| Literature DB >> 33976284 |
Maslin Osathanunkul1,2, Toshifumi Minamoto3.
Abstract
A lack of reliable tools for determining the presence and distribution of fish species can impede understanding of predator-prey interactions and fishery management. Conventional fish survey methods are invasive, and can be size or species selective. Combining netting and electrofishing is a current method used to monitor fish species in Phayao Lake (Kwan Phayao), Thailand. However, the methods are inefficient and time-consuming. Recently, locals who rely on inland fisheries in Kwan Phayao expressed their deep concerns about the giant snakehead, Channa micropeltes (Cuvier, 1831) destroying other fish there. The giant snakehead prey on many commercially important fish species, as the prey species is reduced, negative effects on both biodiversity and the fishery sector could follow. Here, an eDNA-based survey was developed to detect the presence of the giant snakehead. Water samples were collected from six sites within Kwan Phayao and 17 sites in Ing River where water flowed into and out of Kwan Payao. The eDNA of the giant snakehead was detected in water samples from all collection sites using the developed qPCR assay with various concentrations. The eDNA was shown here to be a sensitive and reliable tool for fish surveillance so there will be a better chance for developing an effective management strategy.Entities:
Year: 2021 PMID: 33976284 PMCID: PMC8113229 DOI: 10.1038/s41598-021-89320-2
Source DB: PubMed Journal: Sci Rep ISSN: 2045-2322 Impact factor: 4.379
Homology of the query to the forward and reverse primers, percentage identity as a function of the number of matching base sites divided by 47 (total number of base sites across the primer pair) Base site homology between the query and the primer is shown as a dot.
| Species | Forward | Reverse | Identity, % | GenBank |
|---|---|---|---|---|
| ●●●●●●●●●●●●●●●●●●●●●● | ●●●●●●●●●●●●●●●●●●●●●●●●● | 100.0 | KX129904 | |
| ●●ACTTT●T●●●●●A●●G●●T● | ●●●●●●CCC●●●●●●●●●●●●●C●– | 71.4 | GU937112 | |
| ●A●CACATT●●A●●●●●G●●T● | ●●●●●●TCC●●●●●●●●A●●●●C●– | 67.3 | KJ930190 | |
| ●●TC●C●TT●●C●●●●●G●●TT | ●●●●●●TTT●●●T●●●●●●●●●C●– | 69.4 | NC 036,948 | |
| –C●●●●●●T●T●●●●●●A●●T● | ●●●●●●TAC●●●●●●●●A●●●●C●– | 75.5 | MF804538 | |
| ●●ACTTT●T●●●●●A●●G●●T● | ●●●●●●CCC●●●●●●●●●●●●●C●– | 71.4 | KC823606 | |
| ●●TC●●●●T●●●●●●●●G●●T● | ●●●●●●CC●●●●●●●●●●●●●●C●– | 81.6 | AB968638 | |
| –CTTATA●T●●●●●●●●G●●T● | ●●●●●●CCC●●●●●●●●T●●●●C●– | 67.3 | KX177965 | |
| ●CAAACA●T●T●●●●●CA●CT● | ●●●A●●T–AA●●●●●●●●●●●●C●G | 61.2 | NC 024,752 | |
| ACTAATTTT●●C●A●●CGCC●● | ●●●●●●CCC●●●T●●●●●●●●●●T– | 57.1 | AB920288 | |
| ACTAATTTT●TC●A●●CAC●●● | ●●●●●●CCC●●●T●TG●A●C●T●●T | 49.0 | NC 026,581 | |
| ACTAATAAT●T●●A●●CCCC●T | T●●●●●C●C●●●–●TG●●●●AT●A– | 49.0 | NC 012,712 | |
| CCTAGCTTT●●C●●●●CGCCT● | ●●●A●●C–CG●●●●●●●T●●●●●●– | 55.1 | NC 022,728 | |
| CCTAGCTTT●●C●●●●CACCT● | ●●●●●T●CC●●●●●●●●●●●●●C●G | 59.2 | NC 031,363 | |
| TCTTA●TTT●●C●A●●CGCC●● | ●●●●●●CT●●●●●●●●●T●●●●T●G | 61.2 | NC 026,725 | |
| TCTTTATAT●TC●A●●CGCC●● | ●●●●●●TCC●●●●●●●●T●●●●C●G | 55.1 | NC 026,580 |
Figure 1Map showing sampling sites. 1–6 water collecting sites in Kwan Phayao, A–K where water flowed into Kwan Phayao and L–Q where water flowed out of Kwan Phayao.
Figure 2Map showing sampling sites with estimated concentration eDNA of the giant snakehead obtained from species-specific qPCR assay.
Average copy number and Ct (cycle threshold) obtaining form qPCR amplification of DNA samples from all sampling sites and standard fragments.
| Site ID | Average copy number per mL | Average Ct |
|---|---|---|
| Positive tank | 25.6 | 27.33 |
| 1 | 5.9 | 29.24 |
| 2 | 2.9 | 30.17 |
| 3 | 2.0 | 30.66 |
| 4 | 9.8 | 28.58 |
| 5 | 2.8 | 30.24 |
| 6 | 2.2 | 30.54 |
| A | 6.4 | 29.15 |
| B | 1.5 | 32.53 |
| C | 7.3 | 28.97 |
| D | 8.9 | 28.71 |
| E | 14.0 | 28.12 |
| F | 8.6 | 28.76 |
| G | 5.3 | 29.38 |
| H | 4.4 | 29.64 |
| I | 4.8 | 29.52 |
| J | 7.9 | 28.86 |
| K | 2.4 | 30.40 |
| L | 8.0 | 28.85 |
| M | 6.2 | 29.18 |
| N | 9.4 | 28.64 |
| O | 5.5 | 29.34 |
| P | 4.8 | 29.52 |
| Q | 4.6 | 29.57 |
Average values were calculated from three qPCR replicates with each replicate contain three replicates of each samples.
Details of species-specific primers and the probe designed to amplify a 127 bp fragment of the 16S region of Channa micropeltes (Cuvier, 1831).
| Primer name | Type | Length (bp) | Primer sequence 5′–3′ |
|---|---|---|---|
| Forward primer | 24 | CTCGCACCAACTAGGCTTTTCC | |
| Reverse primer | 25 | GGTTAATGTTCGGTGGATTGTCCGT | |
| Probe | 20 | TGCTAACATGGAAGCACTTA |