53 in HCT116 cells (Fig. 1D). Tumor-suppressing p53 is upregulated in response to DNA damage, oncogene activation, or exposure to other stresses [43]. Nuclear p53 acts as a transcription factor that transcriptionally activates genes involved in apoptosis and numerous other processes [43], whereas cytosolic p53 has been found to inhibit autophagy and trigger apoptosis [12, 13, 44]. As SHMT2 is localized mainly in both mitochondria and the cytoplasm [28], we constructed a wild-type (WT) p53, a cytosol-only p53 (NLS-) mutant with a disrupted nuclear localization sequence (NLS), and a nuclear-retained p53 (NES-) mutant with a disrupted nuclear export signal [13] to assess which subpopulation of cellular p53 interacted with SHMT2. The results of coimmunoprecipitation experiments showed that SHMT2 interacted with cytosolic p53 (NLS-) but not nuclear p53 (NES-) (Fig. 1E). Moreover, the immunofluorescence results showed that SHMT2 partially colocalized with cytosolic p53 in cells cotransfected with SHMT2, WT p53, nuclear p53 (NES-), or cytosolic p53 (NLS-) [13] (Fig. 1F). Consistent with the finding that p53 is also localized in the cytoplasm [44], the colocalization of endogenous SHMT2 with cytosolic p53 was also observed (Fig. 1G). A proximity ligation assay (PLA) was performed, and the data provided further evidence that these proteins colocalized with each other (Fig. 1H). Collectively, these results indicated that SHMT2 interacts with cytosolic p53.
Fig. 1
SHMT2 interacts with cytosolic p53.
A, B SHMT2 purified by Flag-IP was collected after in-gel digestion and used for LC-MS/MS analysis to search for the binding proteins of SHMT2. A Flag-SHMT2 was transfected into 293 T cells for 24 h, isolated by coimmunoprecipitation, separated by SDS-PAGE and stained using Coomassie. B Tabular display of the number of tryptic peptides from each of the indicated proteins that coprecipitated with SHMT2. C HCT116 cells transfected with Flag-SHMT2 were immunoprecipitated with FLAG-M2 beads. Western blotting for p53 and SHMT2 was then performed. Immunoprecipitation using an anti-p53 antibody (Do-1) was followed by western blotting with anti-SHMT2 or anti-p53 antibodies (ab32389, Abcam). D SHMT2 interacted mainly with endogenous cytosolic p53 in HCT116 cells. Cyt cytosolic, Nuc nuclear. E Cytosolic p53 bound to SHMT2. HCT116 cells transfected with Flag-WT, nuclear (NES-) or cytosolic p53 (NLS-) were immunoprecipitated with FLAG-M2 beads. Western blotting for FLAG and SHMT2 was then performed. F–H Colocalization of SHMT2 and cytosolic p53. A set of partially enlarged pictures are attached on the right side. F Representative micrographs of HCT116 cells transfected with plasmids expressing WT, nuclear (NES-) and cytosolic p53 (NLS-). G Representative micrographs of HCT116 cells stained for SHMT2 and p53. H Representative micrographs of HCT116 cells in the proximity ligation assay (PLA). Scale bar, 10 μm. PLA foci per nucleus for the two antibodies are presented in the histogram.
SHMT2 interacts with cytosolic p53.
A, B SHMT2 purified by Flag-IP was collected after in-gel digestion and used for LC-MS/MS analysis to search for the binding proteins of SHMT2. A Flag-SHMT2 was transfected into 293 T cells for 24 h, isolated by coimmunoprecipitation, separated by SDS-PAGE and stained using Coomassie. B Tabular display of the number of tryptic peptides from each of the indicated proteins that coprecipitated with SHMT2. C HCT116 cells transfected with Flag-SHMT2 were immunoprecipitated with FLAG-M2 beads. Western blotting for p53 and SHMT2 was then performed. Immunoprecipitation using an anti-p53 antibody (Do-1) was followed by western blotting with anti-SHMT2 or anti-p53 antibodies (ab32389, Abcam). D SHMT2 interacted mainly with endogenous cytosolic p53 in HCT116 cells. Cyt cytosolic, Nuc nuclear. E Cytosolic p53 bound to SHMT2. HCT116 cells transfected with Flag-WT, nuclear (NES-) or cytosolic p53 (NLS-) were immunoprecipitated with FLAG-M2 beads. Western blotting for FLAG and SHMT2 was then performed. F–H Colocalization of SHMT2 and cytosolic p53. A set of partially enlarged pictures are attached on the right side. F Representative micrographs of HCT116 cells transfected with plasmids expressing WT, nuclear (NES-) and cytosolic p53 (NLS-). G Representative micrographs of HCT116 cells stained for SHMT2 and p53. H Representative micrographs of HCT116 cells in the proximity ligation assay (PLA). Scale bar, 10 μm. PLA foci per nucleus for the two antibodies are presented in the histogram.
Depletion of SHMT2 induces autophagy
Cytosolic p53 mediates the inhibition of autophagy, as deletion, depletion, or pharmacological inhibition of p53 induces autophagy in mouse, human and nematode cells [13]. Having verified the binding of SHMT2 to cytosolic p53, we then examined autophagic flux in cells with endogenous SHMT2, SHMT2 knockdown (SHMT2-sh), or SHMT2 knockout (SHMT2-KO). During AP maturation, cytoplasmic LC3 is conjugated to phosphatidylethanolamine (PE) and transported to the surface of the phagophore, increasing the ratio of PE-LC3 (LC3-II) versus cytoplasmic LC3 (LC3-I) [5, 45]. Upon autophagy activation, P62, an adaptor for autophagic substrates and a key regulator in autophagy [46], is also degraded, rendering it another commonly used reporter for cellular autophagy activity. As shown in Fig. 2A–C, the [LC3-II]/[LC3-I] ratio was markedly increased and p62 levels were decreased in SHMT2-sh and SHMT2-KO cells compared to control HCT116 cells, which clearly suggested that cellular autophagy was activated upon SHMT2 deficiency. Moreover, overexpression of SHMT2 seemed to efficiently suppress cellular autophagy triggered by glucose deprivation (Fig. 2D). To visualize the autophagic vesicles directly, we examined them by both GFP-LC3 puncta and transmission electron microscopy (TEM). Consistently, SHMT2 knockdown increased the number of LC3 puncta per cell (Fig. 2E–F). TEM analysis of autophagy in SHMT2-sh cells revealed that SHMT2 knockdown led to a marked increase in the number of autophagic vacuoles (AVs) in vitro (Fig. 2G–H). Consistent with these findings, enhanced autophagy was also observed in SW480 cells (Fig. 2I) and was inhibited by CQ (Fig. 2J). To examine autophagic flux in detail, we also monitored APs and ALs via the mCherry–GFP–LC3 reporter, which labeled APs and ALs with yellow and red fluorescence, respectively. SHMT2 knockdown increased the numbers of both APs and ALs in HCT116 cells, and CQ treatment increased the number of APs but decreased the number of ALs in SHMT2-sh cells (Fig. 2K–M). The above data indicate that autophagy is enhanced in SHMT2-low cells.
Fig. 2
Depletion of SHMT2 induces autophagy.
A The effect of SHMT2 on autophagy. To establish stable cell lines, HCT116 cells were infected with Scramble-sh (Control) or SHMT2 knockdown (SHMT2-sh-1, -sh-2, or -sh-3) lentivirus for 72 h and selected with puromycin (1 mg/ml). The protein levels of endogenous SHMT2, p62, LC3, and β-actin (as the internal standard) were examined by western blotting. B Identification of SHMT2-KO monoclonal HCT116 cell lines. C The protein levels of endogenous SHMT2, p62, LC3, and β-actin were evaluated in control and SHMT2-KO HCT116 cells. D The effect of SHMT2 on autophagy under glucose deprivation (GD) was assessed. E GFP-LC3 puncta were induced in SHMT2 knockdown cells. Control and SHMT2-sh stable HCT116 cell lines were transfected with the GFP-LC3 plasmid and cultured in complete medium for 24 h. Scale bar, 10 μm. F The percentage of cells exhibiting accumulation of GFP-LC3 in puncta (GFP-LC3vac) is shown (mean ± s.d., n = 3; **P < 0.01). G Ultrastructural evidence of autophagic vacuolization induced by SHMT2 depletion. H The numbers of autophagosomes (APs) and autolysosomes (ALs) were determined in at least 50 cells in three independent experiments (mean ± s.d.; **P < 0.01). I Effect of SHMT2 on LC3 maturation in SW480 cells. To establish stable cell lines, SW480 cells were infected with Scramble-sh (Control) or SHMT2 knockdown (SHMT2-sh-1 or -sh-2) lentivirus for 72 h and selected with puromycin (1 mg/ml). The protein levels of endogenous SHMT2, p62, LC3, and β-actin (as the internal standard) were examined by western blotting. J Autophagy levels were increased in SHMT2-sh cells and prevented by the autophagy inhibitor chloroquine (CQ). K–M Representative images and quantification of HCT116 cells expressing mCherry-GFP-LC3B and the indicated shRNA. APs and ALs were identified as yellow and red puncta, respectively. The numbers of puncta are shown as the mean ± s.e.m. values. Statistical significance was determined by Poisson regression. ns nonsignificant, *P < 0.05, ***P < 0.001.
Depletion of SHMT2 induces autophagy.
A The effect of SHMT2 on autophagy. To establish stable cell lines, HCT116 cells were infected with Scramble-sh (Control) or SHMT2 knockdown (SHMT2-sh-1, -sh-2, or -sh-3) lentivirus for 72 h and selected with puromycin (1 mg/ml). The protein levels of endogenous SHMT2, p62, LC3, and β-actin (as the internal standard) were examined by western blotting. B Identification of SHMT2-KO monoclonal HCT116 cell lines. C The protein levels of endogenous SHMT2, p62, LC3, and β-actin were evaluated in control and SHMT2-KO HCT116 cells. D The effect of SHMT2 on autophagy under glucose deprivation (GD) was assessed. E GFP-LC3 puncta were induced in SHMT2 knockdown cells. Control and SHMT2-sh stable HCT116 cell lines were transfected with the GFP-LC3 plasmid and cultured in complete medium for 24 h. Scale bar, 10 μm. F The percentage of cells exhibiting accumulation of GFP-LC3 in puncta (GFP-LC3vac) is shown (mean ± s.d., n = 3; **P < 0.01). G Ultrastructural evidence of autophagic vacuolization induced by SHMT2 depletion. H The numbers of autophagosomes (APs) and autolysosomes (ALs) were determined in at least 50 cells in three independent experiments (mean ± s.d.; **P < 0.01). I Effect of SHMT2 on LC3 maturation in SW480 cells. To establish stable cell lines, SW480 cells were infected with Scramble-sh (Control) or SHMT2 knockdown (SHMT2-sh-1 or -sh-2) lentivirus for 72 h and selected with puromycin (1 mg/ml). The protein levels of endogenous SHMT2, p62, LC3, and β-actin (as the internal standard) were examined by western blotting. J Autophagy levels were increased in SHMT2-sh cells and prevented by the autophagy inhibitor chloroquine (CQ). K–M Representative images and quantification of HCT116 cells expressing mCherry-GFP-LC3B and the indicated shRNA. APs and ALs were identified as yellow and red puncta, respectively. The numbers of puncta are shown as the mean ± s.e.m. values. Statistical significance was determined by Poisson regression. ns nonsignificant, *P < 0.05, ***P < 0.001.
Depletion of SHMT2 induces autophagy via degradation of cytosolic p53 in response to 5-FU treatment
Typically, SHMT2 functions to regulate one-carbon metabolism [47, 48]. We thus analyzed the metabolites in cells with or without SHMT2 knockdown and found that the metabolites that changed the most after SHMT2 knockdown were involved in arginine and proline metabolism; alanine, aspartate and dicarboxylate metabolism; pyrimidine metabolism; and valine, leucine and isoleucine biosynthesis (Fig. S2A). It has been established that cellular autophagy activities can be modulated when cell metabolism is altered [49-51]. However, as shown in Fig. S2B, treatment with sodium formate (a one-carbon metabolite mimic) did not suppress the cellular autophagy activated by SHMT2 deficiency (in SHMT2-KO cells), suggesting that the changes in one-carbon metabolites might not directly influence cellular autophagy. In other words, this result helped us decouple the enzyme activity of SHMT2 and its autophagy-suppressing function. Even stronger evidence came from the fact that enzymatically dead [26, 35] could efficiently suppress autophagy activated upon SHMT2 knockout (Fig. S2C). Altogether, we believe it is safe to conclude that the effects of SHMT2 on autophagy are not dependent on its typical function in one-carbon metabolism.Next, we evaluated whether SHMT2 regulates autophagy via cytosolic p53. SHMT2 overexpression affected neither the LC3-II/I ratio nor the p62 level in the absence of p53 (Fig. 3A). Similar results were also observed in p53 knockdown cells (Fig. 3B). To further assess whether SHMT2-mediated autophagy inhibition is p53 dependent, we restored p53 expression in SHMT2-sh cells and found that WT p53 and cytosolic p53 (NLS-) but not nuclear p53 (NES-) reversed the induction of autophagy resulting from SHMT2 depletion (Fig. 3C). Similarly, WT p53 and cytosolic p53 decreased the number of LC3 puncta per cell and the level of GFP–LC3 in SHMT2-sh cells (Fig. 3D–E). Collectively, these results indicate that SHMT2 inhibits autophagy via cytosolic p53.
Fig. 3
SHMT2 depletion induces autophagy via degradation of cytosolic p53 in response to 5-FU treatment.
A–C Effect of SHMT2 and p53 on LC3 maturation. The protein levels of SHMT2, p53, p62, LC3, and β-actin (as the internal standard) were assessed by western blotting using anti-Flag and anti-p53, anti-p62, anti-LC3, and anti-β-actin antibodies, respectively. A HCT116p53+/+ cells and HCT116p53-/- cells were transfected with Flag-SHMT2 for 24 h. B HCT116 cells were infected with Scramble-sh (Control) or p53 knockdown (Sh) lentivirus for 72 h and transfected with Flag-SHMT2 for 24 h. C Stable control and SHMT2-sh cells were transfected with Flag-WT, nuclear (NES-) and cytosolic p53 (NLS-) plasmids for 24 h. The protein levels of p53, SHMT2, p62, LC3, and β-actin were assessed by western blotting using anti-Flag and anti-p53, anti-SHMT2, anti-p62, anti-LC3, and anti-β-actin antibodies, respectively. D GFP-LC3 puncta formation induced by SHMT2-sh or p53 mutants. Control and SHMT2-sh stable HCT116 cell lines were transfected with Flag-WT p53, nuclear (NES-) p53, cytosolic p53 (NLS-), or GFP-LC3 plasmids and cultured in complete medium for 24 h. Scale bar, 10 μm. E The percentage of HCT116 and SW480 cells exhibiting accumulation of GFP-LC3 in puncta (GFP-LC3vac) is shown (mean ± s.d., n = 3; **P < 0.01). Puncta were quantified from 100 cells. F SHMT2 disrupted the binding of cytosolic p53 to HDM2. HCT116 cells transfected with GFP-HDM2, HA-SHMT2, and Flag-cytosolic p53 (NLS-) plasmids were immunoprecipitated with FLAG-M2 beads. Western blotting for p53, GFP, and HA was then performed. G SHMT2 maintained the stability of cytosolic p53. Western blot analysis of lysates of cells with stable SHMT2 overexpression and knockdown that were transfected with Flag-WT, nuclear (NES-), and cytosolic p53 (NLS-) plasmids and treated with the translation inhibitors cycloheximide (CHX, 50 μg/ml) and MG132 (25 μM, 4 h) for the indicated durations. H, I HCT116 cells transfected with Flag-cytosolic p53 (NLS-), GFP-SHMT2 or GFP-HDM2 were immunoprecipitated with FLAG-M2 beads. Western blotting for p53 and GFP was then performed. H 5-FU disrupted the binding of cytosolic p53 to SHMT2. I 5-FU promoted the binding of cytosolic p53 to HDM2. J Western blot analysis of lysates of HCT116 cells transfected with Flag-cytosolic p53 (NLS-) or SHMT2 plasmids and treated with CHX and MG132 for the indicated durations with or without 5-FU. K Nuclear-cytosolic separation shows that SHMT2 affects the stability of endogenous cytosolic p53. Cyt cytosolic, Nuc nuclear.
SHMT2 depletion induces autophagy via degradation of cytosolic p53 in response to 5-FU treatment.
A–C Effect of SHMT2 and p53 on LC3 maturation. The protein levels of SHMT2, p53, p62, LC3, and β-actin (as the internal standard) were assessed by western blotting using anti-Flag and anti-p53, anti-p62, anti-LC3, and anti-β-actin antibodies, respectively. A HCT116p53+/+ cells and HCT116p53-/- cells were transfected with Flag-SHMT2 for 24 h. B HCT116 cells were infected with Scramble-sh (Control) or p53 knockdown (Sh) lentivirus for 72 h and transfected with Flag-SHMT2 for 24 h. C Stable control and SHMT2-sh cells were transfected with Flag-WT, nuclear (NES-) and cytosolic p53 (NLS-) plasmids for 24 h. The protein levels of p53, SHMT2, p62, LC3, and β-actin were assessed by western blotting using anti-Flag and anti-p53, anti-SHMT2, anti-p62, anti-LC3, and anti-β-actin antibodies, respectively. D GFP-LC3 puncta formation induced by SHMT2-sh or p53 mutants. Control and SHMT2-sh stable HCT116 cell lines were transfected with Flag-WT p53, nuclear (NES-) p53, cytosolic p53 (NLS-), or GFP-LC3 plasmids and cultured in complete medium for 24 h. Scale bar, 10 μm. E The percentage of HCT116 and SW480 cells exhibiting accumulation of GFP-LC3 in puncta (GFP-LC3vac) is shown (mean ± s.d., n = 3; **P < 0.01). Puncta were quantified from 100 cells. F SHMT2 disrupted the binding of cytosolic p53 to HDM2. HCT116 cells transfected with GFP-HDM2, HA-SHMT2, and Flag-cytosolic p53 (NLS-) plasmids were immunoprecipitated with FLAG-M2 beads. Western blotting for p53, GFP, and HA was then performed. G SHMT2 maintained the stability of cytosolic p53. Western blot analysis of lysates of cells with stable SHMT2 overexpression and knockdown that were transfected with Flag-WT, nuclear (NES-), and cytosolic p53 (NLS-) plasmids and treated with the translation inhibitors cycloheximide (CHX, 50 μg/ml) and MG132 (25 μM, 4 h) for the indicated durations. H, I HCT116 cells transfected with Flag-cytosolic p53 (NLS-), GFP-SHMT2 or GFP-HDM2 were immunoprecipitated with FLAG-M2 beads. Western blotting for p53 and GFP was then performed. H 5-FU disrupted the binding of cytosolic p53 to SHMT2. I 5-FU promoted the binding of cytosolic p53 to HDM2. J Western blot analysis of lysates of HCT116 cells transfected with Flag-cytosolic p53 (NLS-) or SHMT2 plasmids and treated with CHX and MG132 for the indicated durations with or without 5-FU. K Nuclear-cytosolic separation shows that SHMT2 affects the stability of endogenous cytosolic p53. Cyt cytosolic, Nuc nuclear.Induction of autophagy has been reported to stimulate proteasome-mediated degradation of p53 through a pathway dependent on the E3 ubiquitin ligase HDM2 [13, 43]. Therefore, we investigated whether SHMT2 interferes with p53–HDM2 binding. The results of a coimmunoprecipitation competition assay showed that SHMT2 prevents cytosolic p53 from interacting with HDM2 (Fig. 3F). SHMT2 stabilized cytosolic p53 but not nuclear p53; moreover, MG132 counteracted the SHMT2-sh-induced degradation of cytosolic p53 (Fig. 3G). After 5-FU treatment, SHMT2–p53 binding was decreased (Fig. 3H), and p53–HDM2 binding was increased (Fig. 3I). 5-FU markedly accelerated cytosolic p53 protein degradation, while SHMT2 overexpression and MG132 treatment delayed cytosolic p53 protein degradation (Fig. 3J). Thus, overexpression of SHMT2 promoted the protein accumulation of endogenous cytosolic p53 (Fig. 3K). Taken together, these results indicate that SHMT2 stabilizes p53 by preventing its HDM2-mediated degradation in response to 5-FU treatment.
Inhibition of autophagy induced by low SHMT2 expression sensitizes CRC cells to 5-FU treatment
Given that cytosolic p53 triggers apoptosis and inhibits autophagy [44], we further analyzed the balance between apoptosis and autophagy in SHMT2-ov, SHMT2-sh, and SHMT2-KO cells after 5-FU treatment. In SHMT2-ov cells, the levels of cleaved caspase-3 and poly (ADP-ribose) polymerase (PARP) were increased and that of LC3-II was decreased, while the opposite pattern was observed in SHMT2-sh and SHMT2-KO cells, indicating that SHMT2 promotes apoptosis and inhibits autophagy in response to 5-FU treatment (Fig. 4A–B). Autophagy induction prevents tumor cells from undergoing apoptosis and subsequently leads to chemoresistance [10]. The autophagy inhibitors 3-methyladenine (3-MA) and CQ were then used to sensitize cells to 5-FU–based chemotherapy [9, 52]. Compared with control and SHMT2-ov cells, SHMT2-sh cells showed 5-FU resistance, which was counteracted by 3-MA and CQ (Fig. 4C).
Fig. 4
Inhibition of autophagy induced by low SHMT2 expression sensitizes CRC cells to 5-FU treatment.
A SHMT2 promoted apoptosis and inhibited autophagy in response to 5-FU treatment. Western blot analysis of lysates of HCT116 cells that were transfected with SHMT2 or infected with SHMT2-sh lentivirus and treated with 5-FU (10 μM) for 24 h. The protein levels of SHMT2, p62, LC3, cleaved Caspase 3, PARP, and β-actin (as the internal standard) were assessed with the indicated antibodies. B The protein levels of SHMT2, p62, LC3, cleaved Caspase 3, PARP, and β-actin (as the internal standard) were assessed in SHMT2-KO HCT116 cells. C The indicated cells were treated with 5-FU (2 μM), 3-MA (10 mM) or chloroquine diphosphate salt (CQ, 20 μM) for 4 days and analyzed using the MTT cell viability assay. *P < 0.05, **P < 0.01. D–F The xenograft experiment with Control and SHMT2-sh cells treated with 5-FU or CQ is described in the Methods section. D Xenograft tumors were harvested and photographed. E, F Quantification of the average volumes (E) and weights (F) of the xenograft tumors are shown. Five tumors from individual mice were included in each group; *P < 0.05, **P < 0.01.
Inhibition of autophagy induced by low SHMT2 expression sensitizes CRC cells to 5-FU treatment.
A SHMT2 promoted apoptosis and inhibited autophagy in response to 5-FU treatment. Western blot analysis of lysates of HCT116 cells that were transfected with SHMT2 or infected with SHMT2-sh lentivirus and treated with 5-FU (10 μM) for 24 h. The protein levels of SHMT2, p62, LC3, cleaved Caspase 3, PARP, and β-actin (as the internal standard) were assessed with the indicated antibodies. B The protein levels of SHMT2, p62, LC3, cleaved Caspase 3, PARP, and β-actin (as the internal standard) were assessed in SHMT2-KO HCT116 cells. C The indicated cells were treated with 5-FU (2 μM), 3-MA (10 mM) or chloroquine diphosphate salt (CQ, 20 μM) for 4 days and analyzed using the MTT cell viability assay. *P < 0.05, **P < 0.01. D–F The xenograft experiment with Control and SHMT2-sh cells treated with 5-FU or CQ is described in the Methods section. D Xenograft tumors were harvested and photographed. E, F Quantification of the average volumes (E) and weights (F) of the xenograft tumors are shown. Five tumors from individual mice were included in each group; *P < 0.05, **P < 0.01.Next, we investigated whether CQ increases sensitivity to 5-FU treatment in SHMT2-sh xenograft tumors. Control and SHMT2-sh HCT116 cells were injected subcutaneously into nude mice above the left and right hind legs, respectively. Tumor growth was markedly inhibited in SHMT2-sh–injected mice after CQ and 5-FU treatment compared with CQ treatment alone (Fig. 4D–F). 5-FU treatment and the combined treatment of CQ and 5-FU caused an ~15% reduction in the body mass of nude mice, while CQ treatment alone caused a 10% reduction in body mass, indicating that the combined therapy did not further potentiate this marker of host toxicity (Fig. S3). Collectively, our findings show that autophagy induced by low SHMT2 expression leads to 5-FU resistance and that inhibition of autophagy sensitizes SHMT2-low CRC cells to 5-FU treatment.
5-FU resistance is related to low SHMT2 expression and autophagy in human CRC
SHMT2 is a potential cancer driver gene and promotes colorectal carcinogenesis [23, 26]; moreover, it is related to 5-FU resistance in CRC cells and xenograft tumors. Thus, we further studied the role of SHMT2 in CRC therapy. q-PCR analysis of 50 paired CRC tissues and adjacent normal tissues showed that SHMT2 expression was significantly upregulated in CRC tissues compared with normal tissues (Fig. S4A). Moreover, we retrieved SHMT2 mRNA expression data from the GEO and TCGA databases and found that the expression level of SHMT2 was significantly higher in CRC tissues than in normal mucosa (Fig. S4B and Fig. 5A).
Fig. 5
5-FU resistance is related to low SHMT2 expression and autophagy in CRC.
A Expression of SHMT2 in three GEO datasets (GSE39582, GSE24551, and GSE21510). ***P < 0.001. B Representative images of immunohistochemical staining for SHMT2 in peritumor and CRC tissues. Scale bar, 50 μm. C 378 stage II–III paired CRC tissues assessed by immunohistochemistry are shown. **P < 0.01. D Survival of patients stratified by the SHMT2 expression level. DFS and OS of patients with stage II–III disease treated with 5-FU-based chemotherapy stratified by the SHMT2 expression level. E, F The protein levels of endogenous SHMT2, p62, LC3, and β-actin (as the internal standard) were examined by western blotting in CRC tissues. F The Spearman rank correlation test was used to evaluate correlations between the SHMT2, p62, and LC3 expression status in CRC tissues as determined by western blotting. G Representative images of immunohistochemical staining. Scale bar, 50 μm.
5-FU resistance is related to low SHMT2 expression and autophagy in CRC.
A Expression of SHMT2 in three GEO datasets (GSE39582, GSE24551, and GSE21510). ***P < 0.001. B Representative images of immunohistochemical staining for SHMT2 in peritumor and CRC tissues. Scale bar, 50 μm. C 378 stage II–III paired CRC tissues assessed by immunohistochemistry are shown. **P < 0.01. D Survival of patients stratified by the SHMT2 expression level. DFS and OS of patients with stage II–III disease treated with 5-FU-based chemotherapy stratified by the SHMT2 expression level. E, F The protein levels of endogenous SHMT2, p62, LC3, and β-actin (as the internal standard) were examined by western blotting in CRC tissues. F The Spearman rank correlation test was used to evaluate correlations between the SHMT2, p62, and LC3 expression status in CRC tissues as determined by western blotting. G Representative images of immunohistochemical staining. Scale bar, 50 μm.Next, we selected CRC patients with TNM stage II or III disease (n = 378) to explore the function of SHMT2 in response to 5-FU–based adjuvant chemotherapy (Table S1). Immunohistochemical (IHC) staining revealed higher expression of SHMT2 in human CRC specimens than in normal specimens (Fig. 5B–C). However, consistent with the complexity of colorectal tumorigenesis, 43.39% (n = 164) of the CRC tissues exhibited low SHMT2 expression (Table S1). To more thoroughly understand the contribution of SHMT2 to the prognosis of patients with CRC, especially its effect on the response to 5-FU–based adjuvant chemotherapy, we investigated the correlation of SHMT2 expression levels with disease-free survival (DFS) and overall survival (OS) in CRC patients. Surprisingly, patients with SHMT2-low CRC (SHMT2-low+chemo, n = 108; SHMT2-high+chemo, n = 140) treated with 5-FU–based adjuvant chemotherapy had worse DFS and OS than those with SHMT2-high CRC (Fig. 5D). Moreover, correlation analysis revealed significant correlations between the protein expression levels of SHMT2 and both LC3-II and p62, indicating that autophagy was induced in SHMT2-low CRC cells (Fig. 5E–F). Moreover, cytosolic p53 was almost undetectable in tissues with low SHMT2 expression (Fig. 5G). Given that 43.39% of the patients had SHMT2-low CRC, we need to explore the mechanism underlying 5-FU resistance. These results also imply that SHMT2 expression could be used as a therapeutic marker for clinical 5-FU resistance.Taken together, these results further demonstrate that SHMT2 upregulation not only promotes CRC progression but also plays a vital role in mediating 5-FU-based chemoresistance in CRC patients. Furthermore, multivariate Cox proportional hazards analysis suggests that SHMT2 is a new independent marker for the prognosis of CRC patients treated with 5-FU-based chemotherapy (Tables S2, S3).
CQ sensitizes patient-derived xenografts (PDXs) with low SHMT2 expression to 5-FU treatment
The above results showed that low SHMT2 induced 5-FU resistance through autophagy activation. To explore the function of autophagy inhibitors in 5-FU therapy, we established a xenograft mouse model in which four CRC patient-derived tissues (two with high expression of SHMT2 and two with low expression of SHMT2) were implanted subcutaneously (Fig. 6A–B). A similar result on autophagy levels was observed in xenograft tumors and the abovementioned experiments (Fig. 6A). As shown in Fig. 6C, tumor growth was markedly inhibited in mice bearing SHMT2-low xenografts that received combination therapy with CQ and 5-FU compared to their counterparts receiving 5-FU monotherapy (Fig. 6C–E). These results indicate that the combination of CQ and 5-FU markedly inhibited tumor growth in mice bearing SHMT2-low tumors. The expression of SHMT2 is negatively related to autophagy (Fig. 6F) and is not altered in tumors during drug treatment (Fig. S5). Collectively, these findings show that CQ, as an autophagy inhibitor, sensitizes xenografts with low SHMT2 expression to 5-FU treatment (Fig. 6G).
Fig. 6
CQ sensitizes PDXs with low SHMT2 expression to 5-FU treatment.
A Images of immunohistochemical staining for SHMT2, LC3, and p62 in CRC tissues from four selected patients (two with low SHMT2 expression and two with high SHMT2 expression) using the indicated antibodies. Scale bar, 50 μm. B Schematic of PDX model establishment. C–E Xenograft experiments with 5-FU or CQ treatment are described in the Methods section. C Xenograft tumors were harvested and photographed. D, E Quantification of the average volumes (D) and weights (E) of the xenograft tumors are shown. Four tumors from individual mice were included in each group; *P < 0.05, **P < 0.01. F Representative western blot of xenograft tumors. G Schematic diagram showing the basic hypothesis/conclusion/model.
CQ sensitizes PDXs with low SHMT2 expression to 5-FU treatment.
A Images of immunohistochemical staining for SHMT2, LC3, and p62 in CRC tissues from four selected patients (two with low SHMT2 expression and two with high SHMT2 expression) using the indicated antibodies. Scale bar, 50 μm. B Schematic of PDX model establishment. C–E Xenograft experiments with 5-FU or CQ treatment are described in the Methods section. C Xenograft tumors were harvested and photographed. D, E Quantification of the average volumes (D) and weights (E) of the xenograft tumors are shown. Four tumors from individual mice were included in each group; *P < 0.05, **P < 0.01. F Representative western blot of xenograft tumors. G Schematic diagram showing the basic hypothesis/conclusion/model.
Discussion
We screened 66 differentially expressed genes associated with CRC progression in 224 colon cancer tissues and 165 adjacent normal tissues from three GEO data sets and found that SHMT2 is important in CRC metabolism. SHMT2, responsible for the conversion of serine to glycine, supports cancer cell proliferation in various cancers [18, 21, 53]. SHMT2 is upregulated in CRC and plays a vital role in colorectal carcinogenesis [23, 27]. Consistent with the genetic diversity of tumors, 43.39% of CRC tumors were found to have low expression of SHMT2. However, patients with SHMT2-low CRC tumors exhibited 5-FU chemoresistance and poor prognosis. Further analysis revealed that low SHMT2 induced autophagy and subsequently triggered 5-FU resistance. Via MS, we identified cytosolic p53 as a SHMT2 binding protein and found that SHMT2 inhibited autophagy by stabilizing cytosolic p53. Depletion of SHMT2 promoted autophagy and inhibited apoptosis after 5-FU treatment. Inhibition of autophagy induced by low SHMT2 expression sensitized CRC cells to 5-FU treatment in vivo and in vitro. Finally, we enhanced the lethality of 5-FU to CRC cells through treatment with the autophagy inhibitor CQ in a PDX model. These findings are essential for understanding the response to 5-FU chemotherapy in patients with SHMT2-low CRC.Autophagy plays opposing and context-dependent roles in cancer, and the therapeutic targeting of autophagy in cancer is sometimes viewed as controversial [6]. In our study, we found that low expression of SHMT2 increased the resistance of CRC cells to 5-FU treatment through autophagy induction. The clinical data also verified this finding. In vivo and in vitro depletion of SHMT2 induced 5-FU resistance, while treatment with autophagy inhibitors decreased this resistance. Thus, our study supports the hypothesis that autophagy inhibitors are beneficial to the response to 5-FU–based chemotherapy in CRC.The factors inducing autophagy are complex (for example, starvation, treatment with rapamycin and exposure to toxins affecting the endoplasmic reticulum) [54, 55]. Inhibition of p53 led to autophagy, and cytosolic p53 repressed the enhancement of autophagy in p53–/– cells. Some inducers of autophagy stimulate proteasome-mediated degradation of p53 via the E3 ubiquitin ligase HDM2. However, the factors regulating the binding of HDM2 to p53 require exploration. Here, we found that SHMT2 competitively bound to cytosolic p53 to exclude HDM2 and thus inhibited autophagy. Treatment with 5-FU increased the binding of p53 to HDM2 to induce autophagy but decreased the binding of cytosolic p53 to SHMT2. In summary, we verified a new autophagy regulation mechanism involving the SHMT2–p53–HDM2 competitive binding system and confirmed the importance of this mechanism in mediating the response to CRC 5-FU–based chemotherapy. Indeed, it was unlikely that the p53 dependent role of SHMT2 in autophagy regulation and its sensitizing effect in 5-FU treatment was only limited to CRC. Further study is warranted to determine whether this mechanism holds true in other tumor types.SHMT2 is located not only in mitochondria but also in the cytoplasm, as shown by our data and data from other studies [28]. SHMT2 is a tetrameric metabolic enzyme involved in one-carbon metabolism and can also participate in the BRISC-SHMT complex to deubiquitinate IFNAR1 and regulate interferon responses [28]. Here, we found that SHMT2 regulated autophagy not by controlling one-carbon metabolism but by binding to cytosolic p53. These findings emphasize the functional multiformity of SHMT2 and improve the overall understanding of the function of SHMT2 in one-carbon metabolism and autophagy.
Conclusion
Given the complexity of tumorigenesis, mechanisms affecting chemotherapy require further exploration. Our study showed that low expression of SHMT2 is related to 5-FU resistance in CRC, implying that SHMT2 expression could be used as a therapeutic marker for clinical 5-FU resistance. Investigation of the molecular mechanism showed that SHMT2 competitively binds to cytosolic p53 to exclude the E3 ubiquitin ligase HDM2 and SHMT2 depletion decreases the stability of cytosolic p53 to induce autophagy, which maintains the survival of cancer cells treated with 5-FU. These findings reveal the SHMT2–p53 interaction as a novel oncotherapeutic target and provide a potential opportunity to reduce 5-FU resistance using autophagy inhibitors in chemotherapy.Supplemental FiguresSupplemental Table
Authors: Rebecca L Siegel; Kimberly D Miller; Ann Goding Sauer; Stacey A Fedewa; Lynn F Butterly; Joseph C Anderson; Andrea Cercek; Robert A Smith; Ahmedin Jemal Journal: CA Cancer J Clin Date: 2020-03-05 Impact factor: 508.702
Authors: Christine M Ribic; Daniel J Sargent; Malcolm J Moore; Stephen N Thibodeau; Amy J French; Richard M Goldberg; Stanley R Hamilton; Pierre Laurent-Puig; Robert Gryfe; Lois E Shepherd; Dongsheng Tu; Mark Redston; Steven Gallinger Journal: N Engl J Med Date: 2003-07-17 Impact factor: 91.245
Authors: R M Chowdhury; G Singh; A Joshi; D K Singh; S Bhatia; S Goswami Journal: J Stomatol Oral Maxillofac Surg Date: 2017-11-08 Impact factor: 1.569
Authors: X Sui; R Chen; Z Wang; Z Huang; N Kong; M Zhang; W Han; F Lou; J Yang; Q Zhang; X Wang; C He; H Pan Journal: Cell Death Dis Date: 2013-10-10 Impact factor: 8.469
Authors: Daniel J Klionsky; Kotb Abdelmohsen; Akihisa Abe; Md Joynal Abedin; Hagai Abeliovich; Abraham Acevedo Arozena; Hiroaki Adachi; Christopher M Adams; Peter D Adams; Khosrow Adeli; Peter J Adhihetty; Sharon G Adler; Galila Agam; Rajesh Agarwal; Manish K Aghi; Maria Agnello; Patrizia Agostinis; Patricia V Aguilar; Julio Aguirre-Ghiso; Edoardo M Airoldi; Slimane Ait-Si-Ali; Takahiko Akematsu; Emmanuel T Akporiaye; Mohamed Al-Rubeai; Guillermo M Albaiceta; Chris Albanese; Diego Albani; Matthew L Albert; Jesus Aldudo; Hana Algül; Mehrdad Alirezaei; Iraide Alloza; Alexandru Almasan; Maylin Almonte-Beceril; Emad S Alnemri; Covadonga Alonso; Nihal Altan-Bonnet; Dario C Altieri; Silvia Alvarez; Lydia Alvarez-Erviti; Sandro Alves; Giuseppina Amadoro; Atsuo Amano; Consuelo Amantini; Santiago Ambrosio; Ivano Amelio; Amal O Amer; Mohamed Amessou; Angelika Amon; Zhenyi An; Frank A Anania; Stig U Andersen; Usha P Andley; Catherine K Andreadi; Nathalie Andrieu-Abadie; Alberto Anel; David K Ann; Shailendra Anoopkumar-Dukie; Manuela Antonioli; Hiroshi Aoki; Nadezda Apostolova; Saveria Aquila; Katia Aquilano; Koichi Araki; Eli Arama; Agustin Aranda; Jun Araya; Alexandre Arcaro; Esperanza Arias; Hirokazu Arimoto; Aileen R Ariosa; Jane L Armstrong; Thierry Arnould; Ivica Arsov; Katsuhiko Asanuma; Valerie Askanas; Eric Asselin; Ryuichiro Atarashi; Sally S Atherton; Julie D Atkin; Laura D Attardi; Patrick Auberger; Georg Auburger; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Maria Laura Avantaggiati; Limor Avrahami; Suresh Awale; Neelam Azad; Tiziana Bachetti; Jonathan M Backer; Dong-Hun Bae; Jae-Sung Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Seung-Hoon Baek; Stephen Baghdiguian; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xue-Yuan Bai; Yannick Bailly; Kithiganahalli Narayanaswamy Balaji; Walter Balduini; Andrea Ballabio; Rena Balzan; Rajkumar Banerjee; Gábor Bánhegyi; Haijun Bao; Benoit Barbeau; Maria D Barrachina; Esther Barreiro; Bonnie Bartel; Alberto Bartolomé; Diane C Bassham; Maria Teresa Bassi; Robert C Bast; Alakananda Basu; Maria Teresa Batista; Henri Batoko; Maurizio Battino; Kyle Bauckman; Bradley L Baumgarner; K Ulrich Bayer; Rupert Beale; Jean-François Beaulieu; George R Beck; Christoph Becker; J David Beckham; Pierre-André Bédard; Patrick J Bednarski; Thomas J Begley; Christian Behl; Christian Behrends; Georg Mn Behrens; Kevin E Behrns; Eloy Bejarano; Amine Belaid; Francesca Belleudi; Giovanni Bénard; Guy Berchem; Daniele Bergamaschi; Matteo Bergami; Ben Berkhout; Laura Berliocchi; Amélie Bernard; Monique Bernard; Francesca Bernassola; Anne Bertolotti; Amanda S Bess; Sébastien Besteiro; Saverio Bettuzzi; Savita Bhalla; Shalmoli Bhattacharyya; Sujit K Bhutia; Caroline Biagosch; Michele Wolfe Bianchi; Martine Biard-Piechaczyk; Viktor Billes; Claudia Bincoletto; Baris Bingol; Sara W Bird; Marc Bitoun; Ivana Bjedov; Craig Blackstone; Lionel Blanc; Guillermo A Blanco; Heidi Kiil Blomhoff; Emilio Boada-Romero; Stefan Böckler; Marianne Boes; Kathleen Boesze-Battaglia; Lawrence H Boise; Alessandra Bolino; Andrea Boman; Paolo Bonaldo; Matteo Bordi; Jürgen Bosch; Luis M Botana; Joelle Botti; German Bou; Marina Bouché; Marion Bouchecareilh; Marie-Josée Boucher; Michael E Boulton; Sebastien G Bouret; Patricia Boya; Michaël Boyer-Guittaut; Peter V Bozhkov; Nathan Brady; Vania Mm Braga; Claudio Brancolini; Gerhard H Braus; José M Bravo-San Pedro; Lisa A Brennan; Emery H Bresnick; Patrick Brest; Dave Bridges; Marie-Agnès Bringer; Marisa Brini; Glauber C Brito; Bertha Brodin; Paul S Brookes; Eric J Brown; Karen Brown; Hal E Broxmeyer; Alain Bruhat; Patricia Chakur Brum; John H Brumell; Nicola Brunetti-Pierri; Robert J Bryson-Richardson; Shilpa Buch; Alastair M Buchan; Hikmet Budak; Dmitry V Bulavin; Scott J Bultman; Geert Bultynck; Vladimir Bumbasirevic; Yan Burelle; Robert E Burke; Margit Burmeister; Peter Bütikofer; Laura Caberlotto; Ken Cadwell; Monika Cahova; Dongsheng Cai; Jingjing Cai; Qian Cai; Sara Calatayud; Nadine Camougrand; Michelangelo Campanella; Grant R Campbell; Matthew Campbell; Silvia Campello; Robin Candau; Isabella Caniggia; Lavinia Cantoni; Lizhi Cao; Allan B Caplan; Michele Caraglia; Claudio Cardinali; Sandra Morais Cardoso; Jennifer S Carew; Laura A Carleton; Cathleen R Carlin; Silvia Carloni; Sven R Carlsson; Didac Carmona-Gutierrez; Leticia Am Carneiro; Oliana Carnevali; Serena Carra; Alice Carrier; Bernadette Carroll; Caty Casas; Josefina Casas; Giuliana Cassinelli; Perrine Castets; Susana Castro-Obregon; Gabriella Cavallini; Isabella Ceccherini; Francesco Cecconi; Arthur I Cederbaum; Valentín Ceña; Simone Cenci; Claudia Cerella; Davide Cervia; Silvia Cetrullo; Hassan Chaachouay; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Georgios Chamilos; Edmond Yw Chan; Matthew Tv Chan; Dhyan Chandra; Pallavi Chandra; Chih-Peng Chang; Raymond Chuen-Chung Chang; Ta Yuan Chang; John C Chatham; Saurabh Chatterjee; Santosh Chauhan; Yongsheng Che; Michael E Cheetham; Rajkumar Cheluvappa; Chun-Jung Chen; Gang Chen; Guang-Chao Chen; Guoqiang Chen; Hongzhuan Chen; Jeff W Chen; Jian-Kang Chen; Min Chen; Mingzhou Chen; Peiwen Chen; Qi Chen; Quan Chen; Shang-Der Chen; Si Chen; Steve S-L Chen; Wei Chen; Wei-Jung Chen; Wen Qiang Chen; Wenli Chen; Xiangmei Chen; Yau-Hung Chen; Ye-Guang Chen; Yin Chen; Yingyu Chen; Yongshun Chen; Yu-Jen Chen; Yue-Qin Chen; Yujie Chen; Zhen Chen; Zhong Chen; Alan Cheng; Christopher Hk Cheng; Hua Cheng; Heesun Cheong; Sara Cherry; Jason Chesney; Chun Hei Antonio Cheung; Eric Chevet; Hsiang Cheng Chi; Sung-Gil Chi; Fulvio Chiacchiera; Hui-Ling Chiang; Roberto Chiarelli; Mario Chiariello; Marcello Chieppa; Lih-Shen Chin; Mario Chiong; Gigi Nc Chiu; Dong-Hyung Cho; Ssang-Goo Cho; William C Cho; Yong-Yeon Cho; Young-Seok Cho; Augustine Mk Choi; Eui-Ju Choi; Eun-Kyoung Choi; Jayoung Choi; Mary E Choi; Seung-Il Choi; Tsui-Fen Chou; Salem Chouaib; Divaker Choubey; Vinay Choubey; Kuan-Chih Chow; Kamal Chowdhury; Charleen T Chu; Tsung-Hsien Chuang; Taehoon Chun; Hyewon Chung; Taijoon Chung; Yuen-Li Chung; Yong-Joon Chwae; Valentina Cianfanelli; Roberto Ciarcia; Iwona A Ciechomska; Maria Rosa Ciriolo; Mara Cirone; Sofie Claerhout; Michael J Clague; Joan Clària; Peter Gh Clarke; Robert Clarke; Emilio Clementi; Cédric Cleyrat; Miriam Cnop; Eliana M Coccia; Tiziana Cocco; Patrice Codogno; Jörn Coers; Ezra Ew Cohen; David Colecchia; Luisa Coletto; Núria S Coll; Emma Colucci-Guyon; Sergio Comincini; Maria Condello; Katherine L Cook; Graham H Coombs; Cynthia D Cooper; J Mark Cooper; Isabelle Coppens; Maria Tiziana Corasaniti; Marco Corazzari; Ramon Corbalan; Elisabeth Corcelle-Termeau; Mario D Cordero; Cristina Corral-Ramos; Olga Corti; Andrea Cossarizza; Paola Costelli; Safia Costes; Susan L Cotman; Ana Coto-Montes; Sandra Cottet; Eduardo Couve; Lori R Covey; L Ashley Cowart; Jeffery S Cox; Fraser P Coxon; Carolyn B Coyne; Mark S Cragg; Rolf J Craven; Tiziana Crepaldi; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Maria Teresa Cruz; Ana Maria Cuervo; Jose M Cuezva; Taixing Cui; Pedro R Cutillas; Mark J Czaja; Maria F Czyzyk-Krzeska; Ruben K Dagda; Uta Dahmen; Chunsun Dai; Wenjie Dai; Yun Dai; Kevin N Dalby; Luisa Dalla Valle; Guillaume Dalmasso; Marcello D'Amelio; Markus Damme; Arlette Darfeuille-Michaud; Catherine Dargemont; Victor M Darley-Usmar; Srinivasan Dasarathy; Biplab Dasgupta; Srikanta Dash; Crispin R Dass; Hazel Marie Davey; Lester M Davids; David Dávila; Roger J Davis; Ted M Dawson; Valina L Dawson; Paula Daza; Jackie de Belleroche; Paul de Figueiredo; Regina Celia Bressan Queiroz de Figueiredo; José de la Fuente; Luisa De Martino; Antonella De Matteis; Guido Ry De Meyer; Angelo De Milito; Mauro De Santi; Wanderley de Souza; Vincenzo De Tata; Daniela De Zio; Jayanta Debnath; Reinhard Dechant; Jean-Paul Decuypere; Shane Deegan; Benjamin Dehay; Barbara Del Bello; Dominic P Del Re; Régis Delage-Mourroux; Lea Md Delbridge; Louise Deldicque; Elizabeth Delorme-Axford; Yizhen Deng; Joern Dengjel; Melanie Denizot; Paul Dent; Channing J Der; Vojo Deretic; Benoît Derrien; Eric Deutsch; Timothy P Devarenne; Rodney J Devenish; Sabrina Di Bartolomeo; Nicola Di Daniele; Fabio Di Domenico; Alessia Di Nardo; Simone Di Paola; Antonio Di Pietro; Livia Di Renzo; Aaron DiAntonio; Guillermo Díaz-Araya; Ines Díaz-Laviada; Maria T Diaz-Meco; Javier Diaz-Nido; Chad A Dickey; Robert C Dickson; Marc Diederich; Paul Digard; Ivan Dikic; Savithrama P Dinesh-Kumar; Chan Ding; Wen-Xing Ding; Zufeng Ding; Luciana Dini; Jörg Hw Distler; Abhinav Diwan; Mojgan Djavaheri-Mergny; Kostyantyn Dmytruk; Renwick Cj Dobson; Volker Doetsch; Karol Dokladny; Svetlana Dokudovskaya; Massimo Donadelli; X Charlie Dong; Xiaonan Dong; Zheng Dong; Terrence M Donohue; Kelly S Doran; Gabriella D'Orazi; Gerald W Dorn; Victor Dosenko; Sami Dridi; Liat Drucker; Jie Du; Li-Lin Du; Lihuan Du; André du Toit; Priyamvada Dua; Lei Duan; Pu Duann; Vikash Kumar Dubey; Michael R Duchen; Michel A Duchosal; Helene Duez; Isabelle Dugail; Verónica I Dumit; Mara C Duncan; Elaine A Dunlop; William A Dunn; Nicolas Dupont; Luc Dupuis; Raúl V Durán; Thomas M Durcan; Stéphane Duvezin-Caubet; Umamaheswar Duvvuri; Vinay Eapen; Darius Ebrahimi-Fakhari; Arnaud Echard; Leopold Eckhart; Charles L Edelstein; Aimee L Edinger; Ludwig Eichinger; Tobias Eisenberg; Avital Eisenberg-Lerner; N Tony Eissa; Wafik S El-Deiry; Victoria El-Khoury; Zvulun Elazar; Hagit Eldar-Finkelman; Chris Jh Elliott; Enzo Emanuele; Urban Emmenegger; Nikolai Engedal; Anna-Mart Engelbrecht; Simone Engelender; Jorrit M Enserink; Ralf Erdmann; Jekaterina Erenpreisa; Rajaraman Eri; Jason L Eriksen; Andreja Erman; Ricardo Escalante; Eeva-Liisa Eskelinen; Lucile Espert; Lorena Esteban-Martínez; Thomas J Evans; Mario Fabri; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Nils J Færgeman; Alberto Faggioni; W Douglas Fairlie; Chunhai Fan; Daping Fan; Jie Fan; Shengyun Fang; Manolis Fanto; Alessandro Fanzani; Thomas Farkas; Mathias Faure; Francois B Favier; Howard Fearnhead; Massimo Federici; Erkang Fei; Tania C Felizardo; Hua Feng; Yibin Feng; Yuchen Feng; Thomas A Ferguson; Álvaro F Fernández; Maite G Fernandez-Barrena; Jose C Fernandez-Checa; Arsenio Fernández-López; Martin E Fernandez-Zapico; Olivier Feron; Elisabetta Ferraro; Carmen Veríssima Ferreira-Halder; Laszlo Fesus; Ralph Feuer; Fabienne C Fiesel; Eduardo C Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; John H Fingert; Steven Finkbeiner; Toren Finkel; Filomena Fiorito; Paul B Fisher; Marc Flajolet; Flavio Flamigni; Oliver Florey; Salvatore Florio; R Andres Floto; Marco Folini; Carlo Follo; Edward A Fon; Francesco Fornai; Franco Fortunato; Alessandro Fraldi; Rodrigo Franco; Arnaud Francois; Aurélie François; Lisa B Frankel; Iain Dc Fraser; Norbert Frey; Damien G Freyssenet; Christian Frezza; Scott L Friedman; Daniel E Frigo; Dongxu Fu; José M Fuentes; Juan Fueyo; Yoshio Fujitani; Yuuki Fujiwara; Mikihiro Fujiya; Mitsunori Fukuda; Simone Fulda; Carmela Fusco; Bozena Gabryel; Matthias Gaestel; Philippe Gailly; Malgorzata Gajewska; Sehamuddin Galadari; Gad Galili; Inmaculada Galindo; Maria F Galindo; Giovanna Galliciotti; Lorenzo Galluzzi; Luca Galluzzi; Vincent Galy; Noor Gammoh; Sam Gandy; Anand K Ganesan; Swamynathan Ganesan; Ian G Ganley; Monique Gannagé; Fen-Biao Gao; Feng Gao; Jian-Xin Gao; Lorena García Nannig; Eleonora García Véscovi; Marina Garcia-Macía; Carmen Garcia-Ruiz; Abhishek D Garg; Pramod Kumar Garg; Ricardo Gargini; Nils Christian Gassen; Damián Gatica; Evelina Gatti; Julie Gavard; Evripidis Gavathiotis; Liang Ge; Pengfei Ge; Shengfang Ge; Po-Wu Gean; Vania Gelmetti; Armando A Genazzani; Jiefei Geng; Pascal Genschik; Lisa Gerner; Jason E Gestwicki; David A Gewirtz; Saeid Ghavami; Eric Ghigo; Debabrata Ghosh; Anna Maria Giammarioli; Francesca Giampieri; Claudia Giampietri; Alexandra Giatromanolaki; Derrick J Gibbings; Lara Gibellini; Spencer B Gibson; Vanessa Ginet; Antonio Giordano; Flaviano Giorgini; Elisa Giovannetti; Stephen E Girardin; Suzana Gispert; Sandy Giuliano; Candece L Gladson; Alvaro Glavic; Martin Gleave; Nelly Godefroy; Robert M Gogal; Kuppan Gokulan; Gustavo H Goldman; Delia Goletti; Michael S Goligorsky; Aldrin V Gomes; Ligia C Gomes; Hernando Gomez; Candelaria Gomez-Manzano; Rubén Gómez-Sánchez; Dawit Ap Gonçalves; Ebru Goncu; Qingqiu Gong; Céline Gongora; Carlos B Gonzalez; Pedro Gonzalez-Alegre; Pilar Gonzalez-Cabo; Rosa Ana González-Polo; Ing Swie Goping; Carlos Gorbea; Nikolai V Gorbunov; Daphne R Goring; Adrienne M Gorman; Sharon M Gorski; Sandro Goruppi; Shino Goto-Yamada; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Yacine Graba; Martin Graef; Giovanna E Granato; Gary Dean Grant; Steven Grant; Giovanni Luca Gravina; Douglas R Green; Alexander Greenhough; Michael T Greenwood; Benedetto Grimaldi; Frédéric Gros; Charles Grose; Jean-Francois Groulx; Florian Gruber; Paolo Grumati; Tilman Grune; Jun-Lin Guan; Kun-Liang Guan; Barbara Guerra; Carlos Guillen; Kailash Gulshan; Jan Gunst; Chuanyong Guo; Lei Guo; Ming Guo; Wenjie Guo; Xu-Guang Guo; Andrea A Gust; Åsa B Gustafsson; Elaine Gutierrez; Maximiliano G Gutierrez; Ho-Shin Gwak; Albert Haas; James E Haber; Shinji Hadano; Monica Hagedorn; David R Hahn; Andrew J Halayko; Anne Hamacher-Brady; Kozo Hamada; Ahmed Hamai; Andrea Hamann; Maho Hamasaki; Isabelle Hamer; Qutayba Hamid; Ester M Hammond; Feng Han; Weidong Han; James T Handa; John A Hanover; Malene Hansen; Masaru Harada; Ljubica Harhaji-Trajkovic; J Wade Harper; Abdel Halim Harrath; Adrian L Harris; James Harris; Udo Hasler; Peter Hasselblatt; Kazuhisa Hasui; Robert G Hawley; Teresa S Hawley; Congcong He; Cynthia Y He; Fengtian He; Gu He; Rong-Rong He; Xian-Hui He; You-Wen He; Yu-Ying He; Joan K Heath; Marie-Josée Hébert; Robert A Heinzen; Gudmundur Vignir Helgason; Michael Hensel; Elizabeth P Henske; Chengtao Her; Paul K Herman; Agustín Hernández; Carlos Hernandez; Sonia Hernández-Tiedra; Claudio Hetz; P Robin Hiesinger; Katsumi Higaki; Sabine Hilfiker; Bradford G Hill; Joseph A Hill; William D Hill; Keisuke Hino; Daniel Hofius; Paul Hofman; Günter U Höglinger; Jörg Höhfeld; Marina K Holz; Yonggeun Hong; David A Hood; Jeroen Jm Hoozemans; Thorsten Hoppe; Chin Hsu; Chin-Yuan Hsu; Li-Chung Hsu; Dong Hu; Guochang Hu; Hong-Ming Hu; Hongbo Hu; Ming Chang Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Ya Hua; Canhua Huang; Huey-Lan Huang; Kuo-How Huang; Kuo-Yang Huang; Shile Huang; Shiqian Huang; Wei-Pang Huang; Yi-Ran Huang; Yong Huang; Yunfei Huang; Tobias B Huber; Patricia Huebbe; Won-Ki Huh; Juha J Hulmi; Gang Min Hur; James H Hurley; Zvenyslava Husak; Sabah Na Hussain; Salik Hussain; Jung Jin Hwang; Seungmin Hwang; Thomas Is Hwang; Atsuhiro Ichihara; Yuzuru Imai; Carol Imbriano; Megumi Inomata; Takeshi Into; Valentina Iovane; Juan L Iovanna; Renato V Iozzo; Nancy Y Ip; Javier E Irazoqui; Pablo Iribarren; Yoshitaka Isaka; Aleksandra J Isakovic; Harry Ischiropoulos; Jeffrey S Isenberg; Mohammad Ishaq; Hiroyuki Ishida; Isao Ishii; Jane E Ishmael; Ciro Isidoro; Ken-Ichi Isobe; Erika Isono; Shohreh Issazadeh-Navikas; Koji Itahana; Eisuke Itakura; Andrei I Ivanov; Anand Krishnan V Iyer; José M Izquierdo; Yotaro Izumi; Valentina Izzo; Marja Jäättelä; Nadia Jaber; Daniel John Jackson; William T Jackson; Tony George Jacob; Thomas S Jacques; Chinnaswamy Jagannath; Ashish Jain; Nihar Ranjan Jana; Byoung Kuk Jang; Alkesh Jani; Bassam Janji; Paulo Roberto Jannig; Patric J Jansson; Steve Jean; Marina Jendrach; Ju-Hong Jeon; Niels Jessen; Eui-Bae Jeung; Kailiang Jia; Lijun Jia; Hong Jiang; Hongchi Jiang; Liwen Jiang; Teng Jiang; Xiaoyan Jiang; Xuejun Jiang; Xuejun Jiang; Ying Jiang; Yongjun Jiang; Alberto Jiménez; Cheng Jin; Hongchuan Jin; Lei Jin; Meiyan Jin; Shengkan Jin; Umesh Kumar Jinwal; Eun-Kyeong Jo; Terje Johansen; Daniel E Johnson; Gail Vw Johnson; James D Johnson; Eric Jonasch; Chris Jones; Leo Ab Joosten; Joaquin Jordan; Anna-Maria Joseph; Bertrand Joseph; Annie M Joubert; Dianwen Ju; Jingfang Ju; Hsueh-Fen Juan; Katrin Juenemann; Gábor Juhász; Hye Seung Jung; Jae U Jung; Yong-Keun Jung; Heinz Jungbluth; Matthew J Justice; Barry Jutten; Nadeem O Kaakoush; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Bertrand Kaeffer; Katarina Kågedal; Alon Kahana; Shingo Kajimura; Or Kakhlon; Manjula Kalia; Dhan V Kalvakolanu; Yoshiaki Kamada; Konstantinos Kambas; Vitaliy O Kaminskyy; Harm H Kampinga; Mustapha Kandouz; Chanhee Kang; Rui Kang; Tae-Cheon Kang; Tomotake Kanki; Thirumala-Devi Kanneganti; Haruo Kanno; Anumantha G Kanthasamy; Marc Kantorow; Maria Kaparakis-Liaskos; Orsolya Kapuy; Vassiliki Karantza; Md Razaul Karim; Parimal Karmakar; Arthur Kaser; Susmita Kaushik; Thomas Kawula; A Murat Kaynar; Po-Yuan Ke; Zun-Ji Ke; John H Kehrl; Kate E Keller; Jongsook Kim Kemper; Anne K Kenworthy; Oliver Kepp; Andreas Kern; Santosh Kesari; David Kessel; Robin Ketteler; Isis do Carmo Kettelhut; Bilon Khambu; Muzamil Majid Khan; Vinoth Km Khandelwal; Sangeeta Khare; Juliann G Kiang; Amy A Kiger; Akio Kihara; Arianna L Kim; Cheol Hyeon Kim; Deok Ryong Kim; Do-Hyung Kim; Eung Kweon Kim; Hye Young Kim; Hyung-Ryong Kim; Jae-Sung Kim; Jeong Hun Kim; Jin Cheon Kim; Jin Hyoung Kim; Kwang Woon Kim; Michael D Kim; Moon-Moo Kim; Peter K Kim; Seong Who Kim; Soo-Youl Kim; Yong-Sun Kim; Yonghyun Kim; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Jason S King; Karla Kirkegaard; Vladimir Kirkin; Lorrie A Kirshenbaum; Shuji Kishi; Yasuo Kitajima; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Rudolf A Kley; Walter T Klimecki; Michael Klinkenberg; Jochen Klucken; Helene Knævelsrud; Erwin Knecht; Laura Knuppertz; Jiunn-Liang Ko; Satoru Kobayashi; Jan C Koch; Christelle Koechlin-Ramonatxo; Ulrich Koenig; Young Ho Koh; Katja Köhler; Sepp D Kohlwein; Masato Koike; Masaaki Komatsu; Eiki Kominami; Dexin Kong; Hee Jeong Kong; Eumorphia G Konstantakou; Benjamin T Kopp; Tamas Korcsmaros; Laura Korhonen; Viktor I Korolchuk; Nadya V Koshkina; Yanjun Kou; Michael I Koukourakis; Constantinos Koumenis; Attila L Kovács; Tibor Kovács; Werner J Kovacs; Daisuke Koya; Claudine Kraft; Dimitri Krainc; Helmut Kramer; Tamara Kravic-Stevovic; Wilhelm Krek; Carole Kretz-Remy; Roswitha Krick; Malathi Krishnamurthy; Janos Kriston-Vizi; Guido Kroemer; Michael C Kruer; Rejko Kruger; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Christian Kuhn; Addanki Pratap Kumar; Anuj Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Rakesh Kumar; Sharad Kumar; Mondira Kundu; Hsing-Jien Kung; Atsushi Kuno; Sheng-Han Kuo; Jeff Kuret; Tino Kurz; Terry Kwok; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert R La Spada; Frank Lafont; Tim Lahm; Aparna Lakkaraju; Truong Lam; Trond Lamark; Steve Lancel; Terry H Landowski; Darius J R Lane; Jon D Lane; Cinzia Lanzi; Pierre Lapaquette; Louis R Lapierre; Jocelyn Laporte; Johanna Laukkarinen; Gordon W Laurie; Sergio Lavandero; Lena Lavie; Matthew J LaVoie; Betty Yuen Kwan Law; Helen Ka-Wai Law; Kelsey B Law; Robert Layfield; Pedro A Lazo; Laurent Le Cam; Karine G Le Roch; Hervé Le Stunff; Vijittra Leardkamolkarn; Marc Lecuit; Byung-Hoon Lee; Che-Hsin Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Hsinyu Lee; Jae Keun Lee; Jongdae Lee; Ju-Hyun Lee; Jun Hee Lee; Michael Lee; Myung-Shik Lee; Patty J Lee; Sam W Lee; Seung-Jae Lee; Shiow-Ju Lee; Stella Y Lee; Sug Hyung Lee; Sung Sik Lee; Sung-Joon Lee; Sunhee Lee; Ying-Ray Lee; Yong J Lee; Young H Lee; Christiaan Leeuwenburgh; Sylvain Lefort; Renaud Legouis; Jinzhi Lei; Qun-Ying Lei; David A Leib; Gil Leibowitz; Istvan Lekli; Stéphane D Lemaire; John J Lemasters; Marius K Lemberg; Antoinette Lemoine; Shuilong Leng; Guido Lenz; Paola Lenzi; Lilach O Lerman; Daniele Lettieri Barbato; Julia I-Ju Leu; Hing Y Leung; Beth Levine; Patrick A Lewis; Frank Lezoualc'h; Chi Li; Faqiang Li; Feng-Jun Li; Jun Li; Ke Li; Lian Li; Min Li; Min Li; Qiang Li; Rui Li; Sheng Li; Wei Li; Wei Li; Xiaotao Li; Yumin Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Yulin Liao; Joana Liberal; Pawel P Liberski; Pearl Lie; Andrew P Lieberman; Hyunjung Jade Lim; Kah-Leong Lim; Kyu Lim; Raquel T Lima; Chang-Shen Lin; Chiou-Feng Lin; Fang Lin; Fangming Lin; Fu-Cheng Lin; Kui Lin; Kwang-Huei Lin; Pei-Hui Lin; Tianwei Lin; Wan-Wan Lin; Yee-Shin Lin; Yong Lin; Rafael Linden; Dan Lindholm; Lisa M Lindqvist; Paul Lingor; Andreas Linkermann; Lance A Liotta; Marta M Lipinski; Vitor A Lira; Michael P Lisanti; Paloma B Liton; Bo Liu; Chong Liu; Chun-Feng Liu; Fei Liu; Hung-Jen Liu; Jianxun Liu; Jing-Jing Liu; Jing-Lan Liu; Ke Liu; Leyuan Liu; Liang Liu; Quentin Liu; Rong-Yu Liu; Shiming Liu; Shuwen Liu; Wei Liu; Xian-De Liu; Xiangguo Liu; Xiao-Hong Liu; Xinfeng Liu; Xu Liu; Xueqin Liu; Yang Liu; Yule Liu; Zexian Liu; Zhe Liu; Juan P Liuzzi; Gérard Lizard; Mila Ljujic; Irfan J Lodhi; Susan E Logue; Bal L Lokeshwar; Yun Chau Long; Sagar Lonial; Benjamin Loos; Carlos López-Otín; Cristina López-Vicario; Mar Lorente; Philip L Lorenzi; Péter Lõrincz; Marek Los; Michael T Lotze; Penny E Lovat; Binfeng Lu; Bo Lu; Jiahong Lu; Qing Lu; She-Min Lu; Shuyan Lu; Yingying Lu; Frédéric Luciano; Shirley Luckhart; John Milton Lucocq; Paula Ludovico; Aurelia Lugea; Nicholas W Lukacs; Julian J Lum; Anders H Lund; Honglin Luo; Jia Luo; Shouqing Luo; Claudio Luparello; Timothy Lyons; Jianjie Ma; Yi Ma; Yong Ma; Zhenyi Ma; Juliano Machado; Glaucia M Machado-Santelli; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; John D MacMicking; Lee Ann MacMillan-Crow; Frank Madeo; Muniswamy Madesh; Julio Madrigal-Matute; Akiko Maeda; Tatsuya Maeda; Gustavo Maegawa; Emilia Maellaro; Hannelore Maes; Marta Magariños; Kenneth Maiese; Tapas K Maiti; Luigi Maiuri; Maria Chiara Maiuri; Carl G Maki; Roland Malli; Walter Malorni; Alina Maloyan; Fathia Mami-Chouaib; Na Man; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Serge N Manié; Claudia Manzoni; Kai Mao; Zixu Mao; Zong-Wan Mao; Philippe Marambaud; Anna Maria Marconi; Zvonimir Marelja; Gabriella Marfe; Marta Margeta; Eva Margittai; Muriel Mari; Francesca V Mariani; Concepcio Marin; Sara Marinelli; Guillermo Mariño; Ivanka Markovic; Rebecca Marquez; Alberto M Martelli; Sascha Martens; Katie R Martin; Seamus J Martin; Shaun Martin; Miguel A Martin-Acebes; Paloma Martín-Sanz; Camille Martinand-Mari; Wim Martinet; Jennifer Martinez; Nuria Martinez-Lopez; Ubaldo Martinez-Outschoorn; Moisés Martínez-Velázquez; Marta Martinez-Vicente; Waleska Kerllen Martins; Hirosato Mashima; James A Mastrianni; Giuseppe Matarese; Paola Matarrese; Roberto Mateo; Satoaki Matoba; Naomichi Matsumoto; Takehiko Matsushita; Akira Matsuura; Takeshi Matsuzawa; Mark P Mattson; Soledad Matus; Norma Maugeri; Caroline Mauvezin; Andreas Mayer; Dusica Maysinger; Guillermo D Mazzolini; Mary Kate McBrayer; Kimberly McCall; Craig McCormick; Gerald M McInerney; Skye C McIver; Sharon McKenna; John J McMahon; Iain A McNeish; Fatima Mechta-Grigoriou; Jan Paul Medema; Diego L Medina; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Yide Mei; Ute-Christiane Meier; Alfred J Meijer; Alicia Meléndez; Gerry Melino; Sonia Melino; Edesio Jose Tenorio de Melo; Maria A Mena; Marc D Meneghini; Javier A Menendez; Regina Menezes; Liesu Meng; Ling-Hua Meng; Songshu Meng; Rossella Menghini; A Sue Menko; Rubem Fs Menna-Barreto; Manoj B Menon; Marco A Meraz-Ríos; Giuseppe Merla; Luciano Merlini; Angelica M Merlot; Andreas Meryk; Stefania Meschini; Joel N Meyer; Man-Tian Mi; Chao-Yu Miao; Lucia Micale; Simon Michaeli; Carine Michiels; Anna Rita Migliaccio; Anastasia Susie Mihailidou; Dalibor Mijaljica; Katsuhiko Mikoshiba; Enrico Milan; Leonor Miller-Fleming; Gordon B Mills; Ian G Mills; Georgia Minakaki; Berge A Minassian; Xiu-Fen Ming; Farida Minibayeva; Elena A Minina; Justine D Mintern; Saverio Minucci; Antonio Miranda-Vizuete; Claire H Mitchell; Shigeki Miyamoto; Keisuke Miyazawa; Noboru Mizushima; Katarzyna Mnich; Baharia Mograbi; Simin Mohseni; Luis Ferreira Moita; Marco Molinari; Maurizio Molinari; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Marco Mongillo; Martha M Monick; Serena Montagnaro; Craig Montell; Darren J Moore; Michael N Moore; Rodrigo Mora-Rodriguez; Paula I Moreira; Etienne Morel; Maria Beatrice Morelli; Sandra Moreno; Michael J Morgan; Arnaud Moris; Yuji Moriyasu; Janna L Morrison; Lynda A Morrison; Eugenia Morselli; Jorge Moscat; Pope L Moseley; Serge Mostowy; Elisa Motori; Denis Mottet; Jeremy C Mottram; Charbel E-H Moussa; Vassiliki E Mpakou; Hasan Mukhtar; Jean M Mulcahy Levy; Sylviane Muller; Raquel Muñoz-Moreno; Cristina Muñoz-Pinedo; Christian Münz; Maureen E Murphy; James T Murray; Aditya Murthy; Indira U Mysorekar; Ivan R Nabi; Massimo Nabissi; Gustavo A Nader; Yukitoshi Nagahara; Yoshitaka Nagai; Kazuhiro Nagata; Anika Nagelkerke; Péter Nagy; Samisubbu R Naidu; Sreejayan Nair; Hiroyasu Nakano; Hitoshi Nakatogawa; Meera Nanjundan; Gennaro Napolitano; Naweed I Naqvi; Roberta Nardacci; Derek P Narendra; Masashi Narita; Anna Chiara Nascimbeni; Ramesh Natarajan; Luiz C Navegantes; Steffan T Nawrocki; Taras Y Nazarko; Volodymyr Y Nazarko; Thomas Neill; Luca M Neri; Mihai G Netea; Romana T Netea-Maier; Bruno M Neves; Paul A Ney; Ioannis P Nezis; Hang Tt Nguyen; Huu Phuc Nguyen; Anne-Sophie Nicot; Hilde Nilsen; Per Nilsson; Mikio Nishimura; Ichizo Nishino; Mireia Niso-Santano; Hua Niu; Ralph A Nixon; Vincent Co Njar; Takeshi Noda; Angelika A Noegel; Elsie Magdalena Nolte; Erik Norberg; Koenraad K Norga; Sakineh Kazemi Noureini; Shoji Notomi; Lucia Notterpek; Karin Nowikovsky; Nobuyuki Nukina; Thorsten Nürnberger; Valerie B O'Donnell; Tracey O'Donovan; Peter J O'Dwyer; Ina Oehme; Clara L Oeste; Michinaga Ogawa; Besim Ogretmen; Yuji Ogura; Young J Oh; Masaki Ohmuraya; Takayuki Ohshima; Rani Ojha; Koji Okamoto; Toshiro Okazaki; F Javier Oliver; Karin Ollinger; Stefan Olsson; Daniel P Orban; Paulina Ordonez; Idil Orhon; Laszlo Orosz; Eyleen J O'Rourke; Helena Orozco; Angel L Ortega; Elena Ortona; Laura D Osellame; Junko Oshima; Shigeru Oshima; Heinz D Osiewacz; Takanobu Otomo; Kinya Otsu; Jing-Hsiung James Ou; Tiago F Outeiro; Dong-Yun Ouyang; Hongjiao Ouyang; Michael Overholtzer; Michelle A Ozbun; P Hande Ozdinler; Bulent Ozpolat; Consiglia Pacelli; Paolo Paganetti; Guylène Page; Gilles Pages; Ugo Pagnini; Beata Pajak; Stephen C Pak; Karolina Pakos-Zebrucka; Nazzy Pakpour; Zdena Palková; Francesca Palladino; Kathrin Pallauf; Nicolas Pallet; Marta Palmieri; Søren R Paludan; Camilla Palumbo; Silvia Palumbo; Olatz Pampliega; Hongming Pan; Wei Pan; Theocharis Panaretakis; Aseem Pandey; Areti Pantazopoulou; Zuzana Papackova; Daniela L Papademetrio; Issidora Papassideri; Alessio Papini; Nirmala Parajuli; Julian Pardo; Vrajesh V Parekh; Giancarlo Parenti; Jong-In Park; Junsoo Park; Ohkmae K Park; Roy Parker; Rosanna Parlato; Jan B Parys; Katherine R Parzych; Jean-Max Pasquet; Benoit Pasquier; Kishore Bs Pasumarthi; Daniel Patschan; Cam Patterson; Sophie Pattingre; Scott Pattison; Arnim Pause; Hermann Pavenstädt; Flaminia Pavone; Zully Pedrozo; Fernando J Peña; Miguel A Peñalva; Mario Pende; Jianxin Peng; Fabio Penna; Josef M Penninger; Anna Pensalfini; Salvatore Pepe; Gustavo Js Pereira; Paulo C Pereira; Verónica Pérez-de la Cruz; María Esther Pérez-Pérez; Diego Pérez-Rodríguez; Dolores Pérez-Sala; Celine Perier; Andras Perl; David H Perlmutter; Ida Perrotta; Shazib Pervaiz; Maija Pesonen; Jeffrey E Pessin; Godefridus J Peters; Morten Petersen; Irina Petrache; Basil J Petrof; Goran Petrovski; James M Phang; Mauro Piacentini; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Federico Pietrocola; Felipe X Pimentel-Muiños; Mario Pinar; Benjamin Pineda; Ronit Pinkas-Kramarski; Marcello Pinti; Paolo Pinton; Bilal Piperdi; James M Piret; Leonidas C Platanias; Harald W Platta; Edward D Plowey; Stefanie Pöggeler; Marc Poirot; Peter Polčic; Angelo Poletti; Audrey H Poon; Hana Popelka; Blagovesta Popova; Izabela Poprawa; Shibu M Poulose; Joanna Poulton; Scott K Powers; Ted Powers; Mercedes Pozuelo-Rubio; Krisna Prak; Reinhild Prange; Mark Prescott; Muriel Priault; Sharon Prince; Richard L Proia; Tassula Proikas-Cezanne; Holger Prokisch; Vasilis J Promponas; Karin Przyklenk; Rosa Puertollano; Subbiah Pugazhenthi; Luigi Puglielli; Aurora Pujol; Julien Puyal; Dohun Pyeon; Xin Qi; Wen-Bin Qian; Zheng-Hong Qin; Yu Qiu; Ziwei Qu; Joe Quadrilatero; Frederick Quinn; Nina Raben; Hannah Rabinowich; Flavia Radogna; Michael J Ragusa; Mohamed Rahmani; Komal Raina; Sasanka Ramanadham; Rajagopal Ramesh; Abdelhaq Rami; Sarron Randall-Demllo; Felix Randow; Hai Rao; V Ashutosh Rao; Blake B Rasmussen; Tobias M Rasse; Edward A Ratovitski; Pierre-Emmanuel Rautou; Swapan K Ray; Babak Razani; Bruce H Reed; Fulvio Reggiori; Markus Rehm; Andreas S Reichert; Theo Rein; David J Reiner; Eric Reits; Jun Ren; Xingcong Ren; Maurizio Renna; Jane Eb Reusch; Jose L Revuelta; Leticia Reyes; Alireza R Rezaie; Robert I Richards; Des R Richardson; Clémence Richetta; Michael A Riehle; Bertrand H Rihn; Yasuko Rikihisa; Brigit E Riley; Gerald Rimbach; Maria Rita Rippo; Konstantinos Ritis; Federica Rizzi; Elizete Rizzo; Peter J Roach; Jeffrey Robbins; Michel Roberge; Gabriela Roca; Maria Carmela Roccheri; Sonia Rocha; Cecilia Mp Rodrigues; Clara I Rodríguez; Santiago Rodriguez de Cordoba; Natalia Rodriguez-Muela; Jeroen Roelofs; Vladimir V Rogov; Troy T Rohn; Bärbel Rohrer; Davide Romanelli; Luigina Romani; Patricia Silvia Romano; M Isabel G Roncero; Jose Luis Rosa; Alicia Rosello; Kirill V Rosen; Philip Rosenstiel; Magdalena Rost-Roszkowska; Kevin A Roth; Gael Roué; Mustapha Rouis; Kasper M Rouschop; Daniel T Ruan; Diego Ruano; David C Rubinsztein; Edmund B Rucker; Assaf Rudich; Emil Rudolf; Ruediger Rudolf; Markus A Ruegg; Carmen Ruiz-Roldan; Avnika Ashok Ruparelia; Paola Rusmini; David W Russ; Gian Luigi Russo; Giuseppe Russo; Rossella Russo; Tor Erik Rusten; Victoria Ryabovol; Kevin M Ryan; Stefan W Ryter; David M Sabatini; Michael Sacher; Carsten Sachse; Michael N Sack; Junichi Sadoshima; Paul Saftig; Ronit Sagi-Eisenberg; Sumit Sahni; Pothana Saikumar; Tsunenori Saito; Tatsuya Saitoh; Koichi Sakakura; Machiko Sakoh-Nakatogawa; Yasuhito Sakuraba; María Salazar-Roa; Paolo Salomoni; Ashok K Saluja; Paul M Salvaterra; Rosa Salvioli; Afshin Samali; Anthony Mj Sanchez; José A Sánchez-Alcázar; Ricardo Sanchez-Prieto; Marco Sandri; Miguel A Sanjuan; Stefano Santaguida; Laura Santambrogio; Giorgio Santoni; Claudia Nunes Dos Santos; Shweta Saran; Marco Sardiello; Graeme Sargent; Pallabi Sarkar; Sovan Sarkar; Maria Rosa Sarrias; Minnie M Sarwal; Chihiro Sasakawa; Motoko Sasaki; Miklos Sass; Ken Sato; Miyuki Sato; Joseph Satriano; Niramol Savaraj; Svetlana Saveljeva; Liliana Schaefer; Ulrich E Schaible; Michael Scharl; Hermann M Schatzl; Randy Schekman; Wiep Scheper; Alfonso Schiavi; Hyman M Schipper; Hana Schmeisser; Jens Schmidt; Ingo Schmitz; Bianca E Schneider; E Marion Schneider; Jaime L Schneider; Eric A Schon; Miriam J Schönenberger; Axel H Schönthal; Daniel F Schorderet; Bernd Schröder; Sebastian Schuck; Ryan J Schulze; Melanie Schwarten; Thomas L Schwarz; Sebastiano Sciarretta; Kathleen Scotto; A Ivana Scovassi; Robert A Screaton; Mark Screen; Hugo Seca; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Jose M Seguí-Simarro; Juan Segura-Aguilar; Ekihiro Seki; Christian Sell; Iban Seiliez; Clay F Semenkovich; Gregg L Semenza; Utpal Sen; Andreas L Serra; Ana Serrano-Puebla; Hiromi Sesaki; Takao Setoguchi; Carmine Settembre; John J Shacka; Ayesha N Shajahan-Haq; Irving M Shapiro; Shweta Sharma; Hua She; C-K James Shen; Chiung-Chyi Shen; Han-Ming Shen; Sanbing Shen; Weili Shen; Rui Sheng; Xianyong Sheng; Zu-Hang Sheng; Trevor G Shepherd; Junyan Shi; Qiang Shi; Qinghua Shi; Yuguang Shi; Shusaku Shibutani; Kenichi Shibuya; Yoshihiro Shidoji; Jeng-Jer Shieh; Chwen-Ming Shih; Yohta Shimada; Shigeomi Shimizu; Dong Wook Shin; Mari L Shinohara; Michiko Shintani; Takahiro Shintani; Tetsuo Shioi; Ken Shirabe; Ronit Shiri-Sverdlov; Orian Shirihai; Gordon C Shore; Chih-Wen Shu; Deepak Shukla; Andriy A Sibirny; Valentina Sica; Christina J Sigurdson; Einar M Sigurdsson; Puran Singh Sijwali; Beata Sikorska; Wilian A Silveira; Sandrine Silvente-Poirot; Gary A Silverman; Jan Simak; Thomas Simmet; Anna Katharina Simon; Hans-Uwe Simon; Cristiano Simone; Matias Simons; Anne Simonsen; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Debasish Sinha; Sangita Sinha; Frank A Sinicrope; Agnieszka Sirko; Kapil Sirohi; Balindiwe Jn Sishi; Annie Sittler; Parco M Siu; Efthimios Sivridis; Anna Skwarska; Ruth Slack; Iva Slaninová; Nikolai Slavov; Soraya S Smaili; Keiran Sm Smalley; Duncan R Smith; Stefaan J Soenen; Scott A Soleimanpour; Anita Solhaug; Kumaravel Somasundaram; Jin H Son; Avinash Sonawane; Chunjuan Song; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Wei Song; Kai Y Soo; Anil K Sood; Tuck Wah Soong; Virawudh Soontornniyomkij; Maurizio Sorice; Federica Sotgia; David R Soto-Pantoja; Areechun Sotthibundhu; Maria João Sousa; Herman P Spaink; Paul N Span; Anne Spang; Janet D Sparks; Peter G Speck; Stephen A Spector; Claudia D Spies; Wolfdieter Springer; Daret St Clair; Alessandra Stacchiotti; Bart Staels; Michael T Stang; Daniel T Starczynowski; Petro Starokadomskyy; Clemens Steegborn; John W Steele; Leonidas Stefanis; Joan Steffan; Christine M Stellrecht; Harald Stenmark; Tomasz M Stepkowski; Stęphan T Stern; Craig Stevens; Brent R Stockwell; Veronika Stoka; Zuzana Storchova; Björn Stork; Vassilis Stratoulias; Dimitrios J Stravopodis; Pavel Strnad; Anne Marie Strohecker; Anna-Lena Ström; Per Stromhaug; Jiri Stulik; Yu-Xiong Su; Zhaoliang Su; Carlos S Subauste; Srinivasa Subramaniam; Carolyn M Sue; Sang Won Suh; Xinbing Sui; Supawadee Sukseree; David Sulzer; Fang-Lin Sun; Jiaren Sun; Jun Sun; Shi-Yong Sun; Yang Sun; Yi Sun; Yingjie Sun; Vinod Sundaramoorthy; Joseph Sung; Hidekazu Suzuki; Kuninori Suzuki; Naoki Suzuki; Tadashi Suzuki; Yuichiro J Suzuki; Michele S Swanson; Charles Swanton; Karl Swärd; Ghanshyam Swarup; Sean T Sweeney; Paul W Sylvester; Zsuzsanna Szatmari; Eva Szegezdi; Peter W Szlosarek; Heinrich Taegtmeyer; Marco Tafani; Emmanuel Taillebourg; Stephen Wg Tait; Krisztina Takacs-Vellai; Yoshinori Takahashi; Szabolcs Takáts; Genzou Takemura; Nagio Takigawa; Nicholas J Talbot; Elena Tamagno; Jerome Tamburini; Cai-Ping Tan; Lan Tan; Mei Lan Tan; Ming Tan; Yee-Joo Tan; Keiji Tanaka; Masaki Tanaka; Daolin Tang; Dingzhong Tang; Guomei Tang; Isei Tanida; Kunikazu Tanji; Bakhos A Tannous; Jose A Tapia; Inmaculada Tasset-Cuevas; Marc Tatar; Iman Tavassoly; Nektarios Tavernarakis; Allen Taylor; Graham S Taylor; Gregory A Taylor; J Paul Taylor; Mark J Taylor; Elena V Tchetina; Andrew R Tee; Fatima Teixeira-Clerc; Sucheta Telang; Tewin Tencomnao; Ba-Bie Teng; Ru-Jeng Teng; Faraj Terro; Gianluca Tettamanti; Arianne L Theiss; Anne E Theron; Kelly Jean Thomas; Marcos P Thomé; Paul G Thomes; Andrew Thorburn; Jeremy Thorner; Thomas Thum; Michael Thumm; Teresa Lm Thurston; Ling Tian; Andreas Till; Jenny Pan-Yun Ting; Vladimir I Titorenko; Lilach Toker; Stefano Toldo; Sharon A Tooze; Ivan Topisirovic; Maria Lyngaas Torgersen; Liliana Torosantucci; Alicia Torriglia; Maria Rosaria Torrisi; Cathy Tournier; Roberto Towns; Vladimir Trajkovic; Leonardo H Travassos; Gemma Triola; Durga Nand Tripathi; Daniela Trisciuoglio; Rodrigo Troncoso; Ioannis P Trougakos; Anita C Truttmann; Kuen-Jer Tsai; Mario P Tschan; Yi-Hsin Tseng; Takayuki Tsukuba; Allan Tsung; Andrey S Tsvetkov; Shuiping Tu; Hsing-Yu Tuan; Marco Tucci; David A Tumbarello; Boris Turk; Vito Turk; Robin Fb Turner; Anders A Tveita; Suresh C Tyagi; Makoto Ubukata; Yasuo Uchiyama; Andrej Udelnow; Takashi Ueno; Midori Umekawa; Rika Umemiya-Shirafuji; Benjamin R Underwood; Christian Ungermann; Rodrigo P Ureshino; Ryo Ushioda; Vladimir N Uversky; Néstor L Uzcátegui; Thomas Vaccari; Maria I Vaccaro; Libuše Váchová; Helin Vakifahmetoglu-Norberg; Rut Valdor; Enza Maria Valente; Francois Vallette; Angela M Valverde; Greet Van den Berghe; Ludo Van Den Bosch; Gijs R van den Brink; F Gisou van der Goot; Ida J van der Klei; Luc Jw van der Laan; Wouter G van Doorn; Marjolein van Egmond; Kenneth L van Golen; Luc Van Kaer; Menno van Lookeren Campagne; Peter Vandenabeele; Wim Vandenberghe; Ilse Vanhorebeek; Isabel Varela-Nieto; M Helena Vasconcelos; Radovan Vasko; Demetrios G Vavvas; Ignacio Vega-Naredo; Guillermo Velasco; Athanassios D Velentzas; Panagiotis D Velentzas; Tibor Vellai; Edo Vellenga; Mikkel Holm Vendelbo; Kartik Venkatachalam; Natascia Ventura; Salvador Ventura; Patrícia St Veras; Mireille Verdier; Beata G Vertessy; Andrea Viale; Michel Vidal; Helena L A Vieira; Richard D Vierstra; Nadarajah Vigneswaran; Neeraj Vij; Miquel Vila; Margarita Villar; Victor H Villar; Joan Villarroya; Cécile Vindis; Giampietro Viola; Maria Teresa Viscomi; Giovanni Vitale; Dan T Vogl; Olga V Voitsekhovskaja; Clarissa von Haefen; Karin von Schwarzenberg; Daniel E Voth; Valérie Vouret-Craviari; Kristina Vuori; Jatin M Vyas; Christian Waeber; Cheryl Lyn Walker; Mark J Walker; Jochen Walter; Lei Wan; Xiangbo Wan; Bo Wang; Caihong Wang; Chao-Yung Wang; Chengshu Wang; Chenran Wang; Chuangui Wang; Dong Wang; Fen Wang; Fuxin Wang; Guanghui Wang; Hai-Jie Wang; Haichao Wang; Hong-Gang Wang; Hongmin Wang; Horng-Dar Wang; Jing Wang; Junjun Wang; Mei Wang; Mei-Qing Wang; Pei-Yu Wang; Peng Wang; Richard C Wang; Shuo Wang; Ting-Fang Wang; Xian Wang; Xiao-Jia Wang; Xiao-Wei Wang; Xin Wang; Xuejun Wang; Yan Wang; Yanming Wang; Ying Wang; Ying-Jan Wang; Yipeng Wang; Yu Wang; Yu Tian Wang; Yuqing Wang; Zhi-Nong Wang; Pablo Wappner; Carl Ward; Diane McVey Ward; Gary Warnes; Hirotaka Watada; Yoshihisa Watanabe; Kei Watase; Timothy E Weaver; Colin D Weekes; Jiwu Wei; Thomas Weide; Conrad C Weihl; Günther Weindl; Simone Nardin Weis; Longping Wen; Xin Wen; Yunfei Wen; Benedikt Westermann; Cornelia M Weyand; Anthony R White; Eileen White; J Lindsay Whitton; Alexander J Whitworth; Joëlle Wiels; Franziska Wild; Manon E Wildenberg; Tom Wileman; Deepti Srinivas Wilkinson; Simon Wilkinson; Dieter Willbold; Chris Williams; Katherine Williams; Peter R Williamson; Konstanze F Winklhofer; Steven S Witkin; Stephanie E Wohlgemuth; Thomas Wollert; Ernst J Wolvetang; Esther Wong; G William Wong; Richard W Wong; Vincent Kam Wai Wong; Elizabeth A Woodcock; Karen L Wright; Chunlai Wu; Defeng Wu; Gen Sheng Wu; Jian Wu; Junfang Wu; Mian Wu; Min Wu; Shengzhou Wu; William Kk Wu; Yaohua Wu; Zhenlong Wu; Cristina Pr Xavier; Ramnik J Xavier; Gui-Xian Xia; Tian Xia; Weiliang Xia; Yong Xia; Hengyi Xiao; Jian Xiao; Shi Xiao; Wuhan Xiao; Chuan-Ming Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Yuyan Xiong; Chuanshan Xu; Congfeng Xu; Feng Xu; Haoxing Xu; Hongwei Xu; Jian Xu; Jianzhen Xu; Jinxian Xu; Liang Xu; Xiaolei Xu; Yangqing Xu; Ye Xu; Zhi-Xiang Xu; Ziheng Xu; Yu Xue; Takahiro Yamada; Ai Yamamoto; Koji Yamanaka; Shunhei Yamashina; Shigeko Yamashiro; Bing Yan; Bo Yan; Xianghua Yan; Zhen Yan; Yasuo Yanagi; Dun-Sheng Yang; Jin-Ming Yang; Liu Yang; Minghua Yang; Pei-Ming Yang; Peixin Yang; Qian Yang; Wannian Yang; Wei Yuan Yang; Xuesong Yang; Yi Yang; Ying Yang; Zhifen Yang; Zhihong Yang; Meng-Chao Yao; Pamela J Yao; Xiaofeng Yao; Zhenyu Yao; Zhiyuan Yao; Linda S Yasui; Mingxiang Ye; Barry Yedvobnick; Behzad Yeganeh; Elizabeth S Yeh; Patricia L Yeyati; Fan Yi; Long Yi; Xiao-Ming Yin; Calvin K Yip; Yeong-Min Yoo; Young Hyun Yoo; Seung-Yong Yoon; Ken-Ichi Yoshida; Tamotsu Yoshimori; Ken H Young; Huixin Yu; Jane J Yu; Jin-Tai Yu; Jun Yu; Li Yu; W Haung Yu; Xiao-Fang Yu; Zhengping Yu; Junying Yuan; Zhi-Min Yuan; Beatrice Yjt Yue; Jianbo Yue; Zhenyu Yue; David N Zacks; Eldad Zacksenhaus; Nadia Zaffaroni; Tania Zaglia; Zahra Zakeri; Vincent Zecchini; Jinsheng Zeng; Min Zeng; Qi Zeng; Antonis S Zervos; Donna D Zhang; Fan Zhang; Guo Zhang; Guo-Chang Zhang; Hao Zhang; Hong Zhang; Hong Zhang; Hongbing Zhang; Jian Zhang; Jian Zhang; Jiangwei Zhang; Jianhua Zhang; Jing-Pu Zhang; Li Zhang; Lin Zhang; Lin Zhang; Long Zhang; Ming-Yong Zhang; Xiangnan Zhang; Xu Dong Zhang; Yan Zhang; Yang Zhang; Yanjin Zhang; Yingmei Zhang; Yunjiao Zhang; Mei Zhao; Wei-Li Zhao; Xiaonan Zhao; Yan G Zhao; Ying Zhao; Yongchao Zhao; Yu-Xia Zhao; Zhendong Zhao; Zhizhuang J Zhao; Dexian Zheng; Xi-Long Zheng; Xiaoxiang Zheng; Boris Zhivotovsky; Qing Zhong; Guang-Zhou Zhou; Guofei Zhou; Huiping Zhou; Shu-Feng Zhou; Xu-Jie Zhou; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Wenhua Zhu; Xiao-Feng Zhu; Yuhua Zhu; Shi-Mei Zhuang; Xiaohong Zhuang; Elio Ziparo; Christos E Zois; Teresa Zoladek; Wei-Xing Zong; Antonio Zorzano; Susu M Zughaier Journal: Autophagy Date: 2016 Impact factor: 16.016