Yiqiang Sun1, Xia Wang2, Guoyong Fu3, Xiaopeng Geng1. 1. Department of Spine, The Affiliated Hospital of Binzhou Medical University, Binzhou 256603, P.R. China. 2. Health Management Center, Binzhou People's Hospital, Binzhou 256613, P.R. China. 3. Department of Pediatric Surgery, The Affiliated Hospital of Binzhou Medical University, Binzhou 256603, P.R. China.
Abstract
Intervertebral disc degeneration (IVDD) is a multifactorial pathological process associated with low back pain in which nucleus pulposus cell senescence is disrupted. Increasing evidence reveals that IVDD can be modulated by microRNAs (miRNAs or miRs). In the current study, we set out to elucidate the role of miR-199a-5p in nucleus pulposus cell apoptosis and IVDD progression. After sample collection, we found highly expressed miR-199a-5p in nucleus pulposus tissues of both patients diagnosed with IVDD and in IVDD rat models. Next, normal and degenerated nucleus pulposus cells were isolated and transfected with miR-199a-5p mimic, miR-199a-5p inhibitor, overexpressed sirtuin 1 (oe-SIRT1), and oe-p21, followed by detection of nucleus pulposus cell apoptosis and proliferation. In addition, the binding of miR-199a-5p and SIRT1, the interaction between p21 and SIRT1, and the regulation of p21 acetylation by SIRT1 were analyzed. We found that miR-199a-5p overexpression promoted nucleus pulposus cell apoptosis and IVDD. Overexpression of SIRT1 countered the effect of miR-199a-5p overexpression, while overexpression of p21 reversed the effect of miR-199a-5p silencing. Also, miR-199a-5p inhibited SIRT1, promoted p21 acetylation, and upregulated p21 expression, thus accelerating nucleus pulposus cell apoptosis and IVDD. Overall, miR-199a-5p promotes nucleus pulposus cell apoptosis and IVDD by suppressing SIRT1-dependent deacetylation of p21.
Intervertebral disc degeneration (IVDD) is a multifactorial pathological process associated with low back pain in which nucleus pulposus cell senescence is disrupted. Increasing evidence reveals that IVDD can be modulated by microRNAs (miRNAs or miRs). In the current study, we set out to elucidate the role of miR-199a-5p in nucleus pulposus cell apoptosis and IVDD progression. After sample collection, we found highly expressed miR-199a-5p in nucleus pulposus tissues of both patients diagnosed with IVDD and in IVDD rat models. Next, normal and degenerated nucleus pulposus cells were isolated and transfected with miR-199a-5p mimic, miR-199a-5p inhibitor, overexpressed sirtuin 1 (oe-SIRT1), and oe-p21, followed by detection of nucleus pulposus cell apoptosis and proliferation. In addition, the binding of miR-199a-5p and SIRT1, the interaction between p21 and SIRT1, and the regulation of p21 acetylation by SIRT1 were analyzed. We found that miR-199a-5p overexpression promoted nucleus pulposus cell apoptosis and IVDD. Overexpression of SIRT1 countered the effect of miR-199a-5p overexpression, while overexpression of p21 reversed the effect of miR-199a-5p silencing. Also, miR-199a-5p inhibited SIRT1, promoted p21 acetylation, and upregulated p21 expression, thus accelerating nucleus pulposus cell apoptosis and IVDD. Overall, miR-199a-5p promotes nucleus pulposus cell apoptosis and IVDD by suppressing SIRT1-dependent deacetylation of p21.
Intervertebral disc degeneration (IVDD), triggered by an imbalance between catabolism and anabolism in discs, is defined as a process featured with phenotypic and genotypic alternations. In addition, IVDD is featured by severely declining quality of life, as patients are known to suffer from lower back pain and even disability. Unfortunately, IVDD is prevalent in the working age class, posing a great hazard to societies across the globe, yet currently available biomedical treatments remain ineffective at treating long-term IVDD and are marred by numerous side effects. Intervertebral discs usually comprise three main parts, including cartilage endplates, nucleus pulposus, and annulus fibrosus, and gradually degenerate as one grows older because of cell death and microenvironment alternation. In light of this, a better understanding of the unique phenotypes of nucleus pulposus cells could prove beneficial to development of cell-based as well as biological therapeutic strategies.4, 5, 6MicroRNAs (miRNAs or miRs), highly conserved molecules with the ability to mediate protein levels at a post-transcriptional level, have been recognized to be of importance in multiple musculoskeletal disorders, including IVDD. More notably, specific manipulation of miRNAs has been demonstrated to be implicated in the mediation of biological behaviors of nucleus pulposus cells, including processes such as differentiation, proliferation, migration, and apoptosis, throughout the development of IVDD. One such miRNA, namely miR-199a-5p, has been found to be highly expressed in lumbar IVDD in association with the grade of the degeneration, while the underlying regulatory mechanism remains understudied. According to initial bioprediction results obtained in the current study using the TargetScan website, sirtuin 1 (SIRT1) was revealed to contain miR-199a-5p binding sites, which is highly suggestive of its role as a target gene of miR-199a-5p. SIRT1 is a deacetylase involved in the consumption of nicotinamide adenine dinucleotide (NAD)+, and it is implicated in genome stability maintenance, gene regulation, apoptosis, autophagy, senescence, proliferation, and tumorigenesis. Moreover, SIRT1 has been highlighted to confer protective effects against IVDD, whereby activation of SIRT1 can curb nucleus pulposus cell senescence and apoptosis while enhancing cell proliferation. Additionally, silencing of SIRT1 can also facilitate the apoptosis of nucleus pulposus cells by functioning as a target gene of miR-182-5p. Moreover, studies have found that SIRT1-deficient mice exhibit upregulated expressions of p21 in osteoarthritis. Current knowledge suggests that p21 functions as a well-established cell cycle inhibitor and anti-proliferative effector in normal cells, which has been mostly associated with p53 protein since p53-independent pathways lead to p21 induction. Also, reduced p21 levels induced by Bmi-1 are known to possess the potential to attenuate the progression of IVDD. Based on the aforementioned evidence, we hypothesized that miR-199a-5p might be involved in the mediation of the nucleus pulposus cell apoptotic pathway via SIRT1-mediated p21, thus playing a regulatory role in the progression of IVDD. To confirm this hypothesis, we performed a series of experiments to investigate the correlation between miR-199a-5p, SIRT1, and p21 and characterize their roles in IVDD progression in enrolled IVDD-diagnosed patients and established rat IVDD models.
Results
miR-199a-5p is highly expressed in nucleus pulposus tissues from IVDD patients
Aberrant miRNA expressions are associated with various musculoskeletal diseases, and they further play an important role in the pathogenesis of IVDD. In addition, a recent study documented increased expression levels of miR-199a-5p during the process of disc degeneration. In the current study, we first analyzed the expression pattern of miR-199a-5p in nucleus pulposus tissue samples from 48 IVDD patients and normal tissue samples from 48 patients with idiopathic scoliosis with the help of quantitative reverse-transcriptase polymerase chain reaction (qRT-PCR). Subsequent results illustrated that miR-199a-5p was highly expressed in nucleus pulposus tissues of IVDD patients relative to normal nucleus pulposus tissues (Figure 1A). In addition, hematoxylin and eosin (H&E) staining analysis of the nucleus pulposus tissues from IVDD patients (Figure 1B) demonstrated that, in the IVDD group, the number of vacuolar cells in the nucleus pulposus tissue was increased, whereas there was apparent nuclear atrophy and fibrous hyperplasia. Safranin O staining revealed that the content of proteoglycan was also decreased in the IVDD group. Furthermore, a terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end-labeling (TUNEL) assay illustrated that apoptosis was increased in the nucleus pulposus tissues of the IVDD group compared with the control group (Figure 1C). The above results indicated that miR-199a-5p was abundantly expressed in nucleus pulposus tissues of IVDD patients.
Figure 1
miR-199a-5p is highly expressed in nucleus pulposus tissues from IVDD patients
(A) miR-199a-5p expression was detected by qRT-PCR in nucleus pulposus tissue samples from IVDD patients (n = 48) and normal tissue samples from idiopathic scoliosis patients (n = 48). (B) Pathological changes of human nucleus pulposus tissues analyzed by H&E (original magnification, ×200) and Safranin O staining (original magnification, ×400). (C) Cell apoptosis in nucleus pulposus tissues was analyzed by TUNEL staining (original magnification, ×400). Data are shown as mean ± standard deviation of three technical replicates and analyzed by an unpaired t test. ∗p < 0.05 with statistical significance. N = 6 for rats in each group.
miR-199a-5p is highly expressed in nucleus pulposus tissues from IVDD patients(A) miR-199a-5p expression was detected by qRT-PCR in nucleus pulposus tissue samples from IVDD patients (n = 48) and normal tissue samples from idiopathic scoliosis patients (n = 48). (B) Pathological changes of human nucleus pulposus tissues analyzed by H&E (original magnification, ×200) and Safranin O staining (original magnification, ×400). (C) Cell apoptosis in nucleus pulposus tissues was analyzed by TUNEL staining (original magnification, ×400). Data are shown as mean ± standard deviation of three technical replicates and analyzed by an unpaired t test. ∗p < 0.05 with statistical significance. N = 6 for rats in each group.
Silencing of miR-199a-5p inhibits rat nucleus pulposus cell apoptosis and IVDD in vivo and in vitro
To further elucidate the effect of miR-199a-5p on rat nucleus pulposus cells, we determined the effects of miR-199a-5p downregulation on apoptosis, proliferation, and pathological changes of nucleus pulposus cells in vitro. First, qRT-PCR results of miR-199a-5p expression patterns depicted that miR-199a-5p was highly expressed in the IVDD + inhibitor negative control (NC) group compared with the normal group. Compared with the IVDD + inhibitor NC group, the miR-199a-5p expression was found to be decreased in the IVDD + miR-199a-5p inhibitor group (Figure 2A). Meanwhile, the results of flow cytometry revealed that nucleus pulposus cells from the IVDD + inhibitor NC group presented with increased apoptosis compared with that in the normal group, while apoptosis was decreased more in the IVDD + miR-199a-5p inhibitor group than that in the IVDD + inhibitor NC group (Figure 2B). In addition, western blot analysis results of apoptosis-associated proteins (cleaved caspase-3, B cell lymphoma 2 [Bcl-2]-associated X protein [Bax], and Bcl-2) showed that the expression levels of cleaved caspase-3 and Bax were elevated, while those of Bcl-2 were decreased in the IVDD + inhibitor NC group compared with the normal group. However, following inhibition of miR-199a-5p, expression levels of cleaved caspase-3 and Bax were decreased but those of Bcl-2 were increased (Figure 2C). Moreover, Cell Counting Kit-8 (CCK-8) assay and western blot analysis results displayed that the IVDD + inhibitor NC group presented with reduced proliferation of nucleus pulposus cells as well as decreased expression levels of proliferation-related proteins Ki-67 and proliferating cell nuclear antigen (PCNA) relative to the normal group, whereas these levels were found to be increased in the IVDD + miR-199a-5p inhibitor group when compared with those in the IVDD + inhibitor NC group (Figures 2D and 2E).
Figure 2
miR-199a-5p silencing inhibits rat nucleus pulposus cell apoptosis and arrests IVDD in vivo and in vitro
(A) miR-199a-5p expression determined by qRT-PCR in miR-199a-5p-transfected nucleus pulposus cells. (B) Cell apoptosis by flow cytometry in miR-199a-5p-transfected nucleus pulposus cells. (C) Expression of cleaved caspase-3, Bax, and Bcl-2 determined by western blot analysis in miR-199a-5p-transfected nucleus pulposus cells. (D) Cell proliferation detected by a CCK-8 assay in miR-199a-5p-transfected nucleus pulposus cells. (E) Expression of Ki-67 and PCNA determined by western blot analysis in miR-199a-5p-transfected nucleus pulposus cells. (F) miR-199a-5p expression determined by qRT-PCR in nucleus pulposus tissues of IVDD rats treated with miR-199a-5p antagomir. (G) Cell apoptosis in rat nucleus pulposus tissues detected by TUNEL staining in the presence of miR-199a-5p antagomir. (H) Expression of cleaved caspase-3, Bax, and Bcl-2 determined by western blot analysis in rat nucleus pulposus tissues of IVDD rats treated with miR-199a-5p antagomir. Data are shown as mean ± standard deviation of three technical replicates. Three parallel samples were examined. Data among multiple groups were analyzed by one-way ANOVA with a Tukey’s test, while those at different time points were analyzed by two-way ANOVA. ∗p < 0.05 with statistical significance. N = 6 for rats in each group.
miR-199a-5p silencing inhibits rat nucleus pulposus cell apoptosis and arrests IVDD in vivo and in vitro(A) miR-199a-5p expression determined by qRT-PCR in miR-199a-5p-transfected nucleus pulposus cells. (B) Cell apoptosis by flow cytometry in miR-199a-5p-transfected nucleus pulposus cells. (C) Expression of cleaved caspase-3, Bax, and Bcl-2 determined by western blot analysis in miR-199a-5p-transfected nucleus pulposus cells. (D) Cell proliferation detected by a CCK-8 assay in miR-199a-5p-transfected nucleus pulposus cells. (E) Expression of Ki-67 and PCNA determined by western blot analysis in miR-199a-5p-transfected nucleus pulposus cells. (F) miR-199a-5p expression determined by qRT-PCR in nucleus pulposus tissues of IVDD rats treated with miR-199a-5p antagomir. (G) Cell apoptosis in rat nucleus pulposus tissues detected by TUNEL staining in the presence of miR-199a-5p antagomir. (H) Expression of cleaved caspase-3, Bax, and Bcl-2 determined by western blot analysis in rat nucleus pulposus tissues of IVDD rats treated with miR-199a-5p antagomir. Data are shown as mean ± standard deviation of three technical replicates. Three parallel samples were examined. Data among multiple groups were analyzed by one-way ANOVA with a Tukey’s test, while those at different time points were analyzed by two-way ANOVA. ∗p < 0.05 with statistical significance. N = 6 for rats in each group.Furthermore, we established rat models of IVDD and silenced the expression of miR-199a-5p in the models to detect the regulation of miR-199a-5p on IVDD. Subsequent results of qRT-PCR demonstrated that miR-199a-5p was highly expressed in the IVDD + antagomir NC group compared with the normal group. Meanwhile, compared with the IVDD + antagomir NC group, decreased expression levels of miR-199a-5p were noted in the IVDD + antagomir group (Figure 2F). Moreover, TUNEL staining results showed that silencing miR-199a-5p reduced the apoptosis of nucleus pulposus cells (Figure 2G). Furthermore, western blot analysis clarified that the expression levels of cleaved caspase-3 and Bax were significantly increased, while those of Bcl-2 were decreased in the IVDD + antagomir NC group compared to those in the normal group. Compared with the IVDD + antagomir NC group, the expression levels of cleaved caspase-3 and Bax were reduced, and those of Bcl-2 were increased in the IVDD + miR-199a-5p antagomir group (Figure 2H). These results demonstrated that silencing of miR-199a-5p could inhibit disc degeneration and apoptosis of rat nucleus pulposus cells in vivo and in vitro.
SIRT1 is a target gene of miR-199a-5p
It is well known that silencing of histone deacetylase SIRT1 can promote the apoptosis of nucleus pulposus cells; meanwhile, prediction results from the TargetScan database indicated the presence of binding sites between miR-199a-5p with SIRT1 in humans and rats (Figure 3A). We thus proposed a hypothesis that miR-199a-5p might be involved in the regulation of nucleus pulposus cell apoptosis via regulation of the expression of SIRT1. Subsequent results from immunohistochemistry analysis displayed that SIRT1 was poorly expressed in IVD tissue samples of 48 IVDD patients (Figure 3B). Western blot analysis also revealed a decline in SIRT1 expression levels in the nucleus pulposus tissues of IVDD rats (Figure 3C). Compared with the normal group, decreased SIRT1 expression levels were further observed in the IVDD + antagomir NC group, while being increased in the nucleus pulposus tissues of the IVDD + miR-199a-5p antagomir group (Figure 3D). In addition, isolated rat nucleus pulposus cells were found to exhibit a spindle or multiple-angle morphology under a high-power microscope (Figure S1A). Meanwhile, immunocytochemistry showed the presence of type I collagenase, type II collagenase, and MMP2 expressions in the nucleus pulposus cells, and that the expression levels of type I collagenase and MMP2 were increased, while those of type II collagenase were reduced with the cell passage (Figure S1B) The above results were in line with the trend of SIRT1 expression levels before and after miR-199a-5p silencing in nucleus pulposus cells in vitro (Figure 3E). Furthermore, RNA-binding protein immunoprecipitation (RIP) experimental results showed that AGO2 pulled down more miR-199a-5 and SIRT1 compared to immunoglobulin G (IgG) (Figure 3F), highlighting the potential binding of miR-199a-5 to SIRT1. Also, results from a dual-luciferase reporter assay demonstrated that the luciferase activity of the SIRT1 wild-type (WT) was inhibited, while there were no changes in the luciferase activity of SIRT1 mutant (MUT) in HEK293T cells in the miR-199a-5p mimic group (Figure 3G). Collectively, these results indicated that miR-199a-5p targeted SIRT1 and inhibited its expression.
Figure 3
SIRT1 is a target of miR-199a-5p
(A) Binding sites of miR-199a-5p to SIRT1 in humans and rats predicted by TargetScan. (B) Immunohistochemistry analysis on the SIRT1 expression in nucleus pulposus tissue samples of 48 IVDD patients and normal tissue samples (original magnification, ×200). (C) SIRT1 protein expression detected by western blot analysis in the nucleus pulposus tissues of normal and IVDD rats. (D) SIRT1 protein expression detected by western blot analysis in nucleus pulposus tissues of IVDD rats treated with miR-199a-5p antagomir. (E) SIRT1 protein expression detected by western blot analysis in nucleus pulposus cells transfected with miR-199a-5p inhibitor. (F) The interaction between miR-199a-5 and SIRT1 was detected by RIP in nucleus pulposus cells. (G) Binding of miR-199a-5p to SIRT1 confirmed by a dual-luciferase reporter assay in HEK293T cells. Data are shown as mean ± standard deviation of three technical replicates. Three parallel samples were examined. Data between two groups were compared by an unpaired t test while those among multiple groups were analyzed by one-way ANOVA with a Tukey’s test. ∗p < 0.05 with statistical significance. N = 6 for rats in each group.
SIRT1 is a target of miR-199a-5p(A) Binding sites of miR-199a-5p to SIRT1 in humans and rats predicted by TargetScan. (B) Immunohistochemistry analysis on the SIRT1 expression in nucleus pulposus tissue samples of 48 IVDD patients and normal tissue samples (original magnification, ×200). (C) SIRT1 protein expression detected by western blot analysis in the nucleus pulposus tissues of normal and IVDD rats. (D) SIRT1 protein expression detected by western blot analysis in nucleus pulposus tissues of IVDD rats treated with miR-199a-5p antagomir. (E) SIRT1 protein expression detected by western blot analysis in nucleus pulposus cells transfected with miR-199a-5p inhibitor. (F) The interaction between miR-199a-5 and SIRT1 was detected by RIP in nucleus pulposus cells. (G) Binding of miR-199a-5p to SIRT1 confirmed by a dual-luciferase reporter assay in HEK293T cells. Data are shown as mean ± standard deviation of three technical replicates. Three parallel samples were examined. Data between two groups were compared by an unpaired t test while those among multiple groups were analyzed by one-way ANOVA with a Tukey’s test. ∗p < 0.05 with statistical significance. N = 6 for rats in each group.
miR-199a-5p promotes apoptosis of rat nucleus pulposus cells and IVDD by inhibiting SIRT1 in vivo and in vitro
To further verify whether miR-199a-5p regulates apoptosis and IVDD by inhibiting SIRT1, we co-overexpressed miR-199a-5p and SIRT1 in rat degenerative nucleus pulposus cells. Subsequent results from qRT-PCR showed that miR-199a-5p was highly expressed in the mimic + overexpression (oe)-NC group compared with the mimic NC + oe-NC group, while there were no changes in the miR-199a-5p mimic + oe-SIRT1 group relative to the miR-199a-5p mimic + oe-NC group (Figure 4A). In addition, flow cytometry analysis demonstrated that overexpression of miR-199a-5p augmented cell apoptosis, while co-overexpression of SIRT1 and miR-199a-5p partially countered this effect (Figure 4B). This particular finding was well demonstrated by western blot detection of SIRT1 and cleaved caspase-3, Bax, and Bcl-2 expression patterns in degenerative nucleus pulposus cells (Figure 4C). A CCK-8 assay further detected that overexpression of miR-199a-5p inhibited the proliferation, while the co-overexpression of SIRT1 and miR-199a-5p partially reversed this effect (Figure 4D). In addition, proliferation results were in line with the changes in the expression levels of Ki-67 and PCNA related to proliferation observed in the western blot analysis (Figure 4E). Furthermore, we repeated the above-mentioned proliferation and apoptosis experiments in isolated human degenerative nucleus pulposus cells (Figure S1) following simultaneous overexpression of SIRT1 and miR-199a-5p. The obtained findings exhibited consistency with those from rat degenerative nucleus pulposus cells (Figure S2).
Figure 4
miR-199a-5p promotes apoptosis of rat nucleus pulposus cells and IVDD by inhibiting SIRT1 in vivo and in vitro
Both miR-199a-5p and SIRT1 were overexpressed in degenerative nucleus pulposus cells and IVDD model rats, respectively. (A) miR-199a-5p expression determined by qRT-PCR in nucleus pulposus cells. (B) Cell apoptosis measured by flow cytometry. (C) Expression of SIRT1, cleaved caspase-3, Bax, and Bcl-2 detected by western blot analysis in nucleus pulposus cells. (D) Cell proliferation measured by a CCK-8 assay. (E) Expression of proliferation-related proteins Ki-67 and PCNA determined by western blot analysis in nucleus pulposus cells. IVDD rats were treated with miR-199a-5p agomir or in combination with oe-SIRT1. (F) miR-199a-5p expression determined by qRT-PCR in nucleus pulposus tissues of IVDD rats. (G) Cell apoptosis in rat nucleus pulposus tissues by TUNEL staining. (H) Expression of SIRT1, cleaved caspase-3, Bax, and Bcl-2 detected by western blot analysis in nucleus pulposus tissues of IVDD rats. Data are shown as mean ± standard deviation of three technical replicates. Three parallel samples were examined. Data among multiple groups were assessed by analyzed by one-way ANOVA with a Tukey’s test while those at different time points were analyzed by two-way ANOVA. ∗p < 0.05 with statistical significance. N = 6 for rats in each group.
miR-199a-5p promotes apoptosis of rat nucleus pulposus cells and IVDD by inhibiting SIRT1 in vivo and in vitroBoth miR-199a-5p and SIRT1 were overexpressed in degenerative nucleus pulposus cells and IVDD model rats, respectively. (A) miR-199a-5p expression determined by qRT-PCR in nucleus pulposus cells. (B) Cell apoptosis measured by flow cytometry. (C) Expression of SIRT1, cleaved caspase-3, Bax, and Bcl-2 detected by western blot analysis in nucleus pulposus cells. (D) Cell proliferation measured by a CCK-8 assay. (E) Expression of proliferation-related proteins Ki-67 and PCNA determined by western blot analysis in nucleus pulposus cells. IVDD rats were treated with miR-199a-5p agomir or in combination with oe-SIRT1. (F) miR-199a-5p expression determined by qRT-PCR in nucleus pulposus tissues of IVDD rats. (G) Cell apoptosis in rat nucleus pulposus tissues by TUNEL staining. (H) Expression of SIRT1, cleaved caspase-3, Bax, and Bcl-2 detected by western blot analysis in nucleus pulposus tissues of IVDD rats. Data are shown as mean ± standard deviation of three technical replicates. Three parallel samples were examined. Data among multiple groups were assessed by analyzed by one-way ANOVA with a Tukey’s test while those at different time points were analyzed by two-way ANOVA. ∗p < 0.05 with statistical significance. N = 6 for rats in each group.Additionally, we co-overexpressed SIRT1 and miR-199a-5p in IVDD rats. Subsequent detection of miR-199a-5p expression patterns using qRT-PCR exhibited the same results as in the in vitro experiments (Figure 4F). Meanwhile, TUNEL staining results displayed that miR-199a-5p overexpression augmented the apoptosis of nucleus pulposus cells, while co-overexpression of SIRT1 and miR-199a-5p could partially counter this effect (Figure 4G). Also, western blot analysis showed that the expression levels of cleaved caspase-3 and Bax were increased, while those of SIRT1 and Bcl-2 exhibited opposite trends in the miR-199a-5p agomir + oe-NC group compared with those in the agomir NC + oe-NC group. Compared with the miR-199a-5p agomir + oe-NC group, the expression levels of cleaved caspase-3 and Bax were reduced, while those of SIRT1 and Bcl-2 were elevated in the miR-199a-5p agomir + oe-SIRT1 group (Figure 4H). These findings all suggested that miR-199a-5p promoted apoptosis of rat nucleus pulposus cells and disc degeneration by inhibiting SIRT1 in vivo and in vitro.
miR-199a-5p increases the expression of p21 through SIRT1
It has been reported that SIRT1 can regulate the acetylation of p21. Thus, we set out to investigate the interaction between miR-199a-5p, p21, and SIRT1 in rat nucleus pulposus cells. A co-immunoprecipitation (coIP) assay and western blot analysis demonstrated that p21 and SIRT1 could interact with each other (Figure 5A). In addition, the expression levels of Ac-p21 and p21 were found to be increased in the IVDD group, while those of SIRT1 were diminished (Figure 5B). Subsequently, we overexpressed SIRT1 in nucleus pulposus cells and observed increased expression levels of SIRT1, while those of Ac-p21 and p21 were decreased (Figure 5C). In addition, following overexpression of miR-199a-5p in nucleus pulposus cells, SIRT1 expression levels were decreased, and those of Ac-p21 and p21 were increased, whereas co-overexpression of SIRT1 could reverse the trend induced by miR-199a-5p overexpression (Figure 5D). These results suggested that miR-199a-5p regulated the acetylation of p21 through SIRT1, thus increasing the expression of p21.
Figure 5
miR-199a-5p elevates the expression of p21 by regulating acetylation of p21 in nucleus pulposus cells
(A) Interaction between p21 and SIRT1 was detected by coIP and western blot analysis in nucleus pulposus cells. (B) Protein expression of Ac-p21, p21, and SIRT1 determined by western blot analysis in nucleus pulposus cells. The expression of Ac-p21 was first detected by coIP with a p21 antibody, and then acetyl-lysine expression was detected by western blot analysis. (C) Protein expression of Ac-p21, SIRT1, and p21 detected by western blot analysis after SIRT1 was overexpressed in degenerative nucleus pulposus cells transfected with oe-SIRT1. (D) Protein expression of Ac-p21, SIRT1, and p21 detected by western blot analysis in nucleus pulposus cells transfected with miR-199a-5p mimic or in combination with oe-SIRT1. Data are shown as mean ± standard deviation of three technical replicates. Three parallel samples were examined. Data between two groups were compared by an unpaired t test while those among multiple groups were analyzed by one-way ANOVA with a Tukey’s test. ∗p < 0.05 with statistical significance.
miR-199a-5p elevates the expression of p21 by regulating acetylation of p21 in nucleus pulposus cells(A) Interaction between p21 and SIRT1 was detected by coIP and western blot analysis in nucleus pulposus cells. (B) Protein expression of Ac-p21, p21, and SIRT1 determined by western blot analysis in nucleus pulposus cells. The expression of Ac-p21 was first detected by coIP with a p21 antibody, and then acetyl-lysine expression was detected by western blot analysis. (C) Protein expression of Ac-p21, SIRT1, and p21 detected by western blot analysis after SIRT1 was overexpressed in degenerative nucleus pulposus cells transfected with oe-SIRT1. (D) Protein expression of Ac-p21, SIRT1, and p21 detected by western blot analysis in nucleus pulposus cells transfected with miR-199a-5p mimic or in combination with oe-SIRT1. Data are shown as mean ± standard deviation of three technical replicates. Three parallel samples were examined. Data between two groups were compared by an unpaired t test while those among multiple groups were analyzed by one-way ANOVA with a Tukey’s test. ∗p < 0.05 with statistical significance.
Downregulation of miR-199a-5p suppresses rat nucleus pulposus cell apoptosis and IVDD via the SIRT1/p21 axis in vivo and in vitro
Lastly, in order to verify whether miR-199a-5p regulates apoptosis and IVDD through the SIRT1/p21 axis, we silenced miR-199a-5p and overexpressed p21 in rat nucleus pulposus cells. Subsequent results from qRT-PCR displayed that miR-199a-5p expression levels were decreased in the miR-199a-5p inhibitor + oe-NC group, while being unchanged in the miR-199a-5p inhibitor + oe-p21 group (Figure 6A). In addition, flow cytometric data illustrated that silencing of miR-199a-5p reduced cell apoptosis, whereas further overexpression of p21 partially countered this effect (Figure 6B). As depicted in Figure 6C, a CCK-8 assay detected that silencing of miR-199a-5p promoted cell proliferation, while further overexpression of p21 partially counteracted this effect.
Figure 6
Inhibition of miR-199a-5p inhibits apoptosis of nucleus pulposus cells and IVDD by regulating the SIRT1/p21 axis both in vivo and in vitro
(A) miR-199a-5p expression detected by qRT-PCR in degenerative nucleus pulposus cells transfected with miR-199a-5p inhibitor or in combination with oe-p21. (B) Cell apoptosis was detected by flow cytometry upon transfection with miR-199a-5p inhibitor or in combination with oe-p21. (C) Cell proliferation detected by a CCK-8 assay upon transfection with miR-199a-5p inhibitor or in combination with oe-p21. (D) Expression of miR-199a-5p detected by qRT-PCR in nucleus pulposus tissues of IVDD rats treated with miR-199a-5p antagomir or in combination with oe-p21. (E) Cell apoptosis in nucleus pulposus tissues by TUNEL staining in IVDD rats treated with miR-199a-5p antagomir or in combination with oe-p21. Data are shown as mean ± standard deviation of three technical replicates. Three parallel samples were examined. Data among multiple groups were analyzed by one-way ANOVA with a Tukey’s test while those at different time points were analyzed by a two-way ANOVA. ∗p < 0.05 with statistical significance. N = 6 for rats in each group.
Inhibition of miR-199a-5p inhibits apoptosis of nucleus pulposus cells and IVDD by regulating the SIRT1/p21 axis both in vivo and in vitro(A) miR-199a-5p expression detected by qRT-PCR in degenerative nucleus pulposus cells transfected with miR-199a-5p inhibitor or in combination with oe-p21. (B) Cell apoptosis was detected by flow cytometry upon transfection with miR-199a-5p inhibitor or in combination with oe-p21. (C) Cell proliferation detected by a CCK-8 assay upon transfection with miR-199a-5p inhibitor or in combination with oe-p21. (D) Expression of miR-199a-5p detected by qRT-PCR in nucleus pulposus tissues of IVDD rats treated with miR-199a-5p antagomir or in combination with oe-p21. (E) Cell apoptosis in nucleus pulposus tissues by TUNEL staining in IVDD rats treated with miR-199a-5p antagomir or in combination with oe-p21. Data are shown as mean ± standard deviation of three technical replicates. Three parallel samples were examined. Data among multiple groups were analyzed by one-way ANOVA with a Tukey’s test while those at different time points were analyzed by a two-way ANOVA. ∗p < 0.05 with statistical significance. N = 6 for rats in each group.Additionally, we silenced miR-199a-5p and overexpressed p21 in IVDD rats. Subsequently results from qRT-PCR depicted that miR-199a-5p expression levels were the same as in in vitro experiments (Figure 6D). Moreover, TUNEL staining results displayed that silencing of miR-199a-5p reduced the apoptosis of nucleus pulposus cells, but further overexpression of p21 countered this effect (Figure 6E). The above results indicated that silencing of miR-199a-5p inhibited nucleus pulposus cell apoptosis and disc degeneration via the SIRT1/p21 axis in vivo and in vitro.
Discussion
As a leading cause of disability, IVDD can be attributed to a variety of factors, while restoration of living cell conditions and altering cell phenotypes are known to reverse the degenerative process underlying IVDD., In recent years, numerous researchers have focused their efforts on miRNAs in the alleviation of IVDD considering their extensive roles in mediating cell proliferation and apoptosis, the inflammatory response, and extracellular matrix degradation. Expanding on this, the current study set out to identify the role of miR-199a-5p in IVDD in an effort to uncover a novel therapeutic strategy for IVDD. Collectively, our obtained findings indicated that miR-199a-5p contributed to IVDD by augmenting the apoptosis of nucleus pulposus cells via the SIRT1/p21 axis.First, we discovered that miR-199a-5p was highly expressed in clinically collected nucleus pulposus tissue samples from IVDD patients as well as in commercially available nucleus pulposus cells. Concordantly, upregulated expression levels of miR-199a-5p have been previously documented in IVDD samples by other studies as well. Not just for IVDD, but previous studies have also witnessed time-dependent upregulation of miR-199a-5p in patients with other spinal cord injuries, such as brachial root avulsion. Moreover, recent findings have further demonstrated that inhibition of miR-199a can promote the beneficial nucleus pulposus phenotype and resist calcification of intervertebral discs. Meanwhile, high expression levels of miR-199a-5p in lumbar IVDD were closely correlated with degeneration grading, which again reiterates the implication of aberrantly expressed miR-199a-5p in IVDD. Additionally, we attempted to further explore the functional role of miR-199a-5p in nucleus pulposus cells by inhibiting miR-199a-5p in vitro and found that miR-199a-5p knockdown led to suppressed apoptosis of nucleus pulposus cells as evidenced by diminished levels of cleaved caspase-3 and Bax, along with elevated levels of Bcl-2. Furthermore, loss of miR-15a in degenerative nucleus pulposus cells has been previously documented to confer a promotive effect on nucleus pulposus cell proliferation and inhibitory effects on nucleus pulposus cell apoptosis, accompanied by upregulation of Bcl-2 and downregulation of Bax and caspase-3, which adds further validation to our results. The findings in conjunction with existing evidence suggest that miR-199a-5p functions as a promoter to facilitate the progression of IVDD, and that miR-199a-5p could serve as a therapeutic target in the treatment of IVDD.Existing knowledge further indicates upregulation of miR-141 aggravates IVDD by facilitating apoptosis of nucleus pulposus cells, while blockade of miR-141 curbs the progression of IVDD by targeting SIRT1 mechanistically. Correspondingly, subsequent mechanistic investigation in the current study demonstrated that SIRT1 was poorly expressed in IVDD and served as a target gene of miR-199a-5p, whereas re-expression of SIRT1 counterweighed the action of highly expressed miR-199a-5p in IVDD. In addition, recent studies have demonstrated that SIRT1 also serves as a direct target gene of miR-199, wherein SIRT1 upregulation could dramatically reverse the promoting effect of miR-199 on transforming growth factor β1 (TGF-β1)-induced epithelial-mesenchymal transition and renal fibrosis in HK-2 cells, which is particularly similar to our findings with regard to the targeting relationship between SIRT1 and miR-199a-5p., Additionally, decreased expression levels of SIRT1 have been previously detected in nucleus pulposus tissues of IVDD rat models, whereas SIRT1 upregulation induced by butein was found to confer protection to nucleus pulposus cells against hyperglycemia-induced apoptosis and senescence. SIRT1 has been verified as a target gene of another miRNA, miR-138-5p, the knockout of which harbors the property of preventing nucleus pulposus cells from apoptosis by re-expressing SIRT1. Also, SIRT1 activation has further been suggested to ameliorate disc injury induced by puncture and potentiate the proliferative capability of senescent nucleus pulposus cells. Taken together, these findings and evidence suggest that the miR-199a-5p/SIRT1 axis may hold the promise to provide a possible treatment strategy for managing IVDD.More importantly, the protective action of SIRT1 in cartilage end plate degeneration, a key process during the course of IVDD, has been reported to rely on the p53/p21 signaling pathway, while the acetylation of p21 is known to be mediated by SIRT1 in cardiomyocytes., In the current study, we also uncovered the involvement of p21 acetylation in the action of miR-199a-5p in IVDD, such that miR-199a-5p could augment the expression of p21 through SIRT1-mediated p21 acetylation, and overexpressed p21 served as a counterbalance to the functional role of the miR-199a-5p inhibitor in IVDD. Moreover, previous studies have further elaborated that the anti-proliferative and pro-apoptotic properties of reduced protein levels of SIRT1 in IVDD are correlated with p21, wherein SIRT1 activation results in diminished p21 expression levels. In addition, high expression of SIRT2 has been authenticated to reduce the expression of p21 in nucleus pulposus cells during IVDD, which is in accordance with our findings. Furthermore, the involvement of p21 in IVDD is usually coincident with the p53 pathway,30, 31, 32 suggesting the need of additional attention due to the complex underlying regulatory signaling pathways. Moreover, p21 is known to be highly expressed in IVD cells under conditions of a combination of low glucose, hypoxia, high osmolality, and the absence of serum, as well as in nucleus pulposus tissue samples from IVDD patients. Meanwhile, silencing of the small ubiquitin-related modifier 2 (SUMO2) gene can diminish the p21 expression and, consequently, promotes proliferation while impairing the apoptosis of nucleus pulposus cells in rats with IVDD. Further in line with our findings, a previous study witnessed significantly upregulated expression levels of miR-199b-5p and p21 in U87 glioma cells following treatment with tigecycline, a first-in-class glycylcycline antibiotic, suggestive of their positive correlation. However, due to the lack of available literature, the established relationship in the current study that miR-199a-5p could promote p21 expression warrants further investigation.In conclusion, findings obtained in the current study indicate that miR-199a-5p could potentially promote apoptosis of nucleus pulposus cells and the resultant IVDD progression by impairing SIRT1-mediated acetylation of p21 (Figure 7). However, we were unable to clarify the specific site that regulates p21 acetylation, which requires further exploration. Also, the number of human tissue samples in the study is limited, and future endeavors exploring the miR-199a-5p/SIRT1/p21 axis should incorporate additional tissue samples. Nevertheless, we demonstrated that targeting the miR-199a-5p/SIRT1/p21 axis could shed new light on the development of therapeutic strategies for IVDD and provide novel possibilities to improve the success of intervertebral disc regenerative techniques.
Figure 7
Potential roles of miR-199a-5p and SIRT1 in the pathological process of IVDD
Potential roles of miR-199a-5p and SIRT1 in the pathological process of IVDD
Materials and methods
Ethics statement
The current study was approved by the Ethics Committee of The Affiliated Hospital of Binzhou Medical University and performed in strict accordance with the Declaration of Helsinki. Signed informed consents were obtained from all participants prior to tissue collection. Animal experiments were performed with the approval of the Institutional Animal Care and Use Committee of The Affiliated Hospital of Binzhou Medical University, and extensive efforts were made to ensure minimal suffering to the animals included in the study.
Study subjects
Degenerative nucleus pulposus tissues were collected from 48 patients undergoing anterior cervical discectomy and fusion (ACDF) due to IVDD at The Affiliated Hospital of Binzhou Medical University. In addition, control nucleus pulposus tissues were also collected from 48 patients with idiopathic scoliosis due to Hirayama disease at The Affiliated Hospital of Binzhou Medical University over the same period.
Immunohistochemistry
Nucleus pulposus tissues were fixed with 4% cold paraformaldehyde for 20 min, rinsed three times with phosphate-buffered saline (PBS), and treated with 0.2% Triton X-100 for 10 min. After another three rinses with PBS, the tissues were blocked with the serum of the same host as the secondary antibody for 30 min. Next, the tissues were incubated with a primary antibody against SIRT1 (dilution ratio of 1:100, ab32441, Abcam, Cambridge, UK) overnight at 4°C in a wet box. Additional incubation with a secondary antibody (ab150081) was performed in dark conditions at room temperature for 2 h or at 37°C for 1.5 h after three rinses with PBS. Finally, 4′,6-diamidino-2-phenylindole (DAPI) was applied for nuclear staining, and the results were analyzed under a fluorescence microscope.
Establishment of IVDD rat models
Adult female Sprague-Dawley (SD) rats (200–250 g) purchased from the Experimental Animal Institute of Shanghai University were fed in a controlled environment with moderately warm temperatures under a 12-h light/12-h dark cycle. Next, all rats were randomly grouped and intraperitoneally anesthetized with 3% pentobarbital sodium (40 mg/kg, P3761, Sigma-Aldrich, St. Louis MO, USA). IVDD model establishment was carried out according to a previously described method. Briefly, rat coccygeal vertebrae (Co7/Co8) were punctured using an 18G needle and kept for 1 min. Next, lentiviruses carrying miR-199a-5p agomir and miR-199a-5p antagomir were injected into the intervertebral discs of rats in each group once a week for 8 weeks until they were euthanized. Lentiviruses with overexpression of SIRT1 and p21 (oe-SIRT1 and oe-p21) were modified from human immunodeficiency virus (HIV) and could be transfected stably into the animal models. All lentiviruses and the corresponding controls were purchased from GenePharma (Shanghai, P.R. China).
H&E staining
Parts of IVDD tissues (Co7/Co8) and normal IVD tissues (Co8/Co9) were used for H&E staining. The target IVDD tissues (Co7-Co8 and Co8-Co9) and adjacent caudal vertebrae were excised, fixed with 3% neutral formaldehyde, paraffin-embedded, and sliced into 5-μm-thick sections. The tissue sections were dewaxed twice with xylene, 5 min each, rehydrated with 100%, 95%, 80%, and 75% gradient ethanol for 1 min, respectively, and then rinsed for 2 min under running water. Next, the tissue sections were stained with hematoxylin for 2 min and rinsed for 10 s with running water, followed by color separation with 1% HCl-ethanol for 10 s. Afterward, the sections were rinsed under distilled water for 1 min and stained with eosin for 1 min. Following washing by aqua distillate for 10 s, the sections were dehydrated twice with 95% and 100% ethanol for 1 min, respectively. Finally, the sections were permeabilized by xylene, mounted with neutral gum, and observed under an optical microscope.
Safranin O staining
Initial section treatment was performed according to similar protocols as for H&E staining. Afterward, the sections were stained with 0.5% Safranin O for 5 min. Following washing with distilled water, the sections were then dehydrated twice in 95% and 100% gradient ethanol (2 min each), permeabilized using xylene, sealed with neutral gum, and observed under an optical microscope.
TUNEL staining
TUNEL staining was performed to evaluate apoptotic cells in the nucleus pulposus tissues. Next, the samples were placed in ethanol solution with 3% hydrogen peroxide for 15 min to block the peroxidase activity in the tissues. After washing, the samples and Proteinase K were co-incubated for 20 min at indoor temperature and added with TUNEL staining solution for reaction. Then, the sections were developed with diaminobenzidine tetrahydrochloride (DAB) for 15 min at room temperature and rinsed with PBS. Subsequently, the sections were stained with hematoxylin. Finally, the TUNEL-positive cells were identified as cells with a brown nucleus.
Nucleus pulposus cell culture
Following 8 weeks of successful model establishment, four rats were euthanized by an overdose of CO2 under anesthesia. The spine was then separated to expose the normal and IVDD spine under aseptic conditions. Specimens of normal and degenerate nucleus pulposus tissues were subsequently rinsed with PBS twice, then cut into blocks and digested with protease (2 U/mL, Gibco, Grand Island, NY, USA) at 37°C for 0.5 h. Type II collagenase (0.25 mg/mL, 17101-015, Gibco, Grand Island, NY, USA) was then added to release nucleus pulposus cells from tissues. The obtained suspension was transferred to a cell filter (40 μm, Novin Daru, Tehran, Iran) and centrifuged at 3,000 rpm for 5 min. Next, the cells were inoculated into a culture dish with Dulbecco’s modified Eagle’s medium/Ham’s F-12 medium (DMEM-F12) (Gibco, Grand Island, NY, USA) containing 100 U/mL penicillin, 100 μg/mL streptomycin, and 15% fetal bovine serum (FBS, Gibco, Grand Island, NY, USA), and cultured in a cell incubator at 37°C with 5% CO2, and the medium was changed every 3 days.
Isolation and culture of human nucleus pulposus cells
Nucleus pulposus tissue samples were separated and sliced into sections. The sections were then treated with 0.25% Pronase (Sigma-Aldrich, St Louis, MO, USA) and 0.2% type II collagenase (Invitrogen, Carlsbad, CA, USA) for 30 min and 4 h at 37°C, respectively. Digestion was subsequently carried out through a 70-μm pore size grid, and then the sections were cultured with DMEM (Gibco, Grand Island, NY, USA) containing 10% FBS, 1% penicillin and streptomycin, 2 mM glutamine, and 50 μg/mL l-ascorbic acid in 5% CO2 at 37°C. When cells grew to confluence, they were detached with 0.25% trypsin containing 1 mM ethylenediaminetetraacetate (EDTA).
Identification of nucleus pulposus cells
The morphology of nucleus pulposus cells was identified using a high-power inverted microscope. Approximately 15 days later, the cells were trypsinized upon reaching 90% confluence and passaged at a ratio of 1:4. Cells at passage 2 were then used for the subsequent experiments. Immunohistochemistry was used to detect the positive expressions of type I collagenase, type II collagenase, and MMP2 in cells at different passages. Briefly, the cells were made to crawl on the slide, which was fixed with 4% paraformaldehyde at room temperature for 30 min, permeabilized with 5% Triton X-100 for 15 min, and then incubated with 3% H2O2 for 15 min at room temperature. Following three PBS washes for 5 min, the cell slides were subjected to antigen retrieval in 0.01 mol/L sodium citrate buffer at 95°C for 15 min, cooled, and rinsed three times with PBS for 5 min. Next, the slide was blocked with 5% goat serum blocking solution for 30 min at 37°C and incubated with primary antibodies against type I collagenase (ab90395), type II collagenase (ab185430), and MMP2 (ab37150) at 4°C overnight. The following day, the biotin-labeled secondary antibody was added to the slide and incubated at room temperature for 30 min, following by DAB development for 5 min. Thereafter, the slides were counterstained with hematoxylin, sealed with neutral resin, and observed under a light microscope.
Cell transfection
The oe-SIRT1 and oe-p21 plasmids and their nonsense control sequences (oe-NCs) were purchased from GenePharma (Shanghai, P.R. China) as controls. In addition, plasmids of inhibitor NC, miR-199a-5p inhibitor, mimic NC, and miR-199a-5p mimic were purchased from GenePharma (Shanghai, P.R. China). The primer sequences are listed in Table 1.
Table 1
Sequences of miR-199a-5p mimic/inhibitor and related controls
miRNA
Sequences (5′→3′)
miR-199a-5p mimic, sense
CCCAGUGUUCAGACUACCUGUUC
miR-199a-5p mimic, antisense
GAACAGGUAGUCUGAACACUGGG
miR-199a-5p inhibitor
GAACAGGUAGUCUGAACACUGGG
NC mimic, sense
UUUGUACUACACAAAAGUACUG
NC mimic, antisense
CAGUACUUUUGUGUAGUACAAA
NC inhibitor
CAGUACUUUUGUGUAGUACAAA
Sequences of miR-199a-5p mimic/inhibitor and related controlsThe cultured cells were taken and grouped as follows (normal disc nucleus pulposus cells in the normal group and degenerative disc nucleus pulposus cells in the other groups): (1) normal group; (2) inhibitor NC (transfection inhibitor NC) group; (3) oe-NC (transfection oe-NC) group; (4) oe-SIRT1 (transfection oe-SIRT1) group; (5) mimic NC + oe-NC (co-transfection of mimics NC and oe-NC) group; (6) miR-199a-5p mimic + oe-NC (co-transfection of miR-199a-5p mimic and oe-NC) group; (7) miR-199a-5p mimic + oe-NC group; (8) miR-199a-5p mimic + oe-SIRT1 (co-transfected with miR-199a-5p inhibitor and oe-SIRT1) group; (9) inhibitor NC + oe-NC (co-transfected with inhibitor NC and oe-NC) group; (10) miR-199a-5p inhibitor + oe-NC (co-transfected with miR-199a-5p inhibitor and oe-NC) group; and (11) miR-199a-5p inhibitor + oe-p21 (co-transfected with miR-199a-5p inhibitor and oe-p21) group.Twenty-four hours prior to transfection, the cells were inoculated in a six-well plate at a density of 30%–50%. Cell transfection was then performed according to the instructions for Lipofectamine 2000 reagents (11668-019, Invitrogen, Carlsbad, CA, USA), and 100 pmol of miR-199a-5p mimic, miR-199a-5p inhibitor, oe-SIRT1, and oe-p21 were diluted with 250 μL of serum-free Opti-minimum essential medium (MEM) (51985042, Gibco, Carlsbad, CA, USA), mixed gently, and incubated for 5 min at room temperature. Meanwhile, 5 μL of Lipofectamine 2000 and 250 μL of serum-free Opti-MEM were then co-incubated at room temperature for 5 min. The above two were mixed and co-incubated at room temperature for another 20 min and added to the plate. Following culturing at 37°C with 5% CO2 for 6–8 h, the complete culture medium was renewed, followed by further culture for another 24–48 h for subsequent experiments.
qRT-PCR
Total RNA content was extracted from the nucleus pulposus tissues using RNeasy mini kits (QIAGEN, Hilden, Germany). The obtained mRNA was reverse transcribed into complementary DNA (cDNA) using a reverse transcription kit (RR047A, Takara, Kusatsu, Japan), and miRNA was reverse transcribed using a miRNA first-strand cDNA synthesis kit (B532451-0020, Sangon, Shanghai, P.R. China). qRT-PCR was then conducted using SYBR Premix Ex Taq II (perfect real time) kits (DRR081, Takara) on an ABI 7500 instrument (Applied Biosystems, Foster City, CA, USA) with each reaction run in triplicate. With β-actin and U6 serving as the internal references, the fold changes were calculated by means of relative quantification (the 2−ΔΔCT method). All primers (Sangon) used are shown in Table 2.
Table 2
Primer sequences for qRT-PCR
Target
Forward sequence (5′→3′)
Reverse sequence (5′→3′)
miR-199a-5p (human)
CCGGGATCCGCAAACTCAGCTTTAC
CGGAATTCGTGGCGACCGTGATACC
miR-199a-5p (rat)
CCCAGTGTTCAGACTACCTG
GTGCAGGGTCCGAGGT
SIRT1
TGGCAAAGGAGCAGATTAGTAGG
CTGCCACAAGAACTAGAGGATAAGA
U6 (rat)
CTCGCTTCGGCAGCACA
AACGCTTCACGAATTTGCGT
U6 (human)
CTCGCTTCGGCAGCACA
AACGCTTCACGAATTTGCGT
β-Actin
TTGCCGACAGGATGCAGAA
GCCGATCCACACGGA
Primer sequences for qRT-PCR
Flow cytometry assessment for cell apoptosis
After 48 h of transfection, the cells were collected, rinsed with cold PBS three times, centrifuged, and resuspended in PBS. The rates of apoptosis were evaluated with flow cytometry using annexin V-fluorescein isothiocyanate (FITC) apoptosis detection kits (4030ES20, Sigma-Aldrich, St. Louis, MO, USA) in accordance with the manufacturer’s instructions. The staining solution was prepared with annexin V-FITC, propidium iodide (PI), and 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) at a proportion of 1:2:50. Next, 1 × 106 cells were resuspended in the staining solution (100 μL). Cells were then incubated at room temperature for 15 min before the addition of HEPES (1 mL). Fluorescence was initiated by excitation at 488 nm and measured using emission filters at 525 nm (FITC) and 620 nm (PI) in order to measure cell apoptosis.
Western blot analysis
Proteins were lysed using radioimmunoprecipitation assay (RIPA) buffer (Boster Biological Technology, Wuhan, Hubei, P.R. China) containing protease inhibitors and quantified using bicinchoninic acid (BCA) protein assay kits (Boster Biological Technology, Wuhan, Hubei, P.R. China). The obtained proteins were then separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto a polyvinylidene fluoride (PVDF) membrane. Following blocking with 5% bovine serum albumin (BSA), the membranes were incubated overnight at 4°C with primary rabbit antibodies against cleaved caspase-3 (ab49822, dilution ratio of 1:500), Bax (ab32503, dilution ratio of 1:1,000), Bcl-2 (ab196495, dilution ratio of 1:500), acetyl-lysine (ab21623, dilution ratio of 1:2,500), Ki-67 (ab16667, dilution ratio of 1:1,000), PCNA (ab92552, dilution ratio of 1:2,000), β-actin (ab8227, dilution ratio of 1:500), SIRT1 (ab110304, dilution ratio of 1:1,000), and p21 (ab80633, dilution ratio of 1:1,000), followed by incubation with horseradish peroxidase (HRP)-labeled secondary antibody goat anti-rabbit IgG (ab6717, dilution ratio of 1:2,000) or goat anti-mouse IgG (ab205719, dilution ratio of 1:2,000) at room temperature for 1 h. The aforementioned antibodies were procured from Abcam (Cambridge, UK). The immunocomplexes on the membrane were visualized using enhanced chemiluminescence (ECL) reagents (EMD Millipore, Billerica, MA, USA) and band intensities were quantified using ImageJ software. β-Actin was regarded as the internal reference, and each experiment was repeated three times.
CCK-8 assay
The proliferation of nucleus pulposus cells was measured using CCK-8 kits (Dojindo, Kumamoto, Japan). After transfection, nucleus pulposus cells were re-suspended and inoculated in a 96-well plate at a density of 2 × 103 cells/well (100 μL) for 96 h. At 0, 24, 48, 72, and 96 h time intervals after inoculation, CCK-8 reagent was added to the corresponding well, respectively. The plate was incubated for another 4 h at 37°C, and the absorbance at 450 nm was measured using a microplate reader.
RIP assay
The binding of miR-199a-5p to SIRT1 was determined using a RIP kit (Millipore, Billerica, MA, USA) following the manufacturer’s instructions. Cells in each group were rinsed with precooled PBS and the supernatant was discarded. The cells were lysed in an ice bath with equal volumes of RIPA lysis buffer (P0013B, Beyotime, Shanghai, P.R. China) for 5 min, and the supernatant was centrifuged at 14,000 rpm and 4°C for 10 min. A part of the cell extract was taken out as the input, and the remaining extract was incubated with the antibody at room temperature for 0.5 h for co-precipitation. RNA was extracted from the sample after digestion by protease K for subsequent qRT-PCR detection of SIRT1. Antibodies used for RIP were rabbit anti-AGO2 (dilution ratio of 1:100, ab32381) and rabbit anti-human IgG (dilution ratio of 1:100, ab109489) used as the NC. Each experiment was repeated three times to obtain the mean value.
Dual-luciferase reporter assay
In order to verify whether SIRT1 was a direct target of miR-199a-5p, we inserted the synthesized SIRT1 3′ untranslated region (UTR) gene fragment into the pmiR-reporter gene (Huayueyang Biotech, Beijing, P.R. China). The sequence of SIRT1-MUT was designed referring to SIRT1-WT. Next, the vectors were digested with the restriction endonuclease and ligated with the target fragments using T4 DNA ligase to yield the pMIR-reporter vector. The vectors, SIRT1-WT and SIRT1-MUT, were confirmed by means of RNA sequencing, and then co-transfected with miR-199a-5p into an HEK293T cell vector (Beinuo Biotech, Shanghai, P.R. China). After 48 h of transfection, the cells were collected and lysed, after which the Dual-Luciferase reporter assay system (E1910, Promega, Madison, WI, USA) was used to measure the luciferase activity.
CoIP assay
Cells were lysed in the lysis buffer (50 mM Tris-HCl [pH 7.4], 150 mM NaCl, 10% glycerin, 1 mM EDTA, 0.5% Nonidet P-40 [NP-40], and protease inhibitors mixture). The cell fragments were removed by centrifugation. Afterward, the debris-free lysates were incubated with antibodies against p21 (2 μg/mg lysate, ab80633) and SIRT1 (ab110304, dilution ratio of 1:100) as well as 15 μL of protein A/G beads (Santa Cruz, Dallas, TX, USA) for 2 h. The proteins were then separated by SDS-PAGE and transferred onto a nitrocellulose membrane (Millipore, Billerica, MA, USA), followed by western blot analysis.
Statistical analysis
Statistical analyses were performed using SPSS 21.0 statistical software (IBM, Armonk, NY, USA), and the measurement data were expressed as mean ± standard deviation. Comparison between two groups was conducted by an unpaired t test, while those among multiple groups was conducted by one-way analysis of variance (ANOVA), followed by Tukey’s tests with corrections for multiple comparisons. Variables were analyzed at different time points using two-way ANOVA. A value of p <0.05 was considered statistically significant.
Availability of data
The datasets generated/analyzed during the current study are available.