Evaluation of the S-locus in Prunus domestica, characterization, phylogeny and 3D modelling.

Self-compatibility has become the primary objective of most prune (Prunus domestica) breeding programs in order to avoid the problems related to the gametophytic self-incompatibility (GSI) system present in this crop. GSI is typically under the control of a specific locus., known as the S-locus., which contains at least two genes. The first gene encodes glycoproteins with RNase activity in the pistils., and the second is an SFB gene expressed in the pollen. There is limited information on genetics of SI/SC in prune and in comparison., with other Prunus species, cloning., sequencing and discovery of different S-alleles is very scarce. Clear information about S-alleles can be used for molecular identification and characterization of the S-haplotypes. We determined the S-alleles of 36 cultivars and selections using primers that revealed 17 new alleles. In addition, our study describes for the first time the association and design of a molecular marker for self-compatibility in P. domestica. Our phylogenetic tree showed that the S-alleles are spread across the phylogeny, suggesting that like previous alleles detected in the Rosaceae., they were of trans-specific origin. We provide for the first time 3D models for the P. domestica SI RNase alleles as well as in other Prunus species, including P. salicina (Japanese plum), P. avium (cherry), P. armeniaca (apricot), P. cerasifera and P. spinosa.

Introduction

Self-incompatibility (SI) is an important biological feature of flowering plants, in which pollen-pistil interactions prevent self-fertility and determine the success of mating in out-crossed plants [1]. The mechanism takes on special significance in agricultural fruit and nut crops, where SI reduces the potential for successful fertilization in minimally genetically diverse orchards. For such species, fruit and nut breeders commonly select for self-compatibility that has the added advantage of reduced dependence on insect pollinators [2].

Prunus, which belongs to the Rosaceae, is one of the most important genera of fruit and nut trees that includes several commercially important species. Because successful fertilization is critical for fruit and nut production, the genus has been the subject of many studies of the genetic mechanisms of SI and the identification of SI groups that can aid in orchard design. Fruit production is controlled by a gametophytic SI (GSI) system that is regulated by a single polymorphic locus containing at least two linked genes; one specifically expressed in the pistil and the other in the pollen [3]. In diploid species, pollen tube growth is arrested in the style whenever the single S haplotype expressed in pollen matches one of the two S haplotypes expressed in the diploid pistil tissue [4]. The pistil component of SI in the Rosaceae, as in the Solanaceae and Plantaginaceae, is a ribonuclease, S-RNase [5, 6], which acts as a cytotoxin in self-pollen tubes, whereas the candidate gene for the pollen component in all Prunus species was identified by [7], to be a specific F-box (SFB) gene that is tightly linked to the S-RNase gene [8, 9]. However, the role of SFB proteins is not completely understood.

As would be expected for proper functioning of the GSI system, co-evolution between pollen and stigma parts of the S-locus requires mutations in one part to be complemented by mutations in the other [10], leading to expectations of high polymorphism at both loci under frequency dependent selection. Indeed, high S-RNase allelic diversity has been detected for most species studied and high pollen part polymorphism has been reported, for example in P. dulcis P. dulcis [7], P. avium [11] and in several additional Prunus spp. [11]. The pistil S-RNases are believed to be ancestral in most eudicots [12], however, diversification of the pollen S F-box proteins appears to be more taxon-dependent [7, 13–15], perhaps as a result of the rapid birth/death of F-box genes [16].

Breakdown of the GSI system results in self-compatible (SC) genotypes that are of great interest to the horticultural industry. The presence of haplotypes conferring SC has been studied in diploid Prunus species, including almond (P. dulcis), Japanese plum (P. salicina), sweet cherry (P. avium) and apricot (P. armeniaca). In most cases SC has been attributed to loss-of-pistil function or to mutations at the SFB gene. For example, in apricot and sweet cherry the SC haplotypes are hypothesized to be a pollen-part mutant in most cases [17-19]. However, the presence of a modifier locus outside the S locus has also been reported in sweet cherry, almond and apricot [20-25]. Other putative causes of SC found in Japanese plum and almond have been associated with a low transcriptional level in the S-RNase [26], or to epigenetic mutations in the S-RNase [27].

Whereas most work on GSI functioning in Prunus has focused on diploid species, several polyploid taxa are important fruit crops, including the tetraploid sour cherry (P. cerasus) and the hexaploid prune (P. domestica). Functioning of the SI system is likely to be considerably more complicated in polyploids than in diploids and appears to vary among taxonomic groups. For example, polyploidy in the Solanaceae induces a competitive interaction among alleles and the breakdown of the SI interaction with heteroallelic pollen [28]. Competitive interaction was reported by [29] for an SC selection of P. pseudocerasus that would be comparable with the Solanaceae. However, in P. cerasus [30], have shown that loss of SI is genotype dependent, rather than ploidy dependent, and that, in contrast to the Solananceae, heteroallelic pollen is SI. Detailed crossing studies between P. cerasus and the diploid P. avium support a one-allele match model, in which pollen is rejected when a functional S-haplotype occurs in both diploid pollen and tetraploid stylar tissue and so, breakdown of SI occurs when pollen contains two non-functional S-haplotypes that may be due to stylar, or pollen mutations [30, 31].

Among polyploid Prunus species, relatively little is known about the GSI system in the hexaploid prune Prunus domestica L, including a dearth of information on allelic variation at the two loci within the S haplotype. Lack of this information limits detailed characterization of germplasm, breeding efforts and appropriate orchard design. S-genotyping using consensus S-RNase primers developed in other Prunus species, has successfully identified S-RNase alleles [32-36]. However, only three S-RNase alleles have been cloned and sequences deposited in the NCBI repository (Sutherland et al., 2008), making genotyping analysis for the remaining alleles very difficult, since these are based on individual interpretations of banding patterns on gels.

In this study we use a multilevel approach that combines traditional field research with molecular gene analysis to understand variation in the S-RNase and SFB loci among cultivars and to ascertain the factors affecting reproductive success in P. domestica. This integrative approach (pollen tube growth, fruit set evaluation, PCR analysis, genomic DNA cloning/sequencing and 3D protein modelling) was undertaken in order to identify the SC haplotypes among thirty-six selections developed within the University of California, Davis prune breeding program and to characterize diversity at the S locus.

Material and methods

Plant material

Pistils and leaves from thirty-six different selections and varieties, including Improved French, Sutter, Muir Beauty and Tulare Giant, were collected from trees growing in the UC Davis prune germplasm collection during three consecutive years (2018, 2019 and 2020). Name of the cultivars and breeding selections are listed in Table 1. Some breeding selections have been derived from crosses among Improved French prune, some others are imported prune clones from France and others are traditional European plum cultivars grown in the US. The UC Davis prune breeding program currently has around 75 selected candidate cultivars for potential release, as well as thousands of seedlings that require evaluation.

Table 1

Summary of the 36 selections of P. domestica used in this study, including their origins and their detected S-RNase-genotype.

Sample     Name		Pedigree	Detected S-genotype	SC/SI
1	F3S-5	Sutter OP	S1/S5/S14	SI
2	F11S-38	French X 6-22-51	S4/S17	SC
3	G5N-35	French X Sutter	S12/S14/S17	SC
4	G45N-35	D6N103 X Muir Beauty	S8/S14/S16	SI
5	G3N-16	S19-39 X 6-22-51	S5/S7/S11/S14	SI
6	D18S-50	Imperial X Tulare Giant	S11/S12/S16	SI
7	G16N-19	3-9E-49 X 4-7E-35	S11/S14/S17	SC
8	G40N-34	D2N-26 X Muir Beauty	S4/S7	SI
9	2-2E-38RR	Early Tragedy X Primacotes	S5/S7/S9/S16	SI
10	D3-39	French OP	S6/S17	SC
11	3-11E-45RR	French X Tardicotes	S6/S9/S12	SI
12	3-11E-32RR	French X Tardicotes	S2/S3/S4/S12	SI
13	5/1/32	French OP	S2/S4/S7/S12	SI
14	3-8E-46RR	French X Tragedy	S1/S3/S6/S17	SC
15	Tragedy	German Prune X Purple Twain	S7/S12	SI
16	Fruit Salad	--	S3/S6	SI
17	Improved French	Agen X seedling of Agen	S10/S12/S17	SC
18	Sutter	Sugar X Primacote	S3/S10/S12/S17	SC
19	F9N-21	Tulare Giant X 6-22-52	S3/S6	SI
20	3-9E-49	--	S3/S9/S11/S17	SC
21	F11N-34	5-3-4 X X 6-19-51	S4/S6	SI
22	G43N-1	D4N-46 X Muir Beauty	S5/S7/S10/S12	SI
23	F13N-23	French X 6-22-51	S4/S9/S10	SI
24	Jojo	Ortenauer X Stanley	S1/S3/S5/S10	SI
25	F2N-10	5-19-30 OP	S1/S9/S14/S15	SI
26	G5N-58	French X Sutter	S7/S11/S12	SI
27	Tulare Giant	Empress X Primacote	S7/S13/S16	SI
28	D6N-103	French X 5-1-32	S7/S8/S12	SI
29	F9S-33	Tulare Giant X 6-22-51	S8/S9/S15	SI
30	Muir Beauty	French X Tulare Giant	S10/S17	SC
31	F13S-46	French X 6-22-51	S4/S10/S11/S15	SI
32	G2N-24	5-19-39 X 6-15-62	S4/S15	SI
33	29C	Rootstock	S6/S11/S14/S17	SC
34	WS3.1	--	S2/S4/S9/S15	SI
35	WN16.1	--	S7/S8/S12/S15/S16	SI
36	H13S-58	D2N-76 OP	S6/S11/S14/S17	SC

Self-compatible (SC) and self-incompatible (SI).

Pollen tube growth and fruit set

Twelve of the 36 selections formed an in vitro study of self-pollination (Table 2). During three consecutive years (2018, 2019 and 2020), at least 12 flower buds a year [37] from each of the 12 seedlings were collected from the field, emasculated and placed in a tray with tap-water, allowing the contact of the flower peduncles with the tray water to prevent dehydration (Fig 1). Anthers were removed from the emasculated flowers and allowed to dry for two days. This pollen was used to self-pollinate the pistils in the tray. Ninety-six hours after pollination, the pistils were placed in tubes containing 5 ml of a 5% solution of Na2SO3. The samples were maintained at 4°C until observation, when they were stained with 0.1% (v/v) aniline blue in 0.1 N potassium phosphate as a specific stain for callose [38]. This growth was assessed by observation under an Olympus BH2 microscope with UV illumination with a Chiu Technical Corp with a Mercury-100 lamp. A genotype was considered SC when pollen tubes reached the base of at least 8 of the 12 styles, in a minimum of two years. In addition, a branch with a minimum of 100 flowers was bagged before bloom in the field, in order to assess the level of SC by evaluating fruit set in enclosed branches. Sets were calculated 3 months after bagging by counting the total number of fruits and were ranked according to [39], i) less than 2% = SI; ii) between 2% and 5% = low SC; iii) between 5% and 10% = SC and iv) higher than 10% = highly SC.

Table 2

Data showing fruit set after bagging and pollen tube growth for three years and phenotype for SC/SI from the evaluations in the field and in the lab under microscope observations.

Selection	Fruit Set % 2018	Fruit Set % 2019	Fruit Set % 2020	Average. Fruit Set %	Phenotype Fruit set	Number of analyzed pistils	% Pistils with pollen tubes reaching the ovary	Phenotype microscope
Improved French	26.7	25.2	21.1	24.3	Highly SC	38	87	SC
Sutter	12	16	14	14.0	Highly SC	40	85	SC
Muir Beauty	32	30.1	25.4	29.2	Highly SC	36	91	SC
G5N35	19	25	21	21.7	Highly SC	35	87	SC
G16N19	31	28	23	27.3	Highly SC	38	89	SC
H13S-58	7.2	6.2	5.1	6.2	SC	36	77	SC
G16N19	11	8.6	7	8.9	SC	37	76	SC
D6N-103	0.9	1.6	0	0.8	SI	37	0	SI
D18S-50	0	0	0	0.0	SI	39	0	SI
F3S-5	0.7	1.5	1.2	1.1	SI	36	0	SI
F13S-46	0	0	0	0.0	SI	36	0	SI
Tulare Giant	1	0.6	0	0.5	SI	38	0	SI

Fig 1

Pollen tube growth in prune flowers.

Preparation of pollen grains and drying anthers before being used to hand-pollinate the pistils (A), emasculated flowers on wet florist foam (B), pollen grains in self-pollinated flowers of prune germinating at the stigma (C), pollen tubes growing along the style (D), pollen tubes reaching the base of the style (E).

Isolation of genomic DNA

In addition to the twelve selections, total DNA from twenty-four more selections was isolated from young leaves using a Qiagen DNA Kit (Qiagen, USA). The quantification and quality evaluation of DNA was performed by a Qubit spectrophotometer (Thermo Fisher Scientific, USA).

S-locus fragment analysis

Pistil S-RNase genotyping was performed using four primer pairs that have shown good transferability among other Prunus species and have revealed high diversity within the S-RNase gene [PaConsIF/PaConsIIR and PaConsIF/EMPC5-consRD [10, 37], PruT2/PCER and PruC2/PCER [40, 41]. For the pollen SFB gene, we used the primer combination Fbox5’F/FboxIntronR [42]. All primer information can be found in Table 3.

Table 3

Sequence information of the primers used and designed in this study.

Primer name	Sequence 5’ 3’	Reference
PaConsIF	MCTTGTTCTTGSTTTYGCTTT CTTC	[62]
PaConsIIR	CAWAACAAARTACCACTTCATGTAAC	[62]
EMPC5-consRD	CAAAATACCACTTCATGTAACARC	[33]
PruT2	TSTTSTTGSTTTTGCTTTCTTC	[40]
PCER	TGTTTGTTCCATTCGCYTTCCC	[40]
PruC2	CTATGGCCAAGTAATTATTCAAACC	[41]
S17-F*	TCTTCCCTTGCTTGGTGTCT	*This study
S17-R*	TCCATGTCTGTGTCGGATGT	*This study
Fbox5’F	TTKSCHATTRYCAACCKCAAAAG	[42]
FboxIntronR	CWGGTAGTCTTDSYAGGATG	[42]

PCR reactions for the S-RNase markers were performed in a volume of 25 μl containing 1x PCR buffer, 1.5 mM MgCl2, 0.2 mM dNTPs, 0.5 μM of each primer and 1 unit of Taq DNA Polymerase. The program consisted of a 2 min denaturation at 94°C, 35 cycles of 1 min at 94°C, 2 min at 50°C and 4 min at 68°C followed by a final extension of 10 min at 68°C. Amplification products were separated on 1% TAE agarose gel in 1X TAE buffer and stained with SYBRGreen and visualized with UV light. A 100 bp DNA ladder was used for fragment size determination.

PCR reaction for the SFB marker ‘Fbox5’F/FboxIntronR’ was performed with M13 labeled tail in its 5’ extremity (CACGACGTTGTAAAACGACA). PCR conditions were as follow, 1X buffer containing 1.5 mM MgCl2., 0.2 mM of each dNTP, 1U Taq polymerase (New England Biolabs), 0.02 μM forward primer with M13 tail in its 5´ extremity, 0.2 μM of M13 Dye (6-Fam) primer and 0.2 μM of reverse primer. The program consisted of 94°C for 5 min; 30 cycles of 94°C for 30 s., 56°C for 45 s, and 72°C for 45 s; 8 cycles of 94°C for 30 s, 53°C for 45 s, and 72°C for 45 s; and a final elongation step at 72°C for 10 min. PCR products were detected using an ABI PRISM 3730xl Genetic Analyzer and GeneMapper analysis software (Applied Biosystems, CA, USA) located at the Evolutionary Genetics Lab (UC Berkeley).

Cloning, sequencing, primer design and analysis of the S-RNase alleles

Once the samples were genotyped, the different S-RNase alleles were gel-cut, cloned and sequenced. Prior to cloning, the band size corresponding to the target alleles was purified using the Wizard Plus Miniprep DNA Purification System (Promega, CA, USA) and quantified on 1.5% agarose gel using a standard 1 kb DNA ladder (Invitrogen, CA, USA). The purified PCR products were cloned into the vector pGEM using the Promega Cloning Kit. For each allele, at least three plasmids from different PCR reactions were sequenced from both ends following the methodology described by Fernandez i Marti et al. (2010, 2014). Plasmids were sequenced on an automated sequencer ABI PRISM 3730 Genetic Analyzer (Applied Biosystems, CA). The coding sequences from C1 to C5 of the cloned S-alleles, were translated and the deduced amino acid sequences were aligned by the ClustalX method using MegAlign Software (DNASTAR., Madison, WI, USA). S-RNase sequences obtained in this work were deposited in GenBank under accession numbers MW407935- MW407936. In order to obtain a complete coverage of the S-RNase gene, additional markers were developed by using the primer walking strategy. All primers were designed using the primer3 software [43]. Specific primers for the S17 RNase allele were designed (Table 3). The PCR program consisted of an initial denaturation at 94°C for 2 min, followed by 34 cycles of denaturation at 94°C for 20 s, 40 s at 57°C, extension at 72°C for 1 min, and a final extension at 72°C for 7 min. PCRs were set up on ice under sterile conditions and the thermocycler was preheated to 94°C before adding the reactions. PCR products were run on a 1% agarose gel.

Diversity analysis and evolutionary phylogenetic analysis of S-RNase alleles

P. domestica is believed to have originated as an interspecific hybrid of a diploid P. cerasifera and a tetraploid P. spinosa; the latter species may have been an interspecific hybrid of P. cerasifera and an unknown Eurasian plum species [44]. The goal of our phylogenetic analysis was to investigate whether the origins of S-RNase alleles that we detected in P. domestica could be traced to its putative ancestors. Therefore, we obtained available GenBank sequences for 86 published SI alleles from members of subgenus Prunus sensu according to [45], see S1 Table. Sequences included S-RNase alleles from the putative parents of P. domestica (P. cerasifera and P. spinosa) as well as the diploid plum (P. salicina) and seven randomly selected alleles for other Prunus species; P. avium, P. dulcis and P. armeniaca. Six Pyrus communis L. SI-RNase alleles were used as outgroup. Protein sequences for each species, together with the alleles detected in this study for P. domestica, were aligned using ClustalW integrated within the program Geneious. The alignment was visualized and manually refined using Jalview software (www.jalview.org). Phylogenetic analyses were performed using the maximum likelihood method through RAxML 8.0 [46]. The resulting tree was visualized using FigTree v1.4.2.

Three-dimensional modelling of S-RNase proteins

The protein sequence of the P. domestica S RNase (MW407938.1; this work), along with protein sequences obtained from the NCBI database for the SC alleles [P. dulcis S-RNase (QDB64273.1), P. armeniaca S-RNase (ABO34168.1), P. avium S-RNase (AAT72120.1), P. salicina S-RNase (BAF91848.1)] and the SI alleles [P. domestica S-RNase (MW407946.1), P. cerasifera S-RNase (AM992048.1) and P. spinosa S-RNase (ABV02077.1)] were used for 3D modelling analysis. The modelling procedure began with alignment of the sequences with the related known protein sequence and crystal structure (template) derived from the Protein Data Bank (PDB). The known 3D structure was chosen based on the protein sequence identity, which had to be higher than 35% with our target genes. Sequences were aligned using the deduced protein sequences for these Prunus RNase alleles using T-Coffee (EMBL-EBI). The frame of the 3D model was constructed by MODELLER 9v24 [47]. Forty models were constructed for each S-RNase. The four models with the lowest value of the Modeller objective function were retrieved for further analysis. Energy function was evaluated through PROSAIIv3 [48].

Stereo-chemical quality and the overall G-factors of the protein models were calculated using PROCHECK [49]. The models with lower numbers of amino acid residues in disallowed regions were selected as the most suitable models. Finally, the molecular graphics of the best models were generated with PYMOL, which visualizes protein structures. Additionally, the 3D models of all S-RNases were compared with that of Pyrus pyrifolia S-RNase (BAA93052.1; [50]), another Rosaceous species.

Results

Phenotypic expression

In an attempt to characterize and identify the phenotypes associated with self-compatibility in P. domestica, we analyzed the pollen tube behavior in pistils under the microscope after self-pollinations.

Observations of pollen tube growth allowed classifying the phenotype of the selections as SC or SI. Out of the twelve individuals analyzed in the lab, only seven (58.3%) showed pollen tubes at the base of the style (G16N19, G5N35, H13S-58, G16N19, Sutter, Muir Beauty and Improved French). As shown in Table 2, the percentage of pistils with pollen tubes reaching the ovary was between 76% (G16N19) and 91% (Muir Beauty). Consequently, these selections were considered as self-compatible (Fig 1). In the remaining five samples, pollen tube growth was arrested in the middle third of the style of the self-pollinated pistils, and no pollen tubes were observed at the style base or in the ovary., displaying the characteristic arrest of pollen tube growth as the typical SI response (D6N-103, D18S-50, F3S-5, F13S-46 and Tulare Giant). Germinated pollen grains on the stigma were observed in all the selections.

Fruit set after bagging confirmed the SC/SI of all selections previously identified as SC/SI by pollen tube growth. Among the SC selections, five genotypes (G16N19, G5N35, Sutter, Muir Beauty and Improved French) were highly SC according to the criteria of [39] with a fruit set higher than 10%, whereas the selections G16N19 and H13S-58 are considered as SC because fruit sets were between 5% and 10% (Table 2). In addition, sets after bagging confirmed the SI phenotype for the three years of the five individuals previously classified as SI under microscopic observation since their fruit set was lower than 2% in the three years.

Genotyping, cloning and sequencing analysis of the SI alleles in P. domestica

Of all primer combinations tested for the S-RNase locus, the primer set PruC2-PCER., which flanks the second and fifth conserved domains of S-RNases, was the most successful in all the samples. The number of alleles amplified with the other primer combinations was very low and, in most cases, no more than two alleles were identified for each individual. However, the PruC2-PCER primer set yielded a multiallelic profile showing from two (Muir Beauty) to five (WN16.1) different fragments per genotype. PCR allele identification revealed seventeen different bands on the gel, including one that was common to all SC phenotypes. This high number of amplified fragments reveals the high genetic diversity for S alleles in prune. Allele sizes ranged from 350 bp (S) to 1350 bp (S). The most common alleles were S that was common to all SC phenotypes and S, S, S and S which were observed in eight, or nine different selections (Fig 2). By contrast, allele S was only detected in one selection (Tulare Giant). A maximum of five alleles were found in one genotype (WN16.1). The average number of alleles per individual was three (Table 1).

Fig 2

PCR amplification of 36 dried prune cultivars and selections, obtained with the primers PruC2-PCER.

Assessment of the alleles was accomplished after individual band isolation, cloning and sequencing.

We cloned and sequenced all bands amplified by primers PruC2-PCER to identify new alleles. Once all gel-band alleles were cloned and sequenced, a “blastn” analysis was conducted in order to find nucleotide sequence similarities with other S-alleles from Prunus species present in NCBI database. For all 17 alleles, we found high sequence similarities (≥95%) with S-RNase alleles from a range of species (Table 4).

Table 4

Size in base pairs (bp) of the new S alleles discovered in this study for RNase and SFB genes and sequence similarities with S-RNase alleles from a range of species in the genus Prunus.

Allele this study	Orthologous allele	Species with orthologous gene	% similarity	PRUC2-PCER (bp)	Fbox5’F-FboxIntronR (bp)
S1	S17RNase	P. salicina	100	780	375
S2	S27RNase	P. salicina	100	380	n.a
S3	S6RNase	P. domestica	96	615	n.a
S4	S1RNase	P. persica	98	585	230
S5	S5RNase	P. domestica	100	695	235
S6	S6RNase	P. domestica	100	310	274
S7	S4RNase	P. cerasifera	99	745	201
S8	Unidentified	P. cerasifera	99	1250	n.a
S9	S9RNase	P. domestica	100	470	365
S10	S10RNase	P. cerasifera	97	350	196
S11	S24RNase	P. salicina	98	525	240
S12	S18RNase	P. virginiana	97	805	192
S13	S31RNase	P. speciosa	95	1350	225
S14	S12RNase	P. virginiana	95	365	215
S15	S24RNase	P. spinosa	98	710	207
S16	S8RNase	P. spinosa	95	890	242
S17	S5RNase	P. virginiana	94	395	300

n.a, no amplification.

PCR amplification of the intron of the pollen SFB revealed a total of fourteen different alleles within the thirty-five P. domestica genotypes for both primer combinations. The size obtained for Fbox5’F/Fbox–IntronR ranged between 192 bp and 375 bp, with the allele size 235 bp being the most common (found in 9 samples). By contrast, the SFB alleles with a size of 201, 207 and 240 were only detected in one selection.

A S-RNase allele common to self-compatible phenotypes of P. domestica

As described earlier, the S allele was present and common to all self-compatible phenotypes but was not detected in self-incompatible selections (Table 1). Sequences of three different cloned colonies for this band in multiple individuals of Improved French and Sutter showed a nucleotide match of 100%. Within the genus Prunus, the S allele from P. domestica showed 94% similarity with the S-RNase allele described for P. virginiana (JQ627793.1). We designed specific primers to amplify this allele. The new molecular marker was then used to detect presence/absence in the remainder of the selections. The primer pair produced a single band, with a size of 205 bp (Fig 3), in all genotypes that were classified as SC according to our phenotypic analyses. As expected, this new marker did not amplify any band in the SI genotypes.

Fig 3

Example of efficacy of the new S marker tested in three SC and three SI samples.

Improved French (1), Sutter (2), Muir Beauty (3), Tulare Giant (4), 18S-50 (5) and 6N-103 (6).

Phylogenetic tree analysis and genetic relationship among the S-RNase alleles within the Rosaceae

We inferred evolutionary relationships among the S-RNase alleles of P. domestica, and among other Prunus species (P. salicina, P. avium, P. dulcis, P. armeniaca, P. spinosa and P. cerasifera), by constructing a ML phylogenetic tree of amino acid sequences (Fig 4). The P. domestica S-RNase alleles were widely dispersed in the ML phylogenetic tree, supporting previous reports of trans-specific origins. There was no evidence that P. domestica S-RNase-alleles clustered more frequently with S-RNase-alleles of putative hybrid parents, P. spinosa and P. cerasifera, than with alleles of any of the other Prunus species.

Fig 4

Phylogenetic relationships among S-RNase alleles from Prunus species including, the 17 alleles identified in this study.

Pyrus was used as an outgroup.

3D modelling of S-RNase proteins

We constructed 3-D models of the SC-RNase alleles of P. dulcis, P. armeniaca, P. avium and P. salicina and compared these with the SI alleles of P. domestica, P. cerasifera and P. spinosa S-RNase as well as the P. domestica S based on related known 3D structures derived from the Protein Database (PDB). The best template model chosen was the RNase MC1 mutant with accession 1J1G, with an identity between this template and the SC P. domestica S-RNase of 41% (E-value = 3e-28). The similarity to the SI P. domestica S-RNase was 40% and E-value = 9e-32. The MC1 protein sequence has 42% identity and E-value = 4e-33. The similarity to the S-RNase, S-RNase and S-RNase was 40%., 38% and 37.2%, respectively (E-value = 3e-28, E-value = 9e-32 and E-value = 1e-26). The similarity and identity to P. cerasifera S-RNase and the P. spinosa S-RNase were 39% and 39.5%, with E-value = 1e-29 and E-value = 3e-37.

Protein structures include secondary structural elements, with α-helices from the core regions of the molecule connected by loop regions (β-sheets) on the protein surface. Our S-RNases belonged to the α and β class, with six α helices and six β sheets connected by loops. The folding topologies of the main chains, found in the models analyzed here, were very similar to the topologies of the RNase T2 family of enzymes. The MC1 protein sequence we used as a template has eight α-helices and eight β sheets, whereas protein structures generated for the SC P. salicina, P. avium, P. spinosa, P. armeniaca and the S P. domestica alleles had 7 α-helices and between 2 and 6 β sheets (six for P. salicina and P. spinosa; four for P. domestica and P. avium; and two for P. armeniaca). The protein structure generated in P. cerasifera, SI P. domestica and SC P. dulcis S-RNase was 6 α-helices and 6 β sheets, with an overall molecular dimension for each S-RNase of approximately 40 Å x 50 Å x 30 Å.

Ramachandran plot statistics showed that 95.3% of amino acid residues were positioned in the favored regions. Structures that place 95–97% or more of the amino acid residues in the favored positions, are considered to be reliable in modelling experiments. Thus, these results indicate that our models were optimal.

When all S-RNases were super positioned, the P. domestica S-RNase structure contained an additional extended loop, which was either not present or was much shorter than in the remaining SI S-RNases. When we aligned the amino acid sequences of the P. domestica S-RNase and the SI P. domestica S-RNase, we found that this long loop was associated with 17 amino acid residues (magenta loop in Fig 5) located between the conserved domains RC4 and C5 and corresponding to the sequence KRHSAQTKSGPKPLLLH. Zooming in on this 3D model structure revealed a very small loop found in the SI RNase allele in P. domestica, which had only 7 amino acids in that region of the gene (cyan loop; Fig 5).

Fig 5

Stereo representation (a), ribbon diagram (b) and Ramachandran plot (c) of modeled structure of P. domestica S-RNase (magenta), and P. domestica SI-RNase (cyan), showing secondary structural elements and surfaces.

Discussion

In this work, we report phenotypic expression of SI/SC and the isolation and characterization of novel S-RNase alleles in thirty-five genotypes of the hexaploid P. domestica. Also, we report on allelic variation within the SFB pollen part gene in the same selections of P. domestica.

Self-compatibility in P. domestica

To determine the status of self (in)compatibility in prunes, bagged branches and self-pollinations in the lab were conducted for three years. The phenotypes of the twelve selections were consistent using the two approaches. Pollen tube growth has been considered a clear indication of the compatibility of any pollination as it is independent of the environment where the study is done as in all cases the results have been unequivocal [51]. However, fruit set evaluation in the field is subject to many environmental hazards in spite of being the most natural approach to the real self-compatibility level of any genotype [2]. To our knowledge, this research represents the first study in P. domestica to evaluate self-compatibility for three years.

Pollen tube growth observations were robust during the three consecutive years, however, the overall number of fruit set was slightly lower in 2020 than in 2018 and 2019. It has been reported in other species such as almond and tomato, that environment may strongly affect fruit set [2, 52]. Although we observed a reduced fruit set in 2020, the sets obtained showed the ability of the flowers to set fruit with their own pollen. The studies conducted in the field show the most reliable response since they reflect the natural conditions for pollination.

Detection of S-RNase alleles

Self-incompatibility has been extensively studied in the most important diploid Prunus species, including Japanese plum, cherry, apricot and almond [19, 21, 22, 26, 41]. For initial S allele genotyping, we used SFB primers and consensus primers that amplified the S-RNase gene. These molecular markers of S-RNase and SFB loci have commonly been utilized to study the genetics of self-incompatibility in other Prunus species. For the S-RNase pistil component, we obtained reliable amplifications only with the PruC2-PCER primer combination that had been developed in sweet cherry [41]. Similar results were described by [36], where, out of all the primers tested, the PruC2-PCER primer combination was the most successful. Some of the other conserved primers were developed in almond, subgenus Amygdalus, suggesting possible low transferability to the subgenus Prunus. Although [33] suggested that primers spanning the 2nd intron, such as PruC2, were not very informative in P. domestica due to a narrow range of amplification fragments, we were able to amplify up to five different fragments per sample. Our results agreed with previous S-genotyping analyses which revealed a high number of amplified fragments in prune by using the same primer combination [34].

We compared our S-genotyping results with phenotypical evaluations in the field and observations of pollen tube growth in pistils after self-pollinations under the microscope. In total, we detected seventeen different S-RNase alleles, one of which (S) was common and exclusive to all SC phenotypes among the thirty-five prune cultivars. The alleles we detected included the RNase of the three haplotypes (S, S and S) reported by [33]. The most frequent alleles among our tested selections were S, S, S, S and S17 which, based on the blast analysis, had high similarities with alleles described in P. salicina, P. persica and P. virginiana. Although the similarity of our alleles was high when compared to other species (between 95% and 98%), we observed several indels and nucleotide differences. Thus, our results suggest that they can be considered as new alleles within the Rosaceae. Only the three alleles reported in P. domestica by [33] plus the alleles S and S that were 100% identical to SRNase and SRNase in P. salicina, have been previously published in the NCBI GenBank.

Approximately one third of the total cultivars and selections we analyzed (31.5%) were self-compatible and could be detected with a new molecular designed to amplify the S allele (F11S-38, G5N-35, G16N-19, D3-39, 3-8E-46RR, Improved French, Sutter, F13S-46, Muir Beauty, 29C, and H13S-58). Many of these selections have their origin in Improved French, which is well known to be a SC variety and so these selections could have inherited the S allele in common. Self (in)compatibility in polyploid species is likely to be considerably more complex than in diploids. The breakdown of SI in polyploid members of the Solanaceae results from competitive interaction among S alleles, such that heteroallelic pollen grains (those containing two different pollen S alleles) are compatible with stylar tissue regardless of its genetic composition [28]. However, a relationship between polyploidy and increased SC is not likely to be a general rule. Indeed, genotypic variation in SI/SC expression in the tetraploid P cerasus provides strong evidence that SC is not determined by ploidy in this species [30]. Our data with the hexaploid P. domestica, showing a mix of SI and SC genotypes, supports this latter observation that polyploidy per se is not the cause of SC in these polyploid Prunus species. The breakdown of SI in Improved French has not been investigated and could have several origins, including stylar S RNase, and pollen SFB mutations, or factors external to the S-locus. We found a 300bp fragment of the SFB intron that was associated with the SC selections and correlated with the S17 RNase allele. Therefore, we cannot speculate whether the loss of SI among our selections of P. domestica may be caused by stylar or pollen mutations. Mutations in the SFB gene appear to be most common in SC diploid Prunus species e.g. P. armeniaca [17, 19], P. mume [53] and P. avium [18] whereas both stylar and pollen part mutations have been reported to cause breakdown of SI in the polyploid P. cerasus [54, 55]. SC may also be determined by a factor external to the S locus. This was suggested by [20] for the variety Cristobalina of P. avium and recent molecular studies have detected a putative modifier region. Interestingly, in Cristobalina, self-fertilized pollen tube growth is slower than cross-fertilized, suggesting a form of partial SC [20]. A modifier gene mediating the pollen part conferring SC has also been detected in Prunus armeniaca [24, 25] and in Prunus dulcis, where some genotypes lacking the SC allele had a self-compatible phenotype in the field [21].

S-RNase relationships among Prunus species including putative parents of hexaploid P. domestica

The sequence differences that we detected at the S-RNase locus agree with the hypothesis that new S-alleles may be generated by the accumulation of point mutations within the female component [56]. These genetic variations can arise from gene mutations, or from genetic recombination near introns, as suggested by [57], leading to alterations in gene activity or protein function. We found high sequence similarity (≥ 95%) for S-RNase alleles with a range of species in the genus Prunus, suggesting orthologous alleles. The ML phylogenetic tree showed no evidence that alleles detected in P. domestica were more closely associated with those of the putative parents, P. spinosa and P cerasifera than with any other of the Prunus species studied. The P. domestica alleles were spread across the phylogeny, consistent with trans-specific origins described by [58] and others [54, 55], although, as pointed out by [59], the allele origins in Prunus are not as ancient as in some other groups, such as the Solanaceae.

3-D structure of S-RNase alleles

We used PYMOL to visualize the 3-D structure of amino acid residues within the S-RNase gene. It has been proposed that loops in 3D structures serve to link α-helices and β-strands, and that longer loops could be susceptible to proteolytic degradation. The general functional differences among 3D almond SC and SI RNases involved an extended loop in the S-RNase [60, 61]. Furthermore, the main structural difference found in the three-dimensional models generated in this study between the SC and SI P. domestica proteins resided in the presence and length of the loop within the conserved domains RC4 and C5. When we analyzed the modeled SC proteins for the S-RNase of P. salicina, S-RNase of P. avium and S-RNase of P. armeniaca, the three 3D structures also presented the same loop pattern and were similar in length to the SC P. domestica. The protein structure of the SI RNases of P. spinosa and P. cerasifera either lacked this loop., or the loop was shorter than that of the SC alleles in P. avium, P. armeniaca, P. dulcis or P. domestica. Variation in the number, lengths, and positions of α-helices, β sheets and loops seems to contribute to functional differences among S-RNases in Prunus. Although it is unknown if this long loop has a direct effect on autogamy in plants, it is interesting that all the SC S-RNases in Prunus share this unique feature.

Conclusion

This study describes for the first time a large number of S-RNase alleles in the hexaploid P. domestica. S-genotyping, cloning and sequencing allowed us to identify and characterize 17 S-RNase alleles, of which 13 are considered new and can be used for orchard design and selection of parental genotypes in prune breeding programs. In addition, our study describes for the first time the association and design of a molecular marker for self-compatibility in P. domestica. Our phylogenetic tree showed that the S-alleles, are spread across the phylogeny, indicating trans-specific origin. Three-dimensional S-RNase structures were analyzed for the first time in plum, cherry, apricot as well as in P. cerasifera and P. spinosa.

S alleles, species name and accession number for each sequence obtained from NCBI used for the construction of the phylogenetic tree in Fig 4.

(DOCX)

Click here for additional data file.

(PDF)

Click here for additional data file.

23 Mar 2021

PONE-D-21-08430

Evaluation of the S-locus in Prunus domestica, characterization, phylogeny and 3D modelling

PLOS ONE

Dear Dr. Fernandez i Marti,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by May 07 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

Jen-Tsung Chen, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2.  Thank you for stating in your Funding Statement:

"This research was supported, in part, by the California Prune Board. "

Please provide an amended statement that declares *all* the funding or sources of support (whether external or internal to your organization) received during this study, as detailed online in our guide for authors at http://journals.plos.org/plosone/s/submit-now.  Please also include the statement “There was no additional external funding received for this study.” in your updated Funding Statement.

Please include your amended Funding Statement within your cover letter. We will change the online submission form on your behalf.

3. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide.

4. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: No

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: In the current study, the authors have characterized the S-locus in Prunus domestica. Further, its phylogeny and 3D modelling have also been carried out. Overall, I do not see any major issue with the experimentation. However, only a few points can be addressed before further consideration.

� Line 47-52, please support your statements with vital reference(s).

� Line 771/Table 1, remove “S” from the end of the caption, and define SC/SI in the table caption or as a footnote.

� Currently, I could not find any information for MW407935- MW407936. Please follow the journal policy regarding data availability.

� Line 307, could you please provide us with microscopic images (within text or suppl. figure) of the pollen tube behavior in pistils.

� Figure 3 quality is very poor (96 dpi), and the text is not clearly visible. Please provide an image with a higher resolution.

� It would be nice to add the Ramachandran plot in figure 4 together with 3D models.

� During the screening, I found that several sentences are very similar to previous publications. The authors must rephrase the plagiarized text. Please see the attached report.

Reviewer #2: In this study, one of the important aspects of self-incompatible plant breeding has been investigated. Although the results are small, but enough innovation is provided.

Some comments and suggestions:

- Add references to the first paragraph of introduction.

- Introduction is so long, so I suggest to remove/merge some sentences.

- Discussion needs to improve.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Submitted filename: Reviewer.pdf

Click here for additional data file.

20 Apr 2021

Dear Editor:

I am re-submitting the manuscript “Evaluation of the S-locus in Prunus domestica, characterization, phylogeny and 3D modelling” by Sarah Castro, Ted DeJong, Richard Dodd and myself for publication in Plos One.

We have followed all the reviewer’s suggestions and attached the new documents as requested by the journal.

“This research was funded in part from grants to RSD from the California Dried Plum Board (PN-17-18) and the Innovative Genomics Institute (Dodd2017RPIL). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. There was no additional external funding received for this study”.

We hope that you will find the study interesting and within the scope of Plos One.

Thanking you very much for your attention.

RESPONSE TO REVIEWERS

Reviewer #1: In the current study, the authors have characterized the S-locus in Prunus domestica. Further, its phylogeny and 3D modelling have also been carried out. Overall, I do not see any major issue with the experimentation. However, only a few points can be addressed before further consideration.

� Line 47-52, please support your statements with vital reference(s).

Done. We have added two new references.

� Line 771/Table 1, remove “S” from the end of the caption, and define SC/SI in the table caption or as a footnote.

Done. We have added the definition of SC/SI

� Currently, I could not find any information for MW407935- MW407936. Please follow the journal policy regarding data availability.

Done. We have request to NCBI to make our sequences publicly available and now are open to everyone.

� Line 307, could you please provide us with microscopic images (within text or suppl. figure) of the pollen tube behavior in pistils.

Included a new picture (Picture 1) and labelled the rest following the new order.

� Figure 3 quality is very poor (96 dpi), and the text is not clearly visible. Please provide an image with a higher resolution.

Done. Picture improved at 300dpi and tiff format

� It would be nice to add the Ramachandran plot in figure 4 together with 3D models.

Done. We have added a new Ramachandran plot in figure 5(c).

� During the screening, I found that several sentences are very similar to previous publications. The authors must rephrase the plagiarized text. Please see the attached report.

Done, we have removed and edited new sentences.

Reviewer #2: In this study, one of the important aspects of self-incompatible plant breeding has been investigated. Although the results are small, but enough innovation is provided.

Some comments and suggestions:

- Add references to the first paragraph of introduction.

Done. We have added two new references.

- Introduction is so long, so I suggest to remove/merge some sentences.

Done. We have e followed the reviewer advice and have shortened the introduction

- Discussion needs to improve.

The reviewer requested improvement to the Discussion without any further details. We have taken a close look and made a few changes including some reorganization that we feel makes the manuscript stronger and clearer

Submitted filename: Response to Reviewers.docx

Click here for additional data file.

26 Apr 2021

Evaluation of the S-locus in Prunus domestica, characterization, phylogeny and 3D modelling

PONE-D-21-08430R1

Dear Dr. Fernandez i Marti,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Jen-Tsung Chen, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The authors have addressed all the reviewer comments. Notably, the MS has been improved and ready for acceptance. Thus, I am endorsing the current version for publication in Plos One.

Congratulations and best wishes for future publications!

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

4 May 2021

PONE-D-21-08430R1

Evaluation of the S-locus in Prunus domestica, characterization, phylogeny and 3D modelling

Dear Dr. Fernandez i Marti:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Jen-Tsung Chen

Academic Editor

PLOS ONE