Guo-Yi Liu1, Yan Wu1, Fan-Yi Kong2, Shu Ma2, Li-Yan Fu2, Jia Geng1. 1. Department of Neurology, The First Affiliated Hospital of Kunming Medical University, Kunming, Yunnan Province, P R China. 2. Department of Neurology, 920th Hospital of Logistics Support Force, People's Liberation Army. No. 212, Kunming, Yunnan Province, P R China.
Abstract
Multiple sclerosis (MS) is a complex, progressive neuroinflammatory disease associated with autoimmunity. Currently, effective therapeutic strategy was poorly found in MS. Experimental autoimmune encephalomyelitis (EAE) is widely used to study the pathogenesis of MS. Cumulative research have shown that bone marrow mesenchymal stem Cells (BMSCs) transplantation could treat EAE animal models, but the mechanism was divergent. Here, we systematically evaluated whether BMSCs can differentiate into neurons, astrocytes and oligodendrocytes to alleviate the symptoms of EAE mice. We used Immunofluorescence staining to detect MAP-2, GFAP, and MBP to evaluate whether BMSCs can differentiate into neurons, astrocytes and oligodendrocytes. The effect of BMSCs transplantation on inflammatory infiltration and demyelination in EAE mice were detected by Hematoxylin-Eosin (H&E) and Luxol Fast Blue (LFB) staining, respectively. Inflammatory factors expression was detected by ELISA and RT-qPCR, respectively. Our results showed that BMSCs could be induced to differentiate into neuron cells, astrocytes and oligodendrocyte in vivo and in vitro, and BMSCs transplanted in EAE mice were easier to differentiate than normal mice. Moreover, transplanted BMSCs reduced neurological function scores and disease incidence of EAE mice. BMSCs transplantation alleviated the inflammation and demyelination of EAE mice. Finally, we found that BMSCs transplantation down-regulated the levels of pro-inflammatory factors TNF-α, IL-1β and IFN-γ, and up-regulated the levels of anti-inflammatory factors IL-10 and TGF-β. In conclusion, this study found that BMSCs could alleviate the inflammatory response and demyelination in EAE mice, which may be achieved by the differentiation of BMSCs into neurons, astrocytes and oligodendrocytes in EAE mice.
Multiple sclerosis (MS) is a complex, progressive neuroinflammatory disease associated with autoimmunity. Currently, effective therapeutic strategy was poorly found in MS. Experimental autoimmune encephalomyelitis (EAE) is widely used to study the pathogenesis of MS. Cumulative research have shown that bone marrow mesenchymal stem Cells (BMSCs) transplantation could treat EAE animal models, but the mechanism was divergent. Here, we systematically evaluated whether BMSCs can differentiate into neurons, astrocytes and oligodendrocytes to alleviate the symptoms of EAE mice. We used Immunofluorescence staining to detect MAP-2, GFAP, and MBP to evaluate whether BMSCs can differentiate into neurons, astrocytes and oligodendrocytes. The effect of BMSCs transplantation on inflammatory infiltration and demyelination in EAE mice were detected by Hematoxylin-Eosin (H&E) and Luxol Fast Blue (LFB) staining, respectively. Inflammatory factors expression was detected by ELISA and RT-qPCR, respectively. Our results showed that BMSCs could be induced to differentiate into neuron cells, astrocytes and oligodendrocyte in vivo and in vitro, and BMSCs transplanted in EAE mice were easier to differentiate than normal mice. Moreover, transplanted BMSCs reduced neurological function scores and disease incidence of EAE mice. BMSCs transplantation alleviated the inflammation and demyelination of EAE mice. Finally, we found that BMSCs transplantation down-regulated the levels of pro-inflammatory factors TNF-α, IL-1β and IFN-γ, and up-regulated the levels of anti-inflammatory factors IL-10 and TGF-β. In conclusion, this study found that BMSCs could alleviate the inflammatory response and demyelination in EAE mice, which may be achieved by the differentiation of BMSCs into neurons, astrocytes and oligodendrocytes in EAE mice.
Multiple sclerosis (MS) is a chronic neuroinflammatory disease that is associated with autoimmunity in central nervous system (CNS) [1,2]. Generally speaking, it is characterized by axon damage, demyelination, inflammatory infiltration and progressive neurological damage, eventually leading to disability [3]. Moreover, MS is thought to be a multifocal demyelination disease in CNS [4]. Currently, MS mainly depends on three types of drug treatment: disease-modifying drugs (DMD) specifically designed for MS, corticosteroids for acute exacerbations, and drugs for symptomatic control. However, it is less evident that drugs are effective in the progression of MS [5]. Thus, to find an effective therapeutic strategy is very important for MS in clinical. Experimental autoimmune encephalomyelitis (EAE) is widely used to study the pathogenesis of MS, which represents both pathological and features of MS [6]. To some extent, EAE could effectively elucidate various pathological processes in MS, such as inflammation demyelination, axonal lesions [7]. Bone marrow mesenchymal stem Cells (BMSCs) are non-hematopoietic stromal cells that derived from bone marrow [8]. BMSCs differentiate into various cell types, which contribute to regeneration of tissues [9-11]. BMSCs also play immunomodulatory role through inhibiting T-cell activities [12]. In addition, BMSCs secrete growth factors to regulate hematopoietic stem/progenitor cell proliferation and differentiation [13]. Recently, some researchers have shifted the focus to stem cell-based therapy in many diseases, including nervous system disease, indicating that stem cell may be potentially amenable to therapeutic manipulation for clinical application of MS [14,15]. In the acute and subacute phases, the tissues were selectively target damaged by intravenous injection of BMSCs, which improved the recovery of neurological function, decreased inflammatory response and demyelination after EAE [16]. However, whether BMSCs have a therapeutic effect on EAE mice through differentiation remains to be studied. In addition, it is now recognized that the interaction of neurons, astrocytes and oligodendrocytes plays an important regulatory role in remyelination and the development of and MS [17,18]. Therefore, we explored whether the transplanted BMSCs can differentiate into neurons, astrocytes and oligodendrocytes to alleviate the development of MS. In our research, we found that BMSCs could differentiate into neurons, astrocytes and oligodendrocytes in vivo and in vitro, and transplanted BMSCs could alleviate the inflammatory response and demyelination of EAE mice, and improve clinical symptoms.
Materials and methods
Animal
Male C57BL/6 mice aged 8–10 weeks were purchased from Kunming Medical University. The mice were housed in sterile, constant temperature rooms at Kunming Medical University with a 12 h/12 h light/dark cycle, with free access to food and water. All animal experiments were conducted according to the ARRIVE guidelines, and were performed in accordance with Ethics Committee of Kunming Medical University and approved by Ethics Committee of Kunming Medical University. All measures had been taken to minimize the suffering of animals. Compared to the starting point of EAE immunization, no animal lost more than 20% of its body weight and no neurological score exceeded 4. The health of the mice was monitored at least once a day, and no accidental deaths were observed. Euthanasia was carried out in a CO2 chamber, gradually filled with CO2 before 4 of mice neurological score, and then bled. All animal facility staff and researchers had followed required courses and obtained certificates to conduct animal research.
Isolation and identification of primary BMSCs
According to the method of Gao et al. [19], BMSCs were isolated from male mice anesthetized (1% sodium pentobarbital, 40 mg/kg intraperitoneal injection). After being disinfected with 75% alcohol, the femur and tibia were obtained by removing the surface muscles and fascia. Bone marrow was then obtained by rinsing with Hanks solution. After 5 min of centrifugation at 170 g, BMSCs at the bottom of the centrifuge tube were remixed evenly with Hanks solution. Followed by 5 min of centrifugation at 1050 g to obtained BMSCs. Isolated BMSCs were cultured at 37°C and 5% CO2 with DMEM/F12 medium (Gibco, USA) containing 10% fetal bovine serum (FBS; Gibco, USA), 100 U/ml penicillin and 100 U/ml streptomycin. In our previous study, we have evaluated phenotype of BMSCs by flow cytometric analysis. To directly track BMSC differentiation in vivo, the BMSCs were labeled with a lentiviral vector encoding enhanced GFP (Cyagen, USA). Briefly, BMSCs (5×103 cells/cm2) were incubated in 6-well plates for 24 h. Then the culture medium was removed and concentrated viral supernatant diluted in serum-free α-MEM was added. Eight hours later, the viral supernatant was replaced with complete culture medium. G418 (100 μg/ml) was used to purify the GFP-positive cells.
EAE model
Mice were randomly divided into NC, NC+BMSCs, EAE and EAE+BMSCs groups, with 15 mice in each group. Mice of EAE and EAE+BMSCs groups performed EAE modeling. In short, Mice were immunized subcutaneously with 200 μg MOG35-55 (peptide sequence: Met-Glu-Val-Gly-Trp-Tyr-Arg-Ser-Pro-Phe-Ser-ArgVal-Val-His-Leu-Tyr-Arg-Asn-Gly-Lys; MedChem Express, US) peptide emulsified in complete Freund’s adjuvant (Sigma, USA) containing Mycobacterium tuberculosis H37Ra (BD Biosciences, USA) on 0 day. Then mice were injected intravenously with 300 ng Pertussis Toxin (Millipore, USA) both immediately after immunization and 2 days later. In 8 days post-EAE induction, BMSCs were injected into the lateral ventricle (Start with the dura mater; before and after the halogen: 0.6 mm; opening: 1.5 mm; depth: 1.7 mm) of mice of NC+BMSCs and EAE+BMSCs groups by brain stereotactic technology.
Induced BMSCs to differentiate into neurons, astrocytes and oligodendrocytes
BMSCs from the fifth generation were seeded in 6-well plates coated with poly ornithine and laminin at a density of 2×105 cells/mL. After 24 h, DMEM/F12 medium performs the following replacements. For neuron induction, it was replaced with DMEM/F12 medium contained 20% FBS, 6 mM β-Mercaptoethanol, 20 ng/ml bFGF, 1.7 μM rhSHH, 100 ng/ml FGF-8, 0.3 μg/ml all-trans retinoic acid. After 14 d, it was replaced with differentiation maintenance solution (DMEM/F12 medium contained 1%N2 and 2% B27). For astrocyte induction, it was replaced with NS medium contained 2% B27, 2 mM glutamine, 50 U/ml penicillin, 50 μg/ml streptomycin and 60 μg/ml T3. After 14 d, it was replaced with differentiation maintenance solution. For oligodendrocyte induction, it was replaced with NS medium contained 2% B27, 2 mM glutamine, 50 U/ml penicillin, 50 μg/ml streptomycin and 60 μg/ml T3. The complete culture medium was changed every 2 to 3 days. BMSCs in control group were not induced. After 21 days, the induced neurons, astrocytes and oligodendrocytes were harvested for follow-up experiments.
Clinical signs measurement
During the in vivo experiment, the weight, neurobehavioral score and disease incidence of the mice were monitored by two independent observers in a blind manner until the 36th day after immunization. The neurobehavioral score is defined by the following scale: no clinical symptoms = 0; wobbled gait or loss of tail tension = 1; tail weakness, hind limb weakness = 2; hind limb paralysis = 3; hind limb paralysis, forelimb paralysis or Forelimb weakness with bowel dysfunction = 4; dying or death = 5; the symbol between them is ±0.5 [20]. In our preliminary experiments, the peak of the disease is from the 9th to the 15th day after immunization. After 16th days after immunization, the mice were euthanized by cervical dislocation. We collected serum from the mice and took cortex and hippocampus of brain tissues and lumbar spinal cord for the following experiments.
Immunofluorescence staining (IF)
After fixed with 4% paraformaldehyde, differentiated BMSCs and brain frozen section (10 μm) were penetrated with PBS containing 0.4% Triton X-100. Then, the cells/brain sections were blocked with 5% bovine serum albumin (BSA; Beijing; China) at room temperature for 1 h. The primary antibodies were incubated overnight at 4°C. The secondary antibodies with fluorophores (1:1000, KPL) were incubated at 4°C for 1 h. Then, nuclei staining with DAPI followed by capturing using a microscope (Olympus, Japan). We calculated the ratio of BMSCs to differentiate into neurons, astrocytes and oligodendrocytes, respectively. The primary antibodies were shown in Table 1.
Table 1
Primary antibodies.
Primary antibodies
Company
Dilution
MAP-2
Abcam
1:600
βIII-tubulin
Abcam
1:400
GFAP
Abcam
1:300
MBP
Abcam
1:400
O4
Sigma
1:500
Luxol Fast Blue staining (LFB)
Spinal cord sections of Lumbar spine were placed in a xylene solution for gradient hydration. Then, the sections were put into Luxol fast blue dye solution (Sigma, USA) in a 50–65°C incubator overnight. Stained sections were taken out and passed through alcohol, water, and then added the color separation solution. Sections were washed 3 times with water after differentiation, and then counterstained or gradient dehydrated., Each mice analyzed 3 histological sections and calculated the average score in our experiment. Standard score for the degree of demyelination: none = 0; rare lesions = 1; demyelination of a few areas = 2; demyelination of large areas or fusion areas = 3 [21].
Hematoxylin-Eosin staining (H&E)
The mice were perfused with normal saline and 4% paraformaldehyde through the blood vessel. The lumbar spinal cord was fixed with 4% paraformaldehyde for 24 h, embedded in paraffin, and cut into 4–5 μm thick sections. H&E staining was performed according to the manufacturer’s instructions to assess the degree of inflammatory cell infiltration. In our experiment, each mice analyzed 3 histological sections and calculated the average score. Standard scores for the degree of inflammatory infiltration: no infiltrating cells = 0; a small amount of scattered infiltrating cells = 1; inflammatory infiltrating tissue around blood vessels = 2; extensive perivascular scar infiltration = 3 [21].
RNA extraction and Real-time quantitative PCR (RT-PCR)
According to the instructions, total RNA of cells and brain tissues were extracted using Trizol Reagent (Lifetech, USA). We followed the instructions of the FastKing RT Kit (Fermentas; Shanghai, China) to synthesize the first strand of cDNA. Then, we performed quantitative PCR by SYBR Green master mix (KAPA; Shanghai, China). The primers were designed using beacon designer 7.90. The primer sequences were listed in Table 2. All experimental results were analyzed by 2-ΔΔCt method.
Table 2
Primer sequences.
Gene
Sequence (5’~3’)
Company
GFAP
AATCACAAGGTCACAAGA
Invitrogen
GGCGTTCCATTTACAATC
βIII tubulin
TCAAGATGTCCTCCACCTT
Invitrogen
GTGAACTGCTCGGAGATG
MAP-2
AAGGTGAACAAGAGAAAGA
Invitrogen
GAGAAGGAGGCAGATTAG
MBP
ACTATAAATCGGCTCACAAG
Invitrogen
AGCGACTATCTCTTCCTC
O4
CCTTGTTGCCACCATCTG
Invitrogen
CATACAGGGAGTAGCCAAAG
GAPDH
AAAGGGTCATCATCTCTG
Invitrogen
GCTGTTGTCATACTTCTC
ELISA assay
The levels of inflammatory factors TNF-α, IL-1β and IFN-γ, and anti-inflammatory factors IL-10 and TGF-β were detected by ELISA. According to the instructions of ELISA Kit (R&D Systems, USA), the supernatant was collected by centrifugation homogenate (5000rpm for 15 minutes at 4°C). The levels of TNF-α, IL-1β, IFN-γ, IL-10 and TGF-β were determined by ELISA Kit. We constructed standard curves by standard samples. Quantification of ELISA results were performed at 450 nm using an ELISA plate reader (Spectra Max 190, Molecular Devices, USA).
Statistical analysis
GraphPad Prism 7 software (GraphPad, USA) was used to conduct statistical analysis. One-way ANOVA and t test were used to analyze data. Data were presented as mean ± standard deviation (SD) and P value<0.05 were considered as significant results.
Results
Identification of primary BMSCs
Before the BMSCs experiment, we used an inverted phase contrast microscope and flow cytometry to detect the morphology and marker expression levels to identify BMSCs. Observed under an inverted phase contrast microscope, the BMSCs cells of the P1 generation adhered to the wall and presented a polygonal shape. After growing to the P3 generation, the overall BMSCs cells showed a swirl shape at high density, while BMSCs cells gradually showed a fibroblast-like spindle shape at low density (Fig 1A). The above observation results are consistent with the basic morphological characteristics of BMSCs. Furthermore, we detected the levels of BMSCs related markers CD29, CD90, CD34 and CD45 by flow cytometry. The result showed that cultured BMSCs expressed positive CD29+ (94.55±1.67%) and CD90+ (94.67±1.88%), and negative CD34- (1.43±0.19%) and CD45- (0.83±0.08%) on the surface of BMSCs (Fig 1B). All the results were consistent with the previous studies [22,23].
Fig 1
Identification of primary BMSCs.
(A) High density and low density of P1 and P3 BMSCs morphology was assessed by an inverted phase contrast microscope. Original magnification: 100×. (B) CD29, CD34, CD45 and CD90 surface marker expression of BMSCs was determined by flow cytometry.
Identification of primary BMSCs.
(A) High density and low density of P1 and P3 BMSCs morphology was assessed by an inverted phase contrast microscope. Original magnification: 100×. (B) CD29, CD34, CD45 and CD90 surface marker expression of BMSCs was determined by flow cytometry.
BMSCs were induced to differentiate into neurons, astrocytes and oligodendrocytes
To verify that BMSCs can differentiate into neurons, astrocytes and oligodendrocytes, we induced the culture of BMSCs, and used IF and RT-qPCR to detect the expression level of neurons markers (MAP-2 and βIII-tubulin), astrocytes markers (GFAP) and oligodendrocytes markers (MBP and O4), respectively. The results of IF showed that MAP-2 and βIII-tubulin were expressed in BMSCs cultured in neurons induction medium (Fig 2A). GFAP was expressed in BMSCs cultured in astrocytes induction medium (Fig 2C). MBP and O4 were expressed in BMSCs cultured in oligodendrocytes induction medium (Fig 2E), and the differentiation ratio of BMSCs was above 95%. In addition, the RT-qPCR results showed that compared with the NC group treated with PBS, the expression levels of MAP-2 and βIII-tubulin in the Induced neurons group (Fig 2B), GFAP in the Induced astrocytes group (Fig 2D), and MBP and O4 in the Induced neurons group (Fig 2F) significantly upregulated. It could be seen from the above experimental results that BMSCs could be induced to differentiate into neurons, astrocytes and oligodendrocytes in vitro.
Fig 2
BMSCs were induced to differentiate into neurons, astrocytes and oligodendrocytes.
Respectively, 21 days after the induction of BMSCs, IF staining was performed to detected the position and level of (A) neurons (MAP-2 and βIII-tubulin), (C)astrocytes (GFAP), and (E) oligodendrocytes marks (MBP and O4). Scale bar = 20 μm. The expression levels of (B) MAP-2 and βIII-tubulin, (D) GFAP, (F) MBP and O4 mRNA were detected by RT-qPCR. In all cases, Values are mean ± SD (n = 3 for each group; **P<0.01, ***P<0.001).
BMSCs were induced to differentiate into neurons, astrocytes and oligodendrocytes.
Respectively, 21 days after the induction of BMSCs, IF staining was performed to detected the position and level of (A) neurons (MAP-2 and βIII-tubulin), (C)astrocytes (GFAP), and (E) oligodendrocytes marks (MBP and O4). Scale bar = 20 μm. The expression levels of (B) MAP-2 and βIII-tubulin, (D) GFAP, (F) MBP and O4 mRNA were detected by RT-qPCR. In all cases, Values are mean ± SD (n = 3 for each group; **P<0.01, ***P<0.001).
The transplanted BMSCs differentiated into neurons, astrocytes and oligodendrocytes in the EAE mice
To verify that BMSCs can differentiate into neurons, astrocytes and oligodendrocytes in vivo, we transplanted GFP-labeled BMSCs into EAE mice model by brain stereotactic technology, and observed the differentiation of BMSCs in hippocampus and cortex through IF. As shown in Fig 3A, the GFP fluorescence signal could be observed in NC+BMSCs and EAE+BMSCs group, while the NC and EAE group had no GFP fluorescence signal at all. In addition, after merge, it was found that the expression positions of MAP-2, GFAP and MBP overlap with the fluorescent signal positions of GFP in the hippocampus and cortex of NC+BMSCs and EAE+BMSCs groups. It is indicated that transplanted BMSCs could differentiate into neurons, astrocytes and oligodendrocytes in the normal and EAE mice. Furthermore, we conducted a statistical analysis of the IF results and found that the fluorescence intensities of MAP-2, GFAP and MBP in the hippocampus and cortex of EAE+BMSCs group were significantly higher than those in EAE group, and there was no significant difference between NC and NC+BMSCs groups (Fig 3B). Further, we analyzed the differentiation of BMSCs. The results showed that the relatively differentiated BMSCs in the EAE+BMSCs group were significantly higher than NC+BMSCs (Fig 3C). It is suggested that the transplanted BMSCs could increase the number of neurons, astrocytes and oligodendrocytes in the hippocampus and cortex in EAE model. This result was at least partly due to the differentiation of BMSCs into neurons, astrocytes and oligodendrocytes.
Fig 3
The transplanted BMSCs differentiated into neurons, astrocytes and oligodendrocytes in the EAE mice.
On the 16th day post-immunization, the mice of each group were euthanized. (A) IF staining exhibited the position and level of GFP with MAP-2, GFAP and MBP in hippocampus and cortex. Scale bar = 20 μm. The green arrows indicated neurons, astrocytes and oligodendrocytes differentiated by BMSCs. (B) The result of MAP-2, GFAP and MBP fluorescence intensity were analyzed by Image J software. (C) In the NC+BMSCs and EAE+BMSCs groups, relative proportion of BMSCs differentiated into neurons, astrocytes and oligodendrocytes, respectively. In all cases, Values are mean ± SD (n = 15 for each group; **P<0.01, ***P<0.001).
The transplanted BMSCs differentiated into neurons, astrocytes and oligodendrocytes in the EAE mice.
On the 16th day post-immunization, the mice of each group were euthanized. (A) IF staining exhibited the position and level of GFP with MAP-2, GFAP and MBP in hippocampus and cortex. Scale bar = 20 μm. The green arrows indicated neurons, astrocytes and oligodendrocytes differentiated by BMSCs. (B) The result of MAP-2, GFAP and MBP fluorescence intensity were analyzed by Image J software. (C) In the NC+BMSCs and EAE+BMSCs groups, relative proportion of BMSCs differentiated into neurons, astrocytes and oligodendrocytes, respectively. In all cases, Values are mean ± SD (n = 15 for each group; **P<0.01, ***P<0.001).
Effect of BMSCs transplantation on clinical signs during EAE progression in mice
To determine whether the differentiation of BMSCs can alleviate the clinical symptoms of EAE, we performed disease incidence analysis, neurobehavioral score and weight measurement on EAE mice and BMSCs transplanted EAE mice. A higher neurobehavioral score indicates worsening of motor dysfunction. Higher disease incidence and lower body weight indicate an increase in disease severity. The line chart shown that, in 10th-15th post-immunization, mice in the EAE group was large-scale disease, and in 15th post-immunization mice, all mice in the EAE group became sick. In the EAE+BMSCs group, mice begin to develop symptoms from the 14th day post-immunization, and the onset of the mice tended to be stable from the 21st day post-immunization (Fig 4A and 4B). The neurobehavioral score of the EAE group increased rapidly after immunization, and reached a peak on the 18th day, and BMSCs treatment could significantly reduce the neurobehavior score of the EAE in mice (Fig 4C). Furthermore, the mice weight was decreased significantly on the 10th day after immunization in the EAE group. Interestingly, the body weight of mice had been showing an upward trend in the EAE+BMSCs group (Fig 4D). In summary, the differentiation of transplanted BMSCs could alleviate clinical signs during EAE progression in mice.
Fig 4
Effect of BMSCs transplantation on clinical signs and histological changes during EAE progression in mice.
The body weight and clinical scores of all of mice were assessed daily according to the same criteria for 35 continuous days. (A) Percentage disease-free, (B) disease incidence, (C) clinical scores and (D) body weight, were monitored. On the 16th day post-immunization, (E) H&E staining was used to observe inflammatory infiltration in the lumbar spinal cord of mice, and result of inflammation score. Scale bar = 500 or 100 μm. The yellow arrow indicated inflammatory cell infiltration. (F) LFB staining showed demyelination in the lumbar spinal cord of mice, and result of demyelination score. Scale bar = 500 or 100 μm. The black arrow indicated demyelination. In all cases, Values are mean ± SD (n = 15 for each group; ***P<0.001).
Effect of BMSCs transplantation on clinical signs and histological changes during EAE progression in mice.
The body weight and clinical scores of all of mice were assessed daily according to the same criteria for 35 continuous days. (A) Percentage disease-free, (B) disease incidence, (C) clinical scores and (D) body weight, were monitored. On the 16th day post-immunization, (E) H&E staining was used to observe inflammatory infiltration in the lumbar spinal cord of mice, and result of inflammation score. Scale bar = 500 or 100 μm. The yellow arrow indicated inflammatory cell infiltration. (F) LFB staining showed demyelination in the lumbar spinal cord of mice, and result of demyelination score. Scale bar = 500 or 100 μm. The black arrow indicated demyelination. In all cases, Values are mean ± SD (n = 15 for each group; ***P<0.001).
Effect of BMSCs transplantation on histological changes during EAE progression in mice
Mice was euthanasia on the 16th day after immunization, collected the lumbar spinal cord tissues of mice for histological analysis to analyze the progression of the disease at the level of CNS damage. The results of H&E (Fig 4E) and LFB (Fig 4F) shown the inflammatory cell infiltration and demyelination status of mice. The results shown that a lot of inflammatory cells gathered around the small blood vessels in the lumbar spinal cord of the EAE group, and the degree of demyelination of the lumbar spinal cord of the EAE group was significantly higher. However, after BMSCs transplantation, the degree of infiltration of inflammatory cells in the lumbar spinal cord of the EAE+BMSCs group was alleviated, and the degree of demyelination was also significantly reduced. Moreover, In the NC and NC+BMSCs groups, the inflammation and demyelination scores of the mice spinal cord were both 0. It could be seen that BMSCs transplantation could alleviate the infiltration of inflammatory cells and demyelination in the EAE mice.
Effect of BMSCs transplantation on inflammatory factor expression during EAE progression in mice
In the development of MS, TNF-α, IL-1β and IFN-γ played important roles in infiltration of inflammatory cells and demyelination, while IL-10 and TGF-β could alleviate the progression of MS. Therefore, we detected the expression levels of these inflammatory factors in the serum of mice by ELISA, and further detected their mRNA expression in spinal cord tissue by RT-qPCR. ELISA results shown that in the EAE group, the levels of TNF-α, IL-1β and IFN-γ were significantly up-regulated, whereas IL-10 and TGF-β levels exhibited an opposite pattern. After BMSCs transplantation, the levels of TNF-α, IL-1β, IFN-γ, IL-10 and TGF-β were restored. There was no significant difference in the levels of these inflammatory factors in NC and NC+BMSCs groups (Fig 5A). As expected, RT-qPCR results shown that, compared with NC and NC+BMSCs groups, mRNA expression of TNF-α, IL-1β and IFN-γ in the EAE group were significantly up-regulated, while mRNA expression of IL-10 and TGF-β was significantly decreased. Moreover, the transplanted BMSCs could restore expression of these mRNAs in the spinal cord of mice (Fig 5B). These results were consistent with previous results of alleviating inflammation.
Fig 5
Effect of BMSCs transplantation on inflammatory factor expression during EAE progression in mice.
On the 16th day post-immunization, (A) ELISA was performed to detected the levels of pro-inflammatory factors (TNF-α, IL-1β and IFN-γ) and anti-inflammatory factors (IL-10 and TGF-β) of mice serum of each group. (B) RT-qPCR indicated the expression of TNF-α, IL-1β, IFN-γ, IL-10 and TGF-β mRNA of mice spinal cord of each group. In all cases, Values are mean ± SD (n = 15 for each group; **P<0.01, ***P<0.001).
Effect of BMSCs transplantation on inflammatory factor expression during EAE progression in mice.
On the 16th day post-immunization, (A) ELISA was performed to detected the levels of pro-inflammatory factors (TNF-α, IL-1β and IFN-γ) and anti-inflammatory factors (IL-10 and TGF-β) of mice serum of each group. (B) RT-qPCR indicated the expression of TNF-α, IL-1β, IFN-γ, IL-10 and TGF-β mRNA of mice spinal cord of each group. In all cases, Values are mean ± SD (n = 15 for each group; **P<0.01, ***P<0.001).
Discussion
MS is a complex neuroinflammatory disease caused by local inflammation and immune dysfunction, leading to demyelination and extensive mononuclear cell infiltration [24-26]. Generally speaking, MS is considered as a disease of central nervous system involved in CD4+ T lymphocytes, including Th1 and Th17 [27,28]. Although the etiology still unclear, increasing evidence showed that genetic and environmental factors were associated with MS [29,30]. It is well known that the complex pathogenesis of MS mainly includes demyelination and inflammation [31]. Transplantation or remyelination could promote the recovery of neurological function of EAE [32,33]. However, the transplantation of stem cells is the focus on the clinical treatment of MS [34,35].Increasing evidences have demonstrated that BMSCs promoted remyelinate axons and neurological function recovery in EAE animal model [36]. However, the mechanism of differentiation of BMSCs on EAE animal models remains to be studied. Myelination is carried out by oligodendrocytes in the central nervous system. Myelination is a modified expanded glial membrane that wraps around axons to achieve rapid saline-alkali nerve conduction and axon integrity [37]. Oligodendrocytes are derived from oligodendrocyte progenitor cells (OPC), and oligodendrocytes hold the capacity to proliferate, migrate and differentiate into myelinating oligodendrocytes. After demyelination, OPC is recruited to differentiate into myelinated oligodendrocytes, which then act on remyelination to protect axons from degeneration [38]. Therefore, oligodendrocytes are of great significance for remyelination. Astrocytes originate from neural embryonic progenitor cells arranged in the embryonic neural tube cavity [39]. It is currently recognized academically that astrocytes can support the function of oligodendrocytes. As early as 1984, studies have shown that type 1 astrocytes could expand O-2A progenitor cells from the optic nerve of newborn rats [40]. Later, Bhat and Pfeiffer observed [41] that extracts from astrocytes-rich cultures stimulated the differentiation of oligodendrocytes, thus supporting the concept that astrocytes played an active role in myelination. In addition, astrogliosis is one of the pathological features of MS. Astrocytes regulate the integrity of the blood brain barrier (BBB) by regulating the transport of peripheral immune cells [42], and can secrete a large number of chemokines and cytokines with pleiotropic functions [43], which lays an active role in promoting demyelination. So, this study investigated whether the transplanted BMSCs can differentiate into neurons, astrocytes and oligodendrocytes to affect the inflammatory invasion and demyelination of EAE mice. However, intravenous injection of BMSCs could not across the BBB, which is a key problem in the future. In the present study, BMSCs were injected into the lateral ventricle to detect the markers of oligodendrocytes, neurons and astrocytes. We found that BMSCs could be induced to differentiate into neurons, astrocytes and oligodendrocytes in vitro and in vivo. Furthermore, BMSCs transplantation alleviated clinical signs, infiltration of inflammatory cells and demyelination of EAE mice, and down-regulated the expression levels of pro-inflammatory factors TNF-α, IL-1β and IFN-γ, while increasing the expression level of anti-inflammatory factors IL-10 and TGF-β. Although stem cell transplantation is advanced, the success rate of stem cell transplantation is relatively low [44]. Some studies have evaluated the effect of stem cell transplantation on the clinical treatment of MS [45-47]. Thus, improving the success rate of stem cell transplantation could be used as a means of clinical treatment of MS.Although in this study, we lacked the specific mechanism of neurons, astrocytes and oligodendrocytes differentiated by BMSCs for the treatment of MS. As discussed earlier, neurons, astrocytes and oligodendrocytes are beneficial for MS treatment, which indicates that at least part of the improvement of MS by transplanted BMSCs is due to differentiation into neurons, astrocytes and oligodendrocytes in vivo. As for the specific mechanism, it will be the focus of our future research.
Conclusion
In conclusion, this study found that BMSCs could alleviate the inflammatory response and demyelination in EAE mice, which may be achieved by the differentiation of BMSCs into neurons, astrocytes and oligodendrocytes in EAE mice.
Plos one humane endpoints checklist.
(DOCX)Click here for additional data file.
Ethical approval.
(ZIP)Click here for additional data file.15 Jan 2021PONE-D-20-34923BMSCs differentiated into neurons, astrocytes and oligodendrocytesalleviatedthe inflammation and demyelination of EAE mice modelsPLOS ONEDear Dr.Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.Please submit your revised manuscript by 15 days. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsWe look forward to receiving your revised manuscript.Kind regards,Rosanna Di Paola, MDAcademic EditorPLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf2. Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please delete it from any other section.3. Please ensure that you refer to Figure 5 in your text as, if accepted, production will need this reference to link the reader to the figure.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: PartlyReviewer #2: Partly**********2. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: I Don't KnowReviewer #2: Yes**********3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: YesReviewer #2: No**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: YesReviewer #2: No**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: The authors suggest that MSCs injected into the lateral ventricle in mice immunized to elicit MOG peptide EAE become neurons, astrocytes, and oligodendrocytes, and suppress clinical and histological EAE. This would be interesting, but there are, unfortunately, a number of flaws in experimental design and data presentation that decrease enthusiasm for this manuscript,a) There is no control group in which MSCs were injected into unimmunized mice,b) The method by which the MSCs were labeled prior to transplantation is not detailed.c( The numbers of mice in the EAE experiments are not specified.d) A MOG peptide EAE model in which all untreated mice died by day 17 post-immunization is most unusual, and deserves explanation. It is possible that what the authors meant to show in Figure 4A is the % of mice that got sick, not the percent that survived, since it is clear from Figures 4B and 4C that many mice survived, and it is specified in the text that no mouse became sicker than grade 4.e) The immunohistological data presented in Figure 3A-C are poorly presented and hence are difficult to interpret. Furthermore, where those sections were in the CNS is not specified.f) The histological section shown for EAE in Figure 4E appear to have been damagedReviewer #2: BMSCs differentiated into neurons, astrocytes and oligodendrocytes alleviated the inflammation and demyelination of EAE mice models by Gen et. al. The authors tackle an important and unmet area of multiple sclerosis. In this study, stem cells differentiated into CNS cells (neurons, oligodendrocytes and astrocytes) were injected intracerebrally to show that 1) viable transplanted cells were retained within the CNS, 2) the procedure modulated the systemic inflammatory response, and 3) resulted in amelioration of the EAE clinical phenotype. The concept of the study is innovative and novel. However, there are several issues that need to be addressed before it can be considered for publication.1) Overall the experimental details are missing, which makes it hard for the reviewer to evaluate the findings and interpretations. Although the authors cited previous publications on stem cell culture and differentiation, details on how the stem cells were harvested, number of seeding cells, differentiation and monitoring procedures, % differentiation, time of harvest were missing. Immunolabeling for cell-specific markers (GFAP, O4, etc) were done, however, the authors also failed to functionally characterize the differentiated cells. In addition, presence of transplanted cells were shown by IHC but the location, whether they were integrated and /or functional was unclear. In addition, the number of cells transplanted and when during the EAE disease course, the percentage of total injected cells retained within the CNS, the ratio of differentiated neurons, astrocytes and oligodendrocytes were not mentioned.2) Blurry figures and figure legends lacking details. Photomicrographs also lack scale bars, arrow, etc.3) Proper controls are lacking (non-EAE, BMSC injection).4) Gender of EAE mice was not mentioned. However, BMSCs from male mice only were harvested and the rationale was not explained.5) Pertussis toxin is usually injected twice at day 0 and day 2 in MOG35-55-immunized EAE model. Authors also included a third injection at day 7. Please explain the rationale.6) EAE is an immune model where the immuno-pathogenesis initiates in the peripheral immune system. Please explain how CNS injection of differentiated stem cells modulate the systemic immune response as shown by down regulation of pro-inflammatory circulating cytokine.**********6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.12 Mar 2021Titled: BMSCs differentiated into neurons, astrocytes and oligodendrocytes alleviated the inflammation and demyelination of EAE mice modelsManuscript Number: PONE-D-20-34923Journal: PLOS ONEDear Editors and Reviewers:On behalf of my co-authors, we thank you very much for giving us an opportunity to revise our manuscript, we appreciate editor and reviewers very much for their positive and constructive comments and suggestions on our manuscript entitled “BMSCs differentiated into neurons, astrocytes and oligodendrocytes alleviated the inflammation and demyelination of EAE mice models”. Those comments are all valuable and helpful for revising and improving our paper, as well as the important guiding significance to our researches. We have studied comments carefully and have made correction which we hope meet with approval. Revised portion are marked in RED in the paper. The main corrections in the paper and the responds to the reviewer’s comments are as followings:Journal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdfRE: Thanks for your comment. We have revised it according to PLOS ONE's Style Requirements.2. Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please delete it from any other section.RE: Thank you for reminding me. We have deleted the Ethics Statement outside the Methods section.3. Please ensure that you refer to Figure 5 in your text as, if accepted, production will need this reference to link the reader to the figure.RE: We have added the corresponding position of Figure 5 to the manuscript Result section. Thanks again for the warm reminder.Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: PartlyReviewer #2: Partly2. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: I Don't KnowReviewer #2: Yes3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: YesReviewer #2: No4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: YesReviewer #2: NoReview Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: The authors suggest that MSCs injected into the lateral ventricle in mice immunized to elicit MOG peptide EAE become neurons, astrocytes, and oligodendrocytes, and suppress clinical and histological EAE. This would be interesting, but there are, unfortunately, a number of flaws in experimental design and data presentation that decrease enthusiasm for this manuscript,a) There is no control group in which MSCs were injected into unimmunized mice,RE: Thanks for your comments. In in vivo, we added experiments in the NC group (unimmunized mice) and NC+BMSCs group (BMSCs injected into unimmunized mice). Please see Fig.3, Fig.4 and Fig.5 for details. Moreover, the corresponding parts in the manuscript have also been revised.b) The method by which the MSCs were labeled prior to transplantation is not detailed.RE: Thanks, we have already supplemented these contents in the Materials and Methods, please see line 115-121.c) The numbers of mice in the EAE experiments are not specified.RE: We shown in the Materials and Methods (line 123-124) and figure legend (line 497-534) that we have 15 mice in each group. Thank you very much for your advice.d) A MOG peptide EAE model in which all untreated mice died by day 17 post-immunization is most unusual, and deserves explanation. It is possible that what the authors meant to show in Figure 4A is the % of mice that got sick, not the percent that survived, since it is clear from Figures 4B and 4C that many mice survived, and it is specified in the text that no mouse became sicker than grade 4.RE: We are very grateful for your correction, and Figure 4A is a major carelessness. As you said, Figure 4A shows a ‘Percentage disease-free’. We have corrected the figure and the corresponding text (line 265-270). Thanks again for your comment.e) The immunohistological data presented in Figure 3A-C are poorly presented and hence are difficult to interpret. Furthermore, where those sections were in the CNS is not specified.RE: Thank you very much for your valuable comments. Firstly, we reformatted Figure 1-5 with AI, which will make Figure more conducive to observation, and marked the location of the staining is the hippocampus and cortex. Secondly, due to the addition of NC and NC+BMSCs groups, we analyzed the differentiation of BMSCs into neurons, astrocytes and oligodendrocytes in the NC+BMSCs and EAE+BMSCs groups, and found that under EAE conditions, BMSCs are easier to differentiate into neurons, astrocytes and oligodendrocytes in vivo (Figure 4C). At the same time, we also analyzed the difference in fluorescence intensity of each cell marker in each group (Figure 4B). These results explain to a certain extent that the differentiation of BMSCs is of positive significance in EAE treatment.f) The histological section shown for EAE in Figure 4E appear to have been damagedRE: We have replaced Figure 4E. However, maybe we sliced and cut a bit thinly, or severe spinal cord injury in the EAE group. The tissue was somewhat incomplete in all our slices of EAE group. The replaced photomicrograph is the most complete one we can find. Thanks again for your comments during your busy schedule.Reviewer #2: BMSCs differentiated into neurons, astrocytes and oligodendrocytes alleviated the inflammation and demyelination of EAE mice models by Gen et. al. The authors tackle an important and unmet area of multiple sclerosis. In this study, stem cells differentiated into CNS cells (neurons, oligodendrocytes and astrocytes) were injected intracerebrally to show that 1) viable transplanted cells were retained within the CNS, 2) the procedure modulated the systemic inflammatory response, and 3) resulted in amelioration of the EAE clinical phenotype. The concept of the study is innovative and novel. However, there are several issues that need to be addressed before it can be considered for publication.1) Overall the experimental details are missing, which makes it hard for the reviewer to evaluate the findings and interpretations. Although the authors cited previous publications on stem cell culture and differentiation, details on how the stem cells were harvested, number of seeding cells, differentiation and monitoring procedures, % differentiation, time of harvest were missing. Immunolabeling for cell-specific markers (GFAP, O4, etc) were done, however, the authors also failed to functionally characterize the differentiated cells. In addition, presence of transplanted cells were shown by IHC but the location, whether they were integrated and /or functional was unclear. In addition, the number of cells transplanted and when during the EAE disease course, the percentage of total injected cells retained within the CNS, the ratio of differentiated neurons, astrocytes and oligodendrocytes were not mentioned.RE: We have supplemented the specific steps of BMSCs differentiation in the method section, please see line 135-148.Since funds have been exhausted, we cannot perform functional characterization of differentiated cells. At present, we can only achieve that BMSCs can differentiate into neurons, astrocytes and oligodendrocytes in vitro.Regarding ‘presence of transplanted cells were shown by IHC but the location, whether they were integrated and /or functional was unclear’, this is also a question we have been thinking about. As we all know, neurons, astrocytes and oligodendrocytes have positive significance for remyelination and nerve damage repair in MS treatment. Therefore, we proved that BMSCs can differentiate into these three kinds of cells in vivo, which shows that the transplantation of BMSCs can play a positive role in the treatment of MS in this way. Although we have not studied the specific mechanism, this is what we will explore later.Regarding ‘the number of cells transplanted and when during the EAE disease course, the percentage of total injected cells retained within the CNS, the ratio of differentiated neurons, astrocytes and oligodendrocytes were not mentioned’, we have been trying to solve this problem before. However, due to financial and technological constraints, we can only study to this point. We can only know how many cells we have transplanted, but we do not have the technology to assess how many cells in the CNS are retained or differentiated. In addition, due to the addition of NC and NC+BMSCs groups, we analyzed the differentiation of BMSCs into neurons, astrocytes and oligodendrocytes in the NC+BMSCs and EAE+BMSCs groups, and found that under EAE conditions, BMSCs are easier to differentiate into neurons, astrocytes and oligodendrocytes in vivo (Figure 4C). At the same time, we also analyzed the difference in fluorescence intensity of each cell marker in each group (Figure 4B). These results explain to a certain extent that the differentiation of BMSCs is of positive significance in EAE treatment.In short, the main purpose of this article is to explain that the MS therapeutic effect of BMSCs transplantation is achieved at least in part by differentiation into neurons, astrocytes and oligodendrocytes. As for the specific mechanism, it will be the focus of our future research.Thank you for pointing out the flaws in our article, which is also a question we have been thinking about. We have done our best to make the revision. Thanks again.2) Blurry figures and figure legends lacking details. Photomicrographs also lack scale bars, arrow, etc.RE: Thank you very much for your valuable comments. Firstly, we reformatted Figure 1-5 with AI, which will make Figure more conducive to observation. Moreover, we have enriched the content in Figure legend to show more details. There is scale bar in Photomicrographs, but they are a bit small. Secondly, we used arrows to mark the main observation positions of Photomicrographs.3) Proper controls are lacking (non-EAE, BMSC injection).RE: Thanks for your comments. In in vivo, we added experiments in the NC group (unimmunized mice) and NC+BMSCs group (BMSCs injected into unimmunized mice). Please see Fig.3, Fig.4 and Fig.5 for details. Moreover, the corresponding parts in the manuscript have also been revised.4) Gender of EAE mice was not mentioned. However, BMSCs from male mice only were harvested and the rationale was not explained.RE: We added the gender of the mice in line 92, that all our experiments use male mice. Moreover, we have supplemented the specific process of BMSCs isolation in the method section (line 106-121). Thank you for your valuable suggestions.5) Pertussis toxin is usually injected twice at day 0 and day 2 in MOG35-55-immunized EAE model. Authors also included a third injection at day 7. Please explain the rationale.RE: Thanks for your correction. This due to the ambiguous description of our method, and we have already revised it, please see line 123-133.6) EAE is an immune model where the immuno-pathogenesis initiates in the peripheral immune system. Please explain how CNS injection of differentiated stem cells modulate the systemic immune response as shown by down regulation of pro-inflammatory circulating cytokine.RE: Thanks again for your comments during your busy schedule. As we said before, we do not have enough funds to support this article to conduct deeper mechanism research. We admit that the current article does have many flaws, but this is also something that point the way for our future research.Submitted filename: Response to Reviewers.docxClick here for additional data file.27 Apr 2021BMSCs differentiated into neurons, astrocytes and oligodendrocytes alleviated the inflammation and demyelination of EAE mice modelsPONE-D-20-34923R1Dear Dr.We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.Kind regards,Rosanna Di Paola, MDAcademic EditorPLOS ONEAdditional Editor Comments (optional):Reviewers' comments:30 Apr 2021PONE-D-20-34923R1BMSCs differentiated into neurons, astrocytes and oligodendrocytes alleviated the inflammation and demyelination of EAE mice modelsDear Dr. Geng:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.If we can help with anything else, please email us at plosone@plos.org.Thank you for submitting your work to PLOS ONE and supporting open access.Kind regards,PLOS ONE Editorial Office Staffon behalf ofDr. Rosanna Di PaolaAcademic EditorPLOS ONE