Natalie N Kinloch1,2, Yanqin Ren3, Winiffer D Conce Alberto3, Winnie Dong2, Pragya Khadka3, Szu Han Huang3, Talia M Mota3, Andrew Wilson4, Aniqa Shahid1,2, Don Kirkby2, Marianne Harris2,5, Colin Kovacs6, Erika Benko6, Mario A Ostrowski7, Perla M Del Rio Estrada8, Avery Wimpelberg9, Christopher Cannon9, W David Hardy9, Lynsay MacLaren9, Harris Goldstein10, Chanson J Brumme2,5, Guinevere Q Lee3, Rebecca M Lynch4, Zabrina L Brumme11,12, R Brad Jones13,14. 1. Faculty of Health Sciences, Simon Fraser University, Burnaby, BC, Canada. 2. British Columbia Centre for Excellence in HIV/AIDS, Vancouver, BC, Canada. 3. Infectious Diseases Division, Department of Medicine, Weill Cornell Medical College, New York, NY, USA. 4. Department of Microbiology, Immunology and Tropical Medicine, George Washington University, Washington, USA. 5. Faculty of Medicine, University of British Columbia, Vancouver, BC, Canada. 6. Maple Leaf Medical Clinic, Toronto, ON, Canada. 7. Department of Medicine, University of Toronto, Toronto, ON, Canada. 8. Center for Research in Infectious Diseases, National Institute of Respiratory Diseases, Mexico City, Mexico. 9. Whitman Walker Health, Washington, DC, USA. 10. Department of Microbiology and Immunology, Albert Einstein College of Medicine, Bronx, NY, USA. 11. Faculty of Health Sciences, Simon Fraser University, Burnaby, BC, Canada. zbrumme@sfu.ca. 12. British Columbia Centre for Excellence in HIV/AIDS, Vancouver, BC, Canada. zbrumme@sfu.ca. 13. Infectious Diseases Division, Department of Medicine, Weill Cornell Medical College, New York, NY, USA. rbjones@med.cornell.edu. 14. Department of Microbiology, Immunology and Tropical Medicine, George Washington University, Washington, USA. rbjones@med.cornell.edu.
Correction to: Nature Communications 10.1038/s41467-020-20442-3, published online 08 January 2021.The original version of this Article contained an error for the ‘RPP30-Shear Forward Primer sequence’ provided in the ‘Intact Proviral DNA Assay (IPDA)’ section of the Methods, which incorrectly read ‘CCAATTTGCTGCTCCTTGGG’. The correct sequence of the ‘RPP30-Shear Forward Primer’ is ‘CCATTTGCTGCTCCTTGGG’. This has been corrected in both the PDF and HTML versions of the Article.
Authors: Christian Gaebler; Shane D Falcinelli; Elina Stoffel; Jenna Read; Ross Murtagh; Thiago Y Oliveira; Victor Ramos; Julio C C Lorenzi; Jennifer Kirchherr; Katherine S James; Brigitte Allard; Caroline Baker; JoAnn D Kuruc; Marina Caskey; Nancie M Archin; Robert F Siliciano; David M Margolis; Michel C Nussenzweig Journal: J Virol Date: 2021-02-24 Impact factor: 5.103
Authors: Imogen A Wright; Michael J Bale; Wei Shao; Wei-Shau Hu; John M Coffin; Gert U Van Zyl; Mary F Kearney Journal: Retrovirology Date: 2021-06-27 Impact factor: 3.768