Literature DB >> 33974673

Subcellular distribution of ezrin/radixin/moesin and their roles in the cell surface localization and transport function of P-glycoprotein in human colon adenocarcinoma LS180 cells.

Takuro Kobori1, Mayuka Tameishi1, Chihiro Tanaka1, Yoko Urashima1, Tokio Obata1.   

Abstract

The ezrin/radixin/moesin (ERM) family proteins act as linkers between the actin cytoskeleton and P-glycoprotein (P-gp) and regulate the plasma membrane localization and functionality of the latter in various cancer cells. Notably, P-gp overexpression in the plasma membrane of cancer cells is a principal factor responsible for multidrug resistance and drug-induced mutagenesis. However, it remains unknown whether the ERM proteins contribute to the plasma membrane localization and transport function of P-gp in human colorectal cancer cells in which the subcellular localization of ERM has yet to be determined. This study aimed to determine the gene expression patterns and subcellular localization of ERM and P-gp and investigate the role of ERM proteins in the plasma membrane localization and transport function of P-gp using the human colon adenocarcinoma cell line LS180. Using real-time reverse transcription polymerase chain reaction and immunofluorescence analyses, we showed higher levels of ezrin and moesin mRNAs than those of radixin mRNA in these cells and preferential distribution of all three ERM proteins on the plasma membrane. The ERM proteins were highly colocalized with P-gp. Additionally, we show that the knockdown of ezrin, but not of radixin and moesin, by RNA interference significantly decreased the cell surface expression of P-gp in LS180 cells without affecting the mRNA expression of P-gp. Furthermore, gene silencing of ezrin substantially increased the intracellular accumulation of rhodamine123, a typical P-gp substrate, with no alterations in the plasma membrane permeability of Evans blue, a passive transport marker. In conclusion, ezrin may primarily regulate the cell surface localization and transport function of P-gp as a scaffold protein without influencing the transcriptional activity of P-gp in LS180 cells. These findings should be relevant for treating colorectal cancer, which is the second leading cause of cancer-related deaths in males and females combined.

Entities:  

Year:  2021        PMID: 33974673      PMCID: PMC8112653          DOI: 10.1371/journal.pone.0250889

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

According to the World Health Organization, cancer is the second most common cause of death worldwide and was responsible for an estimated 9.6 million deaths in 2018 [1]. Colorectal cancer (CRC) is the second leading cause of cancer deaths among males and females combined [1]. Despite great advances in the treatment of cancer in the last few decades, effective strategies for pharmacotherapy of CRC are still under development [2-4]. One of the major problems with the treatment of CRC is the acquired multidrug resistance (MDR) of cancer cells, not only to a broad spectrum of structurally and functionally distinct conventional chemotherapeutic drugs but also to molecular targeted drugs during the course of their treatment [5-10]. Moreover, drug-induced mutagenesis is also one of the most common barriers to the clinical success for cancer chemotherapy [11, 12]. P-glycoprotein (P-gp/ABCB1/MDR1) belongs to the ATP-binding cassette (ABC) transporter superfamily, which actively exports structurally and functionally unrelated chemotherapeutic drugs from cancer cells to the extracellular space [13, 14]. Among the complex and multifactorial mechanisms underlying MDR, overexpression of P-gp in the cancer cell membrane has long been recognized as the principal factor responsible for MDR in a variety of cancers [15-18]. The members of the ezrin/radixin/moesin (ERM) family of proteins act as linkers between the actin cytoskeleton and various plasma membrane proteins, including P-gp, multidrug resistant protein-2, and epidermal growth factor receptor 2 [19-21]. Several recent studies have demonstrated that ERM play a critical role in the maintenance of cell surface membrane localization and drug efflux function of P-gp in a variety of cancer cells [17, 21–25]. However, it is largely unknown whether ERM contribute to the plasma membrane localization and drug efflux function of P-gp in human colon adenocarcinoma in which subcellular localization of ERM has yet to be determined. The aim of this study was to identify the gene expression pattern and subcellular localization of ERM together with P-gp and to investigate the role of ERM in the plasma membrane localization and transport function of P-gp using RNA interference-mediated gene silencing experiments in LS180 cells, a representative human colon adenocarcinoma cell line.

Materials and methods

Cell culture

The human colon adenocarcinoma cell lines, LS180 and Caco-2, were purchased from European Collection of Cell Cultures (ECACC) collections (KAC, Hyogo, Japan). LS180 cells were cultured in Dulbecco’s modified Eagle medium (DMEM) containing 1,500 mg/L glucose (FUJIFILM Wako Pure Chemical, Osaka, Japan) and Caco-2 cells were cultured in DMEM with 4,500 mg/L glucose. In both the cases, the medium was supplemented with heat-inactivated 10% fetal bovine serum (FBS) (Cosmo Bio, Tokyo, Japan). The cultures were maintained at 37°C in a humidified atmosphere with 5% CO2. The acidic cell culture medium (pH 6.5) was obtained by the addition of 35–37% HCl solution to DMEM containing 1,500 mg/L glucose supplemented with heat-inactivated 10% FBS by measuring pH with a FiveEasy Plus FEP20 pH Meter (METTLER TOLEDO, Tokyo, Japan). LS180 cells were grown for a sufficient time in normal medium and were subsequently maintained in the acidic cell culture medium (pH 6.5) for a few days as described previously with some modifications [26-28].

Transfection of cells with siRNAs

LS180 cells were cultured until 70–80% confluent in the normal (for all experiments) or the acidic medium (for isolation of total RNA, flow cytometric analysis, and cell viability assay), and then were seeded at a density of 2.5 × 104 cells/well in 24-well cell culture plates (Corning, Glendale, AZ, USA) for isolation of total RNA, flow cytometric analysis, rhodamine123 (Rho123) accumulation study, and passive transport assay. For Rho123 accumulation study using confocal laser microscope, 2.0 × 104 cells/dish were seeded in the center of polylysine-coated 35-mm glass bottom dish with 14-mm inner diameter (Matsunami Glass, Osaka, Japan), and for cell viability assay, 5.0 × 103 cells/well were plated in 96-well cell culture plates (Thermo Fisher Scientific, Tokyo, Japan). The cultures were incubated overnight at 37°C in a humidified atmosphere with 5% CO2 to allow for attachment. Silencer Select small interfering RNAs (siRNAs) for each target gene (Thermo Fisher Scientific) were diluted with Opti-MEM (Thermo Fisher Scientific). The cells were then transfected with 2 nM/well or 5 nM/well of siRNAs targeting human moesin or other genes (ABCB1, ezrin, and radixin) using the Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher Scientific). The volume of transfection reagent used was 1.0 μL/well for total RNA isolation, Rho123 accumulation study without confocal laser microscope, and passive transport assay, 0.8 μL/well for Rho123 accumulation study with confocal laser microscope, and 0.2 μL/well for cell viability assay. For cell viability assay, cells treated with 10 μM/well of staurosporine (Merck, Darmstadt, Germany) were included as a positive control for inducing cell death. After addition of the siRNA and transfection reagent, cells were cultured continuously for 3 days. Silencer Select Negative Control siRNA (Thermo Fisher Scientific), which has no significant similarity to human gene sequences and has minimal effects on gene expression, was used as a negative control for each siRNA.

RNA isolation and real-time reverse transcription- polymerase chain reaction (RT-PCR)

Total RNA was isolated using ISOSPIN Cell & Tissue RNA (NIPPON GENE, Tokyo, Japan) according to the manufacturer’s protocol. The quality and quantity of total RNA were measured with a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific). The isolated total RNA (10–50 ng) was used as a template for real-time quantitative (RT-PCR) amplification, which was performed in 96-well optical reaction plates or Low-Profile 0.2-mL 8-Tube Strips with Optical Flat 8-Cap Strips (Bio-Rad Laboratories, Tokyo, Japan) on a CFX Connect Real-Time PCR Detection System (Bio-Rad Laboratories). The reactions were performed with a One Step TB Green Prime Script PLUS RT-PCR Kit (Takara Bio, Shiga, Japan) and the gene-specific primers for human ABCB1, ezrin, radixin, moesin, and β-actin (all purchased from Takara Bio) at a final concentration of 0.4 μM. The reaction program comprised of a reverse transcription step at 42°C for 5 min and subsequent amplification steps including 10 s at 95°C followed by 40 cycles of denaturation for 5 s at 95°C and annealing for 30 s at 60°C. The relative mRNA levels of the target genes normalized to the β-actin levels (used as an internal reference), amplified from the same sample were computed with the comparative quantification cycle (Cq) method (2-ΔΔCq) using the Bio-Rad CFX Manager software version 3.1 (Bio-Rad Laboratories). The sequences of gene-specific PCR primers are given in Table 1.
Table 1

Primer sequences used for RT-PCR analysis of gene expression.

GenePrimer sequence (5′→3′)
hβ-actin (forward)TGGCACCCAGCACAATGAA
hβ-actin (reverse)CTAAGTCATAGTCCGCCTAGAAGCA
hABCB1 (forward)CACATTTGGCAAAGCTGGAGA
hABCB1 (reverse)CATCATTGGCGAGCCTGGTA
hezrin (forward)ACCATGGATGCAGAGCTGGAG
hezrin (reverse)CATAGTGGAGGCCAAAGTACCACA
hradixin (forward)GAATTTGCCATTCAGCCCAATA
hradixin (reverse)GCCATGTAGAATAACCTTTGCTGTC
hmoesin (forward)CCGAATCCAAGCCGTGTGTA
hmoesin (reverse)GGCAAACTCCAGCTCTGCATC

Confocal laser scanning microscopy (CLSM) analysis

CLSM analysis was conducted as described previously with some modifications [29, 30]. Briefly, LS180 cells were seeded at a density of 1.0 × 105 cells on a polylysine-coated 35-mm glass bottom dish with an inner diameter of 14-mm (Matsunami Glass) and incubated overnight 37°C in a humidified atmosphere with 5% CO2 to allow for attachment. Thereafter, the cells were washed with Dulbecco’s phosphate-buffered saline (D-PBS) (Nacalai Tesque, Kyoto, Japan) and fixed with 4% paraformaldehyde (PFA) (FUJIFILM Wako Pure Chemical) for 15 min at room temperature followed by washing with D-PBS three times. Subsequently, the cells were incubated in a blocking buffer consisting of D-PBS supplemented with 10% normal goat serum (Thermo Fisher Scientific), 1% bovine serum albumin (BSA) (FUJIFILM Wako Pure Chemical), 0.3 M glycine (FUJIFILM Wako Pure Chemical), and 0.1% Tween-20 (Nacalai Tesque) for 60 min at room temperature to permeabilize the plasma membrane and to block non-specific protein–protein interactions. Thereafter, the cells were incubated overnight with a mouse anti-human P-gp antibody (Ab) (MA5-13854; Thermo Fisher Scientific) at a dilution of 1:10 in combination with a rabbit anti-human ezrin Ab (3145S; Cell Signaling Technology, Danvers, MA, USA) at a dilution of 1:50, a rabbit anti-human radixin Ab (GTX105408; GeneTex, Alton Pkwy Irvine, CA, USA) at a dilution of 1:50, or a rabbit anti-human moesin Ab (Q480) (3150S; Cell Signaling Technology) at a dilution of 1:25 in blocking buffer at 4°C. After rinsing in D-PBS supplemented with 0.1% Tween-20 (PBS-T) for three times, the cells were incubated for 60 min at room temperature with a blocking buffer containing Alexa Fluor 488-conjugated donkey anti-mouse IgG (H+L) secondary Ab (A-21202; Thermo Fisher Scientific) at a dilution of 1:500 for P-gp or Alexa Fluor 594-conjugated goat anti-rabbit IgG (H+L) secondary Ab (R37117; Thermo Fisher Scientific) at a dilution of 1 drop/500 μL for ezrin, radixin, and moesin. The cells were then washed three times with PBS-T and sealed with a drop of Fluoro-KEEPER Antifade Reagent containing 4′,6-diamidine-2′-phenylindole dihydrochloride (DAPI) (Nacalai Tesque) for counterstaining and preserving the fluorescence. Thereafter, photomicrographs were taken at 0.3–0.4-μm intervals for z-axis at an original magnification of ×120 with a Nikon A1 confocal laser microscope system (Nikon Instruments, Tokyo, Japan). The two- or three-dimensional images were reconstructed from the obtained pictures using the NIS-Elements Ar Analysis software (Nikon Instruments).

Flow cytometric analysis

Flow cytometric analysis was carried out as described previously with some modifications [29, 30]. After treatment of LS180 cells with siRNAs for 3 days, the cells were detached using 500 μL of Accutase (Nacalai Tesque) and transferred into 5 mL tubes filled with 2 mL of D-PBS and centrifuged (260 ×g for 5 min at 4°C). Subsequently, the cells were incubated with a mouse anti-human Ab against P-gp (MA5-13854; Thermo Fisher Scientific) at a dilution of 0.10 μg/tube in a labeling buffer consisting of D-PBS supplemented with 5% normal horse serum (Biowest, Nuaillé, France) and 1% sodium azide (FUJIFILM Wako Pure Chemical) for 60 min at 4°C. After rinsing in the labeling buffer and centrifugation (260 ×g for 5 min at 4°C), the cells were incubated with Alexa Fluor 488-conjugated donkey anti-mouse IgG (H+L) secondary Ab (A-21202, Thermo Fisher Scientific) at a dilution of 1:300 in the labeling buffer for 30 min at room temperature in the dark. After rinsing in the labeling buffer and centrifugation (260 ×g for 5 min at 4°C), the cell pellet was resuspended in 600 μL of D-PBS containing propidium iodide (PI) (Dojindo Laboratories, Kumamoto, Japan) at a concentration of 2 μg/mL to exclude PI-positive dead cells. Thereafter, the cells were analyzed with a Cell Analyzer EC800 (Sony Imaging Products & Solutions, Tokyo, Japan). Data were processed using the EC800 Analysis software (Sony Imaging Products & Solutions) to determine the mean fluorescence intensity of the Alexa Fluor 488-P-gp peak from the cell surface of LS180 cells.

Rho123 accumulation study

The intracellular accumulation of Rho123 was determined as described previously with some modifications [22, 23, 31–34]. After treatment with siRNAs for 3 days, the LS180 cells were pretreated with 50 μM of verapamil (FUJIFILM Wako Pure Chemical), a classical inhibitor of the P-gp function [35], for 30 min followed by incubation with 50 μM of Rho123 (Merck) as a P-gp substrate in the dark for 2 h at 37°C in a humidified atmosphere with 5% CO2. Thereafter, the cells were washed three times with D-PBS to remove the residual Rho123 and lysed in 300 μL of D-PBS containing 0.1% sodium dodecyl sulfate (SDS) (Nacalai Tesque) for 30 min on ice with vigorous vortexing followed by centrifugation (15.700 ×g for 10 min at 4°C) to extract the total protein. The amount of total cellular proteins and Rho123 concentrations in the cell lysate were quantified by measuring the absorbance at 562 nm using a Bicinchoninic acid Protein Assay Kit with BSA as a standard (Takara Bio), and the fluorescence intensity (excitation at 485 nm and emission at 538 nm), respectively with a Synergy HTX Multi-Mode Microplate Reader (BioTek Instrument, Winooski, VT, USA). The intracellular accumulation rate of Rho123 normalized to the total protein content (pmol/μg protein) was calculated by dividing the intracellular concentration of Rho123 (pmol/mL) by the total protein amount (μg/mL). To determine the retention level of Rho123 in LS180 cells by CLSM analysis, cells were subjected to the same procedure except for the final concentration of Rho123 (10 μM) as described above before their lysis in 0.1% SDS solution. Thereafter, photomicrographs were taken at 1.0-μm intervals for z-axis at an original magnification of 20× with a Nikon A1 confocal laser microscope system (Nikon Instruments). The two- or three-dimensional images were reconstructed from the obtained pictures using the NIS-Elements Ar Analysis software (Nikon Instruments).

Passive transport assay

After treatment with siRNAs for 3 days, the cells were pretreated for 30 min in the presence or absence of 70% ethanol (Nacalai Tesque) diluted with the complete growth medium as a positive control followed by incubation with 25 mM of Evans blue, a passive transport marker [22, 36], for 30 min at 37°C in a humidified atmosphere with 5% CO2. After removing the residual Evans blue from each well, the intracellular accumulation of dye was observed using the Eclipse Ti2 inverted microscope system (Nikon Instruments).

Cell viability assay

After treatment of cells with siRNAs or staurosporine for 3 days, 10 μL/well of a commercial PrestoBlue Cell Viability Reagent (Thermo Fisher Scientific) was added directly to the wells containing 100 μL of the complete growth medium and the cells were incubated for 10 min at 37°C in a humidified atmosphere with 5% CO2 protected from direct light. Thereafter, fluorescence signals were detected at a wavelength of 560 nm (excitation) and 590 nm (emission) using a Synergy HTX Multi-Mode Microplate Reader (BioTek Instrument, Winooski, VT, USA). PrestoBlue is a new resazurin-based reagent to assess cell viability and cytotoxicity with higher sensitivity than 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT), and comparable with that of Alamar Blue [37-40].

Statistical analysis

Data are presented as means ± standard error of the mean (SEM). Statistical analysis was performed using the Prism version 3 software (GraphPad Software, La Jolla, CA, USA). Statistical significance was assessed by a one-way analysis of variance (ANOVA) followed by Tukey’s test for multiple comparisons. Differences with P values < 0.05 were considered significant.

Results

ERM expression profiles and localization in LS180 cells

We first measured the expression of ezrin, radixin, and moesin mRNAs in LS180 cells along with that of ABCB1 by real-time RT-PCR analysis. The expression of ezrin, moesin, and ABCB1 was high and that of radixin was low (Fig 1A). By contrast, higher levels of ezrin, radixin, and ABCB1 and lower levels of moesin mRNAs were observed in Caco-2 cells (Fig 1B). Next, subcellular localization of ERM in LS180 cells was assessed by immunofluorescence staining. CLSM analysis revealed that ezrin, radixin, and moesin (red) were preferentially distributed on the plasma membrane and colocalized with P-gp (green) (Fig 1C).
Fig 1

Gene expression pattern and subcellular localization of ezrin, radixin, and moesin (ERM) and P-gp in LS180 cells.

(A, B) Representative amplification curves of ezrin, radixin, moesin, and ABCB1 together with that of β-actin (internal control) in LS180 and Caco-2 cells as determined by real-time quantitative reverse transcription-polymerase chain reaction. (C) Confocal laser scanning microscopy analysis of ERM and P-gp to visualize the subcellular distribution in LS180 cells. In a three-dimensional reconstruction of optically sectioned LS180 cells, ezrin, radixin, and moesin (red) were detected on the plasma membrane and preferentially colocalized with P-gp (green) on the plasma membrane. Scale bars: 20 μm. All data are representative of at least three independent experiments.

Gene expression pattern and subcellular localization of ezrin, radixin, and moesin (ERM) and P-gp in LS180 cells.

(A, B) Representative amplification curves of ezrin, radixin, moesin, and ABCB1 together with that of β-actin (internal control) in LS180 and Caco-2 cells as determined by real-time quantitative reverse transcription-polymerase chain reaction. (C) Confocal laser scanning microscopy analysis of ERM and P-gp to visualize the subcellular distribution in LS180 cells. In a three-dimensional reconstruction of optically sectioned LS180 cells, ezrin, radixin, and moesin (red) were detected on the plasma membrane and preferentially colocalized with P-gp (green) on the plasma membrane. Scale bars: 20 μm. All data are representative of at least three independent experiments.

Effect of siRNAs against each ERM on the expression levels of target mRNAs in LS180 cells

To confirm the efficiency of siRNAs against each ERM, the mRNA levels of each ERM were measured 3 days after transfection of LS180 cells with the siRNAs. siRNAs for ezrin, radixin, and moesin achieved 85%–90% reduction in the expression of their target mRNAs compared with transfection reagent alone without any influence on the expression of other genes (Fig 2A–2C). Notably, none of the siRNAs used in this study altered the viability of LS180 cells (Fig 2D).
Fig 2

Effect of siRNAs targeting ezrin, radixin, or moesin on the mRNA expression of ezrin, radixin, and moesin (ERM) in LS180 cells.

Cells were treated with the transfection medium (Untreated), transfection reagent (Lipofectamine), nontargeting control (NC) siRNA, and specific siRNAs for ezrin, radixin, or moesin and then incubated for 3 days. (A–C) Expression of each mRNA in the cells treated with siRNAs relative to that in cells treated with the transfection reagent alone was measured by real-time quantitative reverse transcription-polymerase chain reaction. n = 3, ***p < 0.001, *p < 0.05 vs. Lipofectamine. (D) Cell viability was assessed with the PrestoBlue cell viability reagent. Staurosporine was used as a positive control for inducing cell death. n = 4, ***p < 0.001 vs. Lipofectamine. All data are expressed as the mean ± SEM and were analyzed by one-way ANOVA followed by Tukey’s test.

Effect of siRNAs targeting ezrin, radixin, or moesin on the mRNA expression of ezrin, radixin, and moesin (ERM) in LS180 cells.

Cells were treated with the transfection medium (Untreated), transfection reagent (Lipofectamine), nontargeting control (NC) siRNA, and specific siRNAs for ezrin, radixin, or moesin and then incubated for 3 days. (A–C) Expression of each mRNA in the cells treated with siRNAs relative to that in cells treated with the transfection reagent alone was measured by real-time quantitative reverse transcription-polymerase chain reaction. n = 3, ***p < 0.001, *p < 0.05 vs. Lipofectamine. (D) Cell viability was assessed with the PrestoBlue cell viability reagent. Staurosporine was used as a positive control for inducing cell death. n = 4, ***p < 0.001 vs. Lipofectamine. All data are expressed as the mean ± SEM and were analyzed by one-way ANOVA followed by Tukey’s test.

Effect of ERM silencing on the expression of P-gp in LS180 cells

First, we checked the effect of siRNAs against ezrin, radixin, and moesin on the level of ABCB1 mRNA. None of these siRNAs had any effect on the levels of ABCB1 mRNA, whereas the siRNA against ABCB1 significantly decreased the levels of ABCB1 mRNA, compared to that in cells treated with the transfection reagent alone (Fig 3A). Next, we investigated whether gene silencing of ezrin, radixin, and moesin affects the expression of P-gp on the surface of the plasma membrane. The results of flow cytometric analysis showed that silencing of ezrin, but not of radixin and moesin, significantly decreased the expression of P-gp on the surface of the plasma membrane to the same level as did the silencing of ABCB1 (Fig 3B and 3C).
Fig 3

Effect of siRNAs targeting ezrin, radixin, or moesin on the ABCB1 mRNA and P-gp expression on the surface of LS180 cells.

Cells were treated with the transfection medium (Untreated), transfection reagent (Lipofectamine), nontargeting control (NC) siRNA, and specific siRNAs for ABCB1, ezrin, radixin, or moesin and then incubated for 3 days. (A) The expression of ABCB1 mRNA in cells treated with each siRNA relative to that in cells treated with the transfection reagent alone was determined by real-time quantitative reverse transcription-polymerase chain reaction. n = 3, ***p < 0.001 vs. Lipofectamine. (B) An overlay of the representative histograms for the expression peak of Alexa Fluor 488-labeled P-gp on the surface of the plasma membrane of LS180 cells treated with the transfection medium (Untreated; black line), transfection reagent (Lipofectamine; gray line), ABCB1 siRNA (purple line), and ezrin siRNA (pink line), as measured by flow cytometry. The calculated relative mean fluorescence intensity peaks of P-gp on the surface of the plasma membrane for all the treatments are shown in (C). n = 4, ***p < 0.001 vs. Lipofectamine. All data are expressed as the mean ± SEM and were analyzed by a one-way ANOVA followed by Tukey’s test.

Effect of siRNAs targeting ezrin, radixin, or moesin on the ABCB1 mRNA and P-gp expression on the surface of LS180 cells.

Cells were treated with the transfection medium (Untreated), transfection reagent (Lipofectamine), nontargeting control (NC) siRNA, and specific siRNAs for ABCB1, ezrin, radixin, or moesin and then incubated for 3 days. (A) The expression of ABCB1 mRNA in cells treated with each siRNA relative to that in cells treated with the transfection reagent alone was determined by real-time quantitative reverse transcription-polymerase chain reaction. n = 3, ***p < 0.001 vs. Lipofectamine. (B) An overlay of the representative histograms for the expression peak of Alexa Fluor 488-labeled P-gp on the surface of the plasma membrane of LS180 cells treated with the transfection medium (Untreated; black line), transfection reagent (Lipofectamine; gray line), ABCB1 siRNA (purple line), and ezrin siRNA (pink line), as measured by flow cytometry. The calculated relative mean fluorescence intensity peaks of P-gp on the surface of the plasma membrane for all the treatments are shown in (C). n = 4, ***p < 0.001 vs. Lipofectamine. All data are expressed as the mean ± SEM and were analyzed by a one-way ANOVA followed by Tukey’s test.

Effect of siRNAs against each ERM on the expression levels of target mRNAs in LS180 cells under the acidic condition

To confirm whether siRNAs against each ERM have similar effects on the target mRNA in the acidic microenvironmental condition, mRNA levels of each ERM were measured 3 days after transfection of LS180 cells with the siRNAs under the acidic condition with pH 6.5. siRNAs for ezrin, radixin, and moesin achieved 74%–85% reduction in the expression of their target mRNAs compared with transfection reagent alone without any significant influence on the expression of other genes (Fig 4A–4C). Notably, none of the siRNAs used in this study also altered the viability of LS180 cells under the acidic condition with pH 6.5 (Fig 4D).
Fig 4

Effect of siRNAs targeting ezrin, radixin, or moesin on the mRNA expression of ezrin, radixin, and moesin (ERM) in LS180 cells under the acidic condition.

Cells were treated with the transfection medium (Untreated), transfection reagent (Lipofectamine), nontargeting control (NC) siRNA, and specific siRNAs for ezrin, radixin, or moesin and then incubated for 3 days under the acidic condition with pH 6.5. (A–C) Expression of each mRNA in the cells treated with siRNAs relative to that in cells treated with the transfection reagent alone was measured by real-time quantitative reverse transcription-polymerase chain reaction. n = 3, **p < 0.01, *p < 0.05 vs. Lipofectamine. (D) Cell viability was assessed with the PrestoBlue cell viability reagent. Staurosporine was used as a positive control for inducing cell death. n = 6, ***p < 0.001 vs. Lipofectamine. All data are expressed as the mean ± SEM and were analyzed by one-way ANOVA followed by Tukey’s test.

Effect of siRNAs targeting ezrin, radixin, or moesin on the mRNA expression of ezrin, radixin, and moesin (ERM) in LS180 cells under the acidic condition.

Cells were treated with the transfection medium (Untreated), transfection reagent (Lipofectamine), nontargeting control (NC) siRNA, and specific siRNAs for ezrin, radixin, or moesin and then incubated for 3 days under the acidic condition with pH 6.5. (A–C) Expression of each mRNA in the cells treated with siRNAs relative to that in cells treated with the transfection reagent alone was measured by real-time quantitative reverse transcription-polymerase chain reaction. n = 3, **p < 0.01, *p < 0.05 vs. Lipofectamine. (D) Cell viability was assessed with the PrestoBlue cell viability reagent. Staurosporine was used as a positive control for inducing cell death. n = 6, ***p < 0.001 vs. Lipofectamine. All data are expressed as the mean ± SEM and were analyzed by one-way ANOVA followed by Tukey’s test.

Effect of ERM silencing on the expression of P-gp in LS180 cells under the acidic condition

We asked whether the gene silencing of ezrin, radixin, and moesin influence the level of ABCB1 mRNA and the expression of P-gp on the surface of the plasma membrane in LS180 cells under the acidic condition. None of these siRNAs had any effect on the levels of ABCB1 mRNA, whereas the siRNA against ABCB1 significantly decreased the levels of ABCB1 mRNA, compared to that in cells treated with the transfection reagent alone (Fig 5A). The results of flow cytometric analysis showed that silencing of ezrin, but not of radixin and moesin, significantly decreased the expression of P-gp on the surface of the plasma membrane to the same level as did the silencing of ABCB1 (Fig 5B and 5C).
Fig 5

Effect of siRNAs targeting ezrin, radixin, or moesin on the ABCB1 mRNA and P-gp expression on the surface of LS180 cells under the acidic condition.

Cells were treated with the transfection medium (Untreated), transfection reagent (Lipofectamine), nontargeting control (NC) siRNA, and specific siRNAs for ABCB1, ezrin, radixin, or moesin and then incubated for 3 days under the acidic condition with pH 6.5. (A) The expression of ABCB1 mRNA in cells treated with each siRNA relative to that in cells treated with the transfection reagent alone was determined by real-time quantitative reverse transcription-polymerase chain reaction. n = 3, ***p < 0.001 vs. Lipofectamine. (B) An overlay of the representative histograms for the expression peak of Alexa Fluor 488-labeled P-gp on the surface of the plasma membrane of LS180 cells treated with the transfection medium (Untreated; black line), transfection reagent (Lipofectamine; gray line), ABCB1 siRNA (purple line), and ezrin siRNA (pink line), as measured by flow cytometry. The calculated relative mean fluorescence intensity peaks of P-gp on the surface of the plasma membrane for all the treatments are shown in (C). n = 4, **p < 0.01, *p < 0.05 vs. Lipofectamine. All data are expressed as the mean ± SEM and were analyzed by a one-way ANOVA followed by Tukey’s test.

Effect of siRNAs targeting ezrin, radixin, or moesin on the ABCB1 mRNA and P-gp expression on the surface of LS180 cells under the acidic condition.

Cells were treated with the transfection medium (Untreated), transfection reagent (Lipofectamine), nontargeting control (NC) siRNA, and specific siRNAs for ABCB1, ezrin, radixin, or moesin and then incubated for 3 days under the acidic condition with pH 6.5. (A) The expression of ABCB1 mRNA in cells treated with each siRNA relative to that in cells treated with the transfection reagent alone was determined by real-time quantitative reverse transcription-polymerase chain reaction. n = 3, ***p < 0.001 vs. Lipofectamine. (B) An overlay of the representative histograms for the expression peak of Alexa Fluor 488-labeled P-gp on the surface of the plasma membrane of LS180 cells treated with the transfection medium (Untreated; black line), transfection reagent (Lipofectamine; gray line), ABCB1 siRNA (purple line), and ezrin siRNA (pink line), as measured by flow cytometry. The calculated relative mean fluorescence intensity peaks of P-gp on the surface of the plasma membrane for all the treatments are shown in (C). n = 4, **p < 0.01, *p < 0.05 vs. Lipofectamine. All data are expressed as the mean ± SEM and were analyzed by a one-way ANOVA followed by Tukey’s test.

Effect of ERM silencing on the transport function of P-gp in LS180 cells

To evaluate the effect of ERM knockdown on the transport function of P-gp, we assessed the intracellular accumulation of Rho123 dye in LS180 cells treated with siRNAs targeting ezrin, radixin, or moesin for 3 days. The siRNA-mediated silencing of P-gp and inhibition of the transport function of P-gp by pretreatment with 50 μM of verapamil resulted in approximately 1.6-fold increase in the intracellular accumulation of Rho123 relative to that in the treatment with the transfection reagent alone. Similarly, transfection of cells with the siRNA against ezrin resulted in approximately 1.6-fold higher intracellular accumulation of Rho123 than in cells treated with the transfection reagent alone. By contrast, we observed no alterations in the rate of Rho123 uptake in LS180 cells transfected with siRNAs against radixin and moesin (Fig 6A). Similarly, the uptake capacity of Rho123 was obviously enhanced in cells transfected with siRNAs targeting ezrin and ABCB1 but not with those targeting radixin and moesin, as was also observed in cells pretreated with 50 μM of verapamil (Fig 6B). Of note, we validated that treatment of LS180 cell with 5, 10, and 50 μM of verapamil dose-dependently increased the uptake capacity of Rho123 (S1 Fig).
Fig 6

Intracellular accumulation of Rho123 in LS180 cells after treatment with siRNA.

Cells were treated with the transfection medium (Untreated), transfection reagent (Lipofectamine), nontargeting control (NC) siRNA, and specific siRNAs for ABCB1, ezrin, radixin, or moesin and then incubated for 3 days. (A) The intracellular accumulation rate of Rhodamine (Rho) 123 normalized to the total protein amount (pmol/μg protein) relative to the accumulation in cells treated with the transfection reagent alone. n = 6, ***p < 0.001 vs. Lipofectamine. Data are expressed as the mean ± SEM and were analyzed by one-way ANOVA followed by Tukey’s test. (B) Representative confocal laser scanning microscopy images of fluorescent Rho123 and of each overlay with phase contrast in LS180 cells. Upper and lower panels indicate Rho123 and merge of Rho123 with phase contrast image, respectively. Scale bars: 50 μm. All the images are representative of at least three independent experiments.

Intracellular accumulation of Rho123 in LS180 cells after treatment with siRNA.

Cells were treated with the transfection medium (Untreated), transfection reagent (Lipofectamine), nontargeting control (NC) siRNA, and specific siRNAs for ABCB1, ezrin, radixin, or moesin and then incubated for 3 days. (A) The intracellular accumulation rate of Rhodamine (Rho) 123 normalized to the total protein amount (pmol/μg protein) relative to the accumulation in cells treated with the transfection reagent alone. n = 6, ***p < 0.001 vs. Lipofectamine. Data are expressed as the mean ± SEM and were analyzed by one-way ANOVA followed by Tukey’s test. (B) Representative confocal laser scanning microscopy images of fluorescent Rho123 and of each overlay with phase contrast in LS180 cells. Upper and lower panels indicate Rho123 and merge of Rho123 with phase contrast image, respectively. Scale bars: 50 μm. All the images are representative of at least three independent experiments. To exclude the possibility that the intracellular accumulation of Rho123 after treatment of LS180 cells with siRNAs was due to a loss of the plasma membrane integrity, we checked the membrane permeability of LS180 cells treated with each siRNA to Evans blue dye, which is absorbed by passive diffusion [22, 36]. As observed for the transfection reagent alone and negative control siRNA, siRNAs for each target gene had no influence on the intracellular accumulation of Evans blue in the presence of 70% ethanol, which was used as a positive control to disrupt the membrane integrity [41] and apparently enhanced the cellular uptake of Evans blue (Fig 7).
Fig 7

Effect of siRNA treatment on passive transport in LS180 cells.

The phase-contrast images of Evans blue accumulation in LS180 cells pretreated with 70% ethanol (EtOH) to disrupt the plasma membrane integrity and of those treated with siRNAs targeting ABCB1, ezrin, radixin, or moesin for 3 days. Scale bars: 50 μm. All the images are representative of at least three independent experiments.

Effect of siRNA treatment on passive transport in LS180 cells.

The phase-contrast images of Evans blue accumulation in LS180 cells pretreated with 70% ethanol (EtOH) to disrupt the plasma membrane integrity and of those treated with siRNAs targeting ABCB1, ezrin, radixin, or moesin for 3 days. Scale bars: 50 μm. All the images are representative of at least three independent experiments.

Discussion

In the present study, we determined the gene expression profiles of ezrin, radixin, and moesin together with that of P-gp in LS180 cells, and found them to be different from those in Caco-2 cells. Interestingly, our CLSM analysis data demonstrate for the first time that ERM are preferentially localized to the plasma membrane and are highly colocalized with P-gp. Nowak et al. indicated that in various kinds of human colon adenocarcinoma including LS180 cells, ezrin is distributed at the tips of pseudopodia, localized as a sharp ring under the cellular membrane, or is present at the edges in areas of subtle protrusions [42]. Moreover, abundant levels of radixin were detected in human colon tumor tissue [43] and also in a variety of human colon cancer cell lines [44]. Unlike LS180 cells, Caco-2 cells were deficient in moesin, which is in agreement with previous findings [45], implying a characteristic feature of LS180 cells, which carries genes for all three ERM proteins. Accumulating evidence indicates that P-gp is highly expressed not only in the cells derived from human gastrointestinal epithelium, including LS180 and Caco-2 cells [46-48], but also in the gastrointestinal tissues of rodents [49-54]. These previous findings strongly support the results obtained in the present study, indicating the gene expression pattern and subcellular localization of ERM along with P-gp in LS180 cells. To verify the role of ERM in the expression and transport activity of P-gp, we used siRNAs to silence ezrin, radixin, and moesin in LS180 cells. We validated that each siRNA targeting the ERM proteins substantially and specifically reduced the level of respective target mRNAs without causing any cytotoxicity in LS180 cells. Therefore, we succeeded in developing an in vitro experimental model to determine the role of ERM in the expression and transport function of P-gp in LS180 cells. A growing body of evidence suggests that the protein expression level and functional activity of transporters, such as P-gp, are not always dependent on their mRNA expression levels [55-57]. As localization to the plasma membrane is required for the functionality of P-gp and other transporters [13, 20, 57–61], scaffold proteins, which anchor the transporters to the surface of the plasma membrane, have been recognized as critical regulators of several transporters by post-translational modification. Notably, the ERM proteins are closely related with the localization of P-gp to the surface of the plasma membrane and with its functional activity in various kinds of tissues and cells [17, 21–25, 62–64]. In the present study, we performed gene-silencing experiments using siRNAs to investigate whether the ERM proteins functionally regulate P-gp in LS180 cells. Interestingly, siRNA against ezrin substantially decreased the cell surface expression of P-gp without affecting the levels of the ABCB1 mRNA. On the contrary, siRNAs against radixin and moesin did not cause any alterations in the levels of ABCB1 mRNA or its cell surface localization. Kobori et al. has previously shown that repeated oral administration of etoposide, an anticancer drug and a strong substrate of P-gp, to mice increases the expression of P-gp via the activation of radixin, in the plasma membrane of small intestine where the protein–protein interaction between P-gp and radixin was detected by immunoprecipitation analysis [51, 65–67]. Of note, not only radixin but also ezrin and moesin interacted with P-gp in the plasma membrane fraction of the small intestine in mice [65, 66]. Intriguingly, Jin et al. showed that the overexpression of sphingomyelin synthase 1 in Caco-2 cells substantially increases the protein expression of ezrin along with an enhancement in the protein expression and functional activity of P-gp [32]. These findings raise the possibility of a close relationship between ezrin and P-gp mediated by the potential protein–protein interaction in the plasma membrane of LS180 cells. Together these results suggest that ezrin may solely regulate the localization of P-gp to the surface of the plasma membrane, possibly by post-translational modification as a scaffold protein without influencing the regulatory mechanism for the transcription of the ABCB1 gene in LS180 cells. Another importance is that gene silencing of ezrin, but not of radixin and moesin significantly decreased the cell surface expression of P-gp without affecting the levels of the ABCB1 mRNA in LS180 cells cultured at the acidic pH condition which mimics the actual tumor microenvironment. These results are in good agreement with those observed in the normal culture condition. The extracellular acidity is a common hallmark of almost all tumors due to the accumulation of lactic acid and H+, leading to the microenvironmental acidification [28, 68, 69]. Previous studies have shown that microenvironmental acidic pH exerts divergent roles in tumor development such as invasion, dissemination, and metastasis [70-72]. Moreover, a growing body of recent evidence suggests that acquired MDR not only to a conventional chemotherapeutics but also to molecular targeted drugs can also be caused by the highly acidic microenvironment of tumors [69]. Taken together, ezrin may play a key role in the plasma membrane localization of P-gp at the acidic tumor microenvironment, leading to an acquired MDR in a variety of cancer cells. In addition, accumulated evidence suggests that ezrin plays an essential role in both the maintenance of migratory and invasive capacity of tumor cells through the specific interaction with some tumor-associated plasma membrane proteins, which leads to the metastatic behavior of tumor cells [73-75]. Therefore, ezrin may exert multiple function not only in driving the MDR but also in acquiring metastatic phenotype of cancer cells in human tumors. We also observed that the knockdown of ezrin gene, but not of radixin and moesin gene, markedly increased the intracellular accumulation of Rho123 in LS180 cells. On the contrary, no changes in the cellular uptake of Evans blue, a passive diffusion marker, were found in cells treated with siRNAs against each of the ERM proteins or P-gp, implying that an increase in the uptake rate of Rho123 induced by the silencing of ezrin gene could not arise from a disruption of membrane integrity in LS180 cells. By contrast, Yano et al. demonstrated a significant increase in the intracellular accumulation of Rho123 in Caco-2 cells upon siRNA-mediated silencing of radixin gene and a substantial decrease in the Rho123 efflux rate in the small intestine of radixin-deficient mice, indicating a reduction in the transport activity of P-gp by the knockdown and knockout of the radixin gene [22, 23, 52]. This discrepancy between the results obtained in the present and previous studies may be attributed at least in part to the different expression profile of ERM in these cell lines. In fact, as evident from the results of the present and previous studies [45, 76], the ezrin mRNA was abundantly expressed not only in LS180 cells but also in Caco-2 cells, whereas higher or lower expression of radixin was detected in Caco-2 and LS180 cells, respectively, which may lead to the variation in the scaffold protein regulating the plasma membrane localization and transport function of P-gp, although the precise details are yet to be elucidated. Taken together, ezrin might serve as an anchor protein to immobilize P-gp on the surface of the plasma membrane, which in turn maintains the transport function of P-gp in LS180 cells (Fig 8).
Fig 8

Schematic diagram of the proposed mechanism by which ezrin contributes to the cell surface localization and functionality of P-gp in LS180 cells.

Among the ERM proteins, ezrin plays a key role as an anchor protein to stabilize P-gp on the surface of the plasma membrane, which in turn regulates the transport function of P-gp in LS180 cells.

Schematic diagram of the proposed mechanism by which ezrin contributes to the cell surface localization and functionality of P-gp in LS180 cells.

Among the ERM proteins, ezrin plays a key role as an anchor protein to stabilize P-gp on the surface of the plasma membrane, which in turn regulates the transport function of P-gp in LS180 cells.

Conclusions

We demonstrate that ezrin and moesin mRNAs are abundantly expressed in LS180 cells whereas the expression of radixin mRNA is weak. Moreover, all three ERM proteins are specifically localized on the plasma membrane of LS180 cells where they are highly colocalized with P-gp. Notably, ezrin primarily regulates the cell surface localization and functionality of P-gp possibly via its post-translational modification as a scaffold protein without influencing the transcriptional level of P-gp in LS180 cells. These results raise the possibility that specific suppression of ezrin expression might increase the intracellular accumulation of P-gp substrate drugs, such as anti-cancer agents, in cancer cells, which may in turn lead to an improvement in the pharmacotherapeutic efficacy of these drugs.

Intracellular accumulation of rhodamine123 in LS180 cells after treatment with verapamil in a concentration-dependent manner.

(PDF) Click here for additional data file. 15 Mar 2021 PONE-D-21-04413 Subcellular distribution of ezrin/radixin/moesin and their roles in the cell surface localization and transport function of P-glycoprotein in human colon adenocarcinoma LS180 cells PLOS ONE Dear Dr. Obata, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Both reviewers have identified a number of issues which should be addressed if the authors plan to submit a revised manuscript. Please submit your revised manuscript by Apr 18 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols We look forward to receiving your revised manuscript. Kind regards, Salvatore V Pizzo Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Partly Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: N/A Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Subcellular d 1 istribution of ezrin/radixin/moesin and their roles in the cell surface localization and transport function of P-glycoprotein in human colon adenocarcinoma LS180 cells By Takuro Kobori, Yoko Urashima, Tokio Obata This reviewer is happy to read about the role of ERM proteins in P-gp participation to human tumor cells’ drug resistance. The issue was really warm at the beginning of 2000, with some papers showing the importance of membrane to cytoskeleton connection in P-gp-mediated drug resistance. This seemed directly related to the importance of the membrane-skeleton apparatus in allowing cellular polarization in driving many cellular funzions in both normal conditions (Fais S et al Immunology Today 1997; Parlato S et al EMBO J 2000; Luciani F et al Cell Death Diff 2004; Ramoni C et al Eur J Immunol 2002; Fais S et al J Leukoc Biol. 2003), but also in promoting the metastatic behaviour of tumor cells (Fais S Leuk Res. 2010) and the cell-in-cell phenomena (reviewed in Fais S, Overholtzer M, Nature Reviews Cancer 2018). I guess the authors should generally discuss better the importance of ERM-mediated mebrane-to-skeleton connection in both normal and tumor condition. As far as the experimental protocol is concerned, the authors should add more to the issue, that can’t be limited to the use of human colon cancer cell, inasmuc as this is a mechanism that involves virtually all cancer histotypes. One suggestion might be to consider that there is another mechanism of tumor drug resistance that while very simple per se is very efficient in rendering cancer cells resistant to chemotherapeutics actually, that is microenvironmental acidity. It has been shown that it is a very powerfull mechanism of resistance (reviewed in Pillai et al Cancer Metastasis Rev. 2019), that may overcome P-gp-mediated drug resistance as well (Luciani F et al J Natl Cancer Inst. 2004). There are models of the same cell line cultured at either the standard 7,4 pH condition or at the acidic pH of tumors (i.e. 6,5), and this includes human colon cancer as well (Logozzi M et al Cancers 2018). The authors should test the involvement of both P-gp and the ERM-mediated membrane-to-cytoskeleton connection at different pH, in order to render their findings more real. Reviewer #2: The current study elucidated the interaction of ERM and P-gp on the membrane of LS180 cells, and the authors found that ezrin but ont radixin and moesin closely regulated P-pg function parabably via protein-protein interaction. Given that P-gp inhibitors have encountered many failures, this study may provide an alternative to suppress MDR by targeting ezrin. Overall, the methods and statistical analysis are appropriate, and the writing are good. This is a well-designed and performed study. It's my opinion that it can be published after minor revison. 1, line 233, the the 2, The Figures are in low resolution that were hard to identify. 3, line 301, would it be too high concentrition of 50 μM of verapamil? 4, ABCB1 mRNA vs. P-gp mRNA, they are inconsistant in Results and Discussion (line 373) ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 31 Mar 2021 Reply comments to #Reviewer 1 We would like to thank #Reviewer 1 for valuable comments and suggestions on our manuscript. We have carefully read all of your comments and suggestions and have made the corrections in the revised version of manuscript. Detailed responses to your comments are listed below, and we highlighted all changes with word track changes in the file labeled ‘Revised Manuscript with Track Changes’. We hope this revised manuscript would be satisfactory for publication in PLoS One. Comment 1. The authors should test the involvement of both P-gp and the ERM-mediated membrane-to-cytoskeleton connection at different pH, in order to render their findings more real. Reply Comments. We would like to appreciate #Reviewer 1’s valuable suggestion. As #Reviewer 1 pointed out, we performed additional study to investigate whether ERM proteins also regulate the plasma membrane localization of P-gp under the condition at the acidic pH of tumor microenvironment. Based on the results of additional experiments, we added following sentence in the Materials and Methods, Results, Discussion, and References to the revised version of manuscript. Materials and Methods (Line 68 – 73) The acidic cell culture medium (pH 6.5) was obtained by the addition of 35–37% HCl solution to DMEM containing 1,500 mg/L glucose supplemented with heat-inactivated 10% FBS by measuring pH with a FiveEasy Plus FEP20 pH Meter (METTLER TOLEDO, Tokyo, Japan). LS180 cells were grown for a sufficient time in normal medium and were subsequently maintained in the acidic cell culture medium (pH 6.5) for a few days as described previously with some modifications [26-28]. Materials and Methods (Line 76 – 78) LS180 cells were cultured until 70–80% confluent in the normal (for all experiments) or the acidic medium (for isolation of total RNA, flow cytometric analysis, and cell viability assay), and then ~. Results (Line 304 – 355) Effect of siRNAs against each ERM on the expression levels of target mRNAs in LS180 cells under the acidic condition. To confirm whether siRNAs against each ERM have similar effects on the target mRNA in the acidic microenvironmental condition, mRNA levels of each ERM were measured 3 days after transfection of LS180 cells with the siRNAs under the acidic condition with pH 6.5. siRNAs for ezrin, radixin, and moesin achieved 74%–85% reduction in the expression of their target mRNAs compared with transfection reagent alone without any significant influence on the expression of other genes (Figs 4A–C). Notably, none of the siRNAs used in this study also altered the viability of LS180 cells under the acidic condition with pH 6.5 (Fig 4D). Fig 4. Effect of siRNAs Targeting Ezrin, Radixin, or Moesin on the mRNA Expression of Ezrin, Radixin, and Moesin (ERM) in LS180 cells under the Acidic Condition. Cells were treated with the transfection medium (Untreated), transfection reagent (Lipofectamine), nontargeting control (NC) siRNA, and specific siRNAs for ezrin, radixin, or moesin and then incubated for 3 days under the acidic condition with pH 6.5. (A–C) Expression of each mRNA in the cells treated with siRNAs relative to that in cells treated with the transfection reagent alone was measured by real-time quantitative reverse transcription-polymerase chain reaction. n = 3, **p < 0.01, *p < 0.05 vs. Lipofectamine. (D) Cell viability was assessed with the PrestoBlue cell viability reagent. Staurosporine was used as a positive control for inducing cell death. n = 6, ***p < 0.001 vs. Lipofectamine. All data are expressed as the mean ± SEM and were analyzed by one-way ANOVA followed by Tukey’s test. Effect of ERM Silencing on the Expression of P-gp in LS180 Cells under the acidic condition. We asked whether the gene silencing of ezrin, radixin, and moesin influence the level of ABCB1 mRNA and the expression of P-gp on the surface of the plasma membrane in LS180 cells under the acidic condition. None of these siRNAs had any effect on the levels of ABCB1 mRNA, whereas the siRNA against ABCB1 significantly decreased the levels of ABCB1 mRNA, compared to that in cells treated with the transfection reagent alone (Fig 5A). The results of flow cytometric analysis showed that silencing of ezrin, but not of radixin and moesin, significantly decreased the expression of P-gp on the surface of the plasma membrane to the same level as did the silencing of ABCB1 (Figs 5B, C). Fig 5. Effect of siRNAs Targeting Ezrin, Radixin, or Moesin on the ABCB1 mRNA and P-gp Expression on the Surface of LS180 cells under the Acidic Condition. Cells were treated with the transfection medium (Untreated), transfection reagent (Lipofectamine), nontargeting control (NC) siRNA, and specific siRNAs for ABCB1, ezrin, radixin, or moesin and then incubated for 3 days under the acidic condition with pH 6.5. (A) The expression of ABCB1 mRNA in cells treated with each siRNA relative to that in cells treated with the transfection reagent alone was determined by real-time quantitative reverse transcription-polymerase chain reaction. n = 3, ***p < 0.001 vs. Lipofectamine. (B) An overlay of the representative histograms for the expression peak of Alexa Fluor 488-labeled P-gp on the surface of the plasma membrane of LS180 cells treated with the transfection medium (Untreated; black line), transfection reagent (Lipofectamine; gray line), ABCB1 siRNA (purple line), and ezrin siRNA (pink line), as measured by flow cytometry. The calculated relative mean fluorescence intensity peaks of P-gp on the surface of the plasma membrane for all the treatments are shown in (C). n = 4, **p < 0.01, *p < 0.05 vs. Lipofectamine. All data are expressed as the mean ± SEM and were analyzed by a one-way ANOVA followed by Tukey’s test. Figure 4 and 5 (See attached file named Fig 4 and Fig 5) Discussion (Line 453 – 466) Another importance is that gene silencing of ezrin, but not of radixin and moesin significantly decreased the cell surface expression of P-gp without affecting the levels of the ABCB1 mRNA in LS180 cells cultured at the acidic pH condition which mimics the actual tumor microenvironment. These results are in good agreement with those observed in the normal culture condition. The extracellular acidity is a common hallmark of almost all tumors due to the accumulation of lactic acid and H+, leading to the microenvironmental acidification [28, 68, 69]. Previous studies have shown that microenvironmental acidic pH exerts divergent roles in tumor development such as invasion, dissemination, and metastasis [70-72]. Moreover, a growing body of recent evidence suggests that acquired MDR not only to a conventional chemotherapeutics but also to molecular targeted drugs can also be caused by the highly acidic microenvironment of tumors [69]. Taken together, ezrin may play a key role in the plasma membrane localization of P-gp at the acidic tumor microenvironment, leading to an acquired MDR in a variety of cancer cells. References (Line 610 – 622, and Line 788 – 806) 26. Logozzi M, Angelini DF, Iessi E, Mizzoni D, Di Raimo R, Federici C, et al. Increased PSA expression on prostate cancer exosomes in in vitro condition and in cancer patients. Cancer Lett. 2017;403:318-29. Epub 2017/07/12. doi: 10.1016/j.canlet.2017.06.036. PubMed PMID: 28694142. 27. Logozzi M, Mizzoni D, Angelini DF, Di Raimo R, Falchi M, Battistini L, et al. Microenvironmental pH and Exosome Levels Interplay in Human Cancer Cell Lines of Different Histotypes. Cancers (Basel). 2018;10(10). Epub 2018/10/12. doi: 10.3390/cancers10100370. PubMed PMID: 30301144. 28. Boussadia Z, Lamberti J, Mattei F, Pizzi E, Puglisi R, Zanetti C, et al. Acidic microenvironment plays a key role in human melanoma progression through a sustained exosome mediated transfer of clinically relevant metastatic molecules. J Exp Clin Cancer Res. 2018;37(1):245. Epub 2018/10/07. doi: 10.1186/s13046-018-0915-z. PubMed PMID: 30290833. 68. Cairns RA, Harris IS, Mak TW. Regulation of cancer cell metabolism. Nat Rev Cancer. 2011;11(2):85-95. Epub 2011/01/25. doi: 10.1038/nrc2981. PubMed PMID: 21258394. 69. Pillai SR, Damaghi M, Marunaka Y, Spugnini EP, Fais S, Gillies RJ. Causes, consequences, and therapy of tumors acidosis. Cancer Metastasis Rev. 2019;38(1-2):205-22. Epub 2019/03/27. doi: 10.1007/s10555-019-09792-7. PubMed PMID: 30911978. 70. Robey IF, Baggett BK, Kirkpatrick ND, Roe DJ, Dosescu J, Sloane BF, et al. Bicarbonate increases tumor pH and inhibits spontaneous metastases. Cancer Res. 2009;69(6):2260-8. Epub 2009/03/12. doi: 10.1158/0008-5472.CAN-07-5575. PubMed PMID: 19276390. 71. Estrella V, Chen T, Lloyd M, Wojtkowiak J, Cornnell HH, Ibrahim-Hashim A, et al. Acidity generated by the tumor microenvironment drives local invasion. Cancer Res. 2013;73(5):1524-35. Epub 2013/01/05. doi: 10.1158/0008-5472.CAN-12-2796. PubMed PMID: 23288510. 72. Rofstad EK, Mathiesen B, Kindem K, Galappathi K. Acidic extracellular pH promotes experimental metastasis of human melanoma cells in athymic nude mice. Cancer Res. 2006;66(13):6699-707. Epub 2006/07/05. doi: 10.1158/0008-5472.CAN-06-0983. PubMed PMID: 16818644. Reply comments to #Reviewer 2 We would like to thank #Reviewer 2 for constructive opinion and evaluation on our manuscript. We have carefully read all of your comments and suggestions and have incorporated them into the revised version of manuscript. Detailed responses to your comments are listed below, and we highlighted all changes with word track changes in the file labeled ‘Revised Manuscript with Track Changes’. We hope this revised manuscript would be satisfactory for publication in PLoS One. Comment 1, line 233, the the Reply Comments. As #Reviewer 2 pointed out, we corrected a typo. Thank you for careful reading. Comment 2, The Figures are in low resolution that were hard to identify. Reply Comments. We are sorry it is a bit hard to see the figure in the PDF file because figure resolutions are very low. Therefore, we revised all Figures fallen within the size, dimensions, and resolution using PACE assistance system according to the instruction of this journal as far as possible in the revised version. Comment 3, line 301, would it be too high concentration of 50 μM of verapamil? Reply Comments. With respect to the concentration of verapamil used in this study, 50 μM of verapamil is often used in the in vitro experiments to inhibit the transport activity of P-gp in many previous studies [1-6]. However, as #Reviewer 2 pointed out, we think that 50 μM of verapamil seems to be a relatively high concentration after careful consideration. Therefore, we performed additional experiments to determine whether lower concentration of verapamil also inhibits the transport activity of P-gp, leading to the accumulation of Rho123, a typical fluorescence substrate for P-gp, in LS180 cells by confocal laser scanning microscopy analysis. Based on the results of additional experiments, we added following sentence and figure in the Results and Supporting Information (S1 Fig. and S1 File Supplemental materials and methods) to the revised version of manuscript. References for this comment 1. Jodoin J, Demeule M, Beliveau R. Inhibition of the multidrug resistance P-glycoprotein activity by green tea polyphenols. Biochim Biophys Acta. 2002;1542(1-3):149-59. Epub 2002/02/21. doi: 10.1016/s0167-4889(01)00175-6. PubMed PMID: 11853888. 2. Rigalli JP, Ruiz ML, Perdomo VG, Villanueva SS, Mottino AD, Catania VA. Pregnane X receptor mediates the induction of P-glycoprotein by spironolactone in HepG2 cells. Toxicology. 2011;285(1-2):18-24. Epub 2011/04/05. doi: 10.1016/j.tox.2011.03.015. PubMed PMID: 21459122. 3. Shang H, Wang Z, Ma H, Sun Y, Ci X, Gu Y, et al. Influence of verapamil on the pharmacokinetics of rotundic acid in rats and its potential mechanism. Pharm Biol. 2021;59(1):200-8. Epub 2021/02/18. doi: 10.1080/13880209.2021.1871634. PubMed PMID: 33595422. 4. Zhao L, Zhao Y, Schwarz B, Mysliwietz J, Hartig R, Camaj P, et al. Verapamil inhibits tumor progression of chemotherapy-resistant pancreatic cancer side population cells. Int J Oncol. 2016;49(1):99-110. Epub 2016/05/14. doi: 10.3892/ijo.2016.3512. PubMed PMID: 27177126. 5. Zhou Y, Song X, Dong G. Effects of verapamil on the pharmacokinetics of puerarin in rats. Xenobiotica. 2019;49(10):1178-82. Epub 2018/09/04. doi: 10.1080/00498254.2018.1518552. PubMed PMID: 30173622. 6. Zhang Y, Li J, Lei X, Zhang T, Liu G, Yang M, et al. Influence of Verapamil on Pharmacokinetics of Triptolide in Rats. Eur J Drug Metab Pharmacokinet. 2016;41(4):449-56. Epub 2015/04/10. doi: 10.1007/s13318-015-0275-4. PubMed PMID: 25854676. Results (Line 371 – 373) Of note, we validated that treatment of LS180 cell with 5, 10, and 50 μM of verapamil dose-dependently increased the uptake capacity of Rho123 (S1 Fig.). Supporting information (an attached PDF file named S1_fig.) Supplemental materials and methods Rho123 accumulation study LS180 cells were seeded at a density of 1.0 × 105 cells/dish in polylysine-coated 35-mm glass bottom dish with 14 mm inner diameter (Matsunami Glass, Osaka, Japan) and were incubated overnight at 37°C in a humidified atmosphere with 5% CO2 to allow for attachment. Then cells were pretreated with 5, 10 or 50 μM of verapamil (FUJIFILM Wako Pure Chemical, Osaka, Japan), a classical inhibitor of the P-gp function, for 30 min followed by incubation with 10 μM of Rhodamine123 (Merck, Darmstadt, Germany) as a P-gp substrate in the dark for 2 h at 37°C in a humidified atmosphere with 5% CO2. After washing the cells with D-PBS for three times, photomicrographs were taken at 0.5–1.0-μm intervals for z-axis at an original magnification of 20× with a Nikon A1 confocal laser microscope system (Nikon Instruments, Tokyo, Japan). The two- or three-dimensional images were reconstructed from the obtained pictures using the NIS-Elements Ar Analysis software (Nikon Instruments). Supplemental figure S1 Fig. Intracellular Accumulation of Rhodamine123 in LS180 Cells after Treatment with Verapamil in a Concentration-dependent Manner. Cells were treated with verapamil at a concentration of 5, 10, and 50 μM and then incubated for 30 min followed by incubation with 10 μM of Rhodamine (Rho) 123. Representative confocal laser scanning microscopy images of fluorescent Rho123 and of each overlay with phase contrast in LS180 cells. Upper and lower panels indicate Rho123 and merge of Rho123 with phase contrast image, respectively. Scale bars: 50 μm. All the images are representative of at least three independent experiments. Comment 4, ABCB1 mRNA vs. P-gp mRNA, they are inconsistent in Results and Discussion (line 373) Reply Comments. As #Reviewer 2 pointed out, we corrected P-gp mRNA into a suitable expression, i.e., ABCB1 mRNA and used the same terms throughout the document. Thank you for careful reading. Submitted filename: Response to reviewers_Kobori et al..docx Click here for additional data file. 8 Apr 2021 PONE-D-21-04413R1 Subcellular distribution of ezrin/radixin/moesin and their roles in the cell surface localization and transport function of P-glycoprotein in human colon adenocarcinoma LS180 cells PLOS ONE Dear Dr. Obata, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Your manuscript is essentially acceptable for publication but Reviewer 1 feels that four publications should be cited in your paper.  I would greatly appreciate your consideration of this request. Please submit your revised manuscript by May 23 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Salvatore V Pizzo Academic Editor PLOS ONE Journal Requirements: Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed Reviewer #2: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: N/A Reviewer #2: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The revision has been fairly performed in addressing the raised points. The authors missed to quote some previous papers, that should be included and commented in the revised version, including: 1. Luciani F, Molinari A, Lozupone F, Calcabrini A, Lugini L, Stringaro A, Puddu P, Arancia G, Cianfriglia M, Fais S. P-glycoprotein-actin association through ERM family proteins: A role in P-glycoprotein function in human cells of lymphoid origin. Blood. 2002;99(2):641-648. 2. Fais S. A role for ezrin in a neglected metastatic tumor function. Trends Mol Med. 2004;10(6):249-250. 3. Brambilla D, Fais S. The janus-faced role of ezrin in "linking" cells to either normal or metastatic phenotype. Int J Cancer. 2009;125(10):2239-2245. 4. Federici C, Brambilla D, Lozupone F, Matarrese P, de Milito A, Lugini L, Iessi E, Cecchetti S, Marino M, Perdicchio M, Logozzi M, Spada M, Malorni W, Fais S. Pleiotropic function of ezrin in human metastatic melanomas. Int J Cancer. 2009;124(12):2804-2812. Reviewer #2: Thank you for the revision which addressed all the issues. Some of the Figures are still in low resolusion, while that may due to the different softwares. It's my opinion that it's now ready for publication. ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 8 Apr 2021 Reply comments to #Reviewer 1 We would like to thank #Reviewer 1 for valuable suggestions and suggestions on our revised version of manuscript. We have carefully read your comments and suggestions and have made the corrections in the revised version of manuscript. Detailed responses to your comments are listed below, and we highlighted all changes with word track changes in the file labeled ‘Revised Manuscript with Track Changes’. We hope this revised manuscript would be satisfactory for publication in PLoS One. Comment. The authors missed to quote some previous papers, that should be included and commented in the revised version, including: 1. Luciani F, Molinari A, Lozupone F, Calcabrini A, Lugini L, Stringaro A, Puddu P, Arancia G, Cianfriglia M, Fais S. P-glycoprotein-actin association through ERM family proteins: A role in P-glycoprotein function in human cells of lymphoid origin. Blood. 2002;99(2):641-648. 2. Fais S. A role for ezrin in a neglected metastatic tumor function. Trends Mol Med. 2004;10(6):249-250. 3. Brambilla D, Fais S. The janus-faced role of ezrin in "linking" cells to either normal or metastatic phenotype. Int J Cancer. 2009;125(10):2239-2245. 4. Federici C, Brambilla D, Lozupone F, Matarrese P, de Milito A, Lugini L, Iessi E, Cecchetti S, Marino M, Perdicchio M, Logozzi M, Spada M, Malorni W, Fais S. Pleiotropic function of ezrin in human metastatic melanomas. Int J Cancer. 2009;124(12):2804-2812. Reply Comments. We would like to appreciate #Reviewer 1’s valuable suggestion. As #Reviewer 1 pointed out, we performed additional study to investigate whether ERM proteins also regulate the plasma membrane localization of P-gp under the condition at the acidic pH of tumor microenvironment. Based on the results of additional experiments, we added following sentence in the Introduction, Discussion, and References to the revised version of manuscript. Introduction (Line 45 – 50) The members of the ezrin/radixin/moesin (ERM) family of proteins act as linkers between the actin cytoskeleton and various plasma membrane proteins, including P-gp, multidrug resistant protein-2, and epidermal growth factor receptor 2 [19-21]. Several recent studies have demonstrated that ERM play a critical role in the maintenance of cell surface membrane localization and drug efflux function of P-gp in a variety of cancer cells [17, 21-25]. Discussion (Line 467 – 472) In addition, accumulated evidence suggests that ezrin plays an essential role in both the maintenance of migratory and invasive capacity of tumor cells through the specific interaction with some tumor-associated plasma membrane proteins, which leads to the metastatic behavior of tumor cells [73-75]. Therefore, ezrin may exert multiple function not only in driving the MDR but also in acquiring metastatic phenotype of cancer cells in human tumors. References (Line 596 – 599, and Line 813 – 822) 21. Luciani F, Molinari A, Lozupone F, Calcabrini A, Lugini L, Stringaro A, et al. P-glycoprotein-actin association through ERM family proteins: a role in P-glycoprotein function in human cells of lymphoid origin. Blood. 2002;99(2):641-8. Epub 2002/01/10. PubMed PMID: 11781249. 73. Federici C, Brambilla D, Lozupone F, Matarrese P, de Milito A, Lugini L, et al. Pleiotropic function of ezrin in human metastatic melanomas. Int J Cancer. 2009;124(12):2804-12. Epub 2009/02/25. doi: 10.1002/ijc.24255. PubMed PMID: 19235924. 74. Brambilla D, Fais S. The Janus-faced role of ezrin in "linking" cells to either normal or metastatic phenotype. Int J Cancer. 2009;125(10):2239-45. Epub 2009/07/10. doi: 10.1002/ijc.24734. PubMed PMID: 19588507. 75. Fais S. A role for ezrin in a neglected metastatic tumor function. Trends Mol Med. 2004;10(6):249-50. Epub 2004/06/05. doi: 10.1016/j.molmed.2004.04.005. PubMed PMID: 15177187. Reply comments to #Reviewer 2 We would like to thank #Reviewer 2 for constructive comments through the review process. 16 Apr 2021 Subcellular distribution of ezrin/radixin/moesin and their roles in the cell surface localization and transport function of P-glycoprotein in human colon adenocarcinoma LS180 cells PONE-D-21-04413R2 Dear Dr. Obata, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Salvatore V Pizzo Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: N/A ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: (No Response) ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No 30 Apr 2021 PONE-D-21-04413R2 Subcellular distribution of ezrin/radixin/moesin and their roles in the cell surface localization and transport function of P-glycoprotein in human colon adenocarcinoma LS180 cells Dear Dr. Obata: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Salvatore V Pizzo Academic Editor PLOS ONE
  76 in total

Review 1.  ERM proteins and merlin: integrators at the cell cortex.

Authors:  Anthony Bretscher; Kevin Edwards; Richard G Fehon
Journal:  Nat Rev Mol Cell Biol       Date:  2002-08       Impact factor: 94.444

2.  Comparison of PrestoBlue and MTT assays of cellular viability in the assessment of anti-proliferative effects of plant extracts on human endothelial cells.

Authors:  Magdalena Boncler; Marek Różalski; Urszula Krajewska; Anna Podsędek; Cezary Watala
Journal:  J Pharmacol Toxicol Methods       Date:  2013-10-06       Impact factor: 1.950

Review 3.  Microparticles in cancer: A review of recent developments and the potential for clinical application.

Authors:  Joyce Gong; Ritu Jaiswal; Penelope Dalla; Frederick Luk; Mary Bebawy
Journal:  Semin Cell Dev Biol       Date:  2015-04-03       Impact factor: 7.727

4.  Resistance: Following different paths.

Authors:  Sarah Seton-Rogers
Journal:  Nat Rev Cancer       Date:  2016-03       Impact factor: 60.716

Review 5.  Chemical molecular-based approach to overcome multidrug resistance in cancer by targeting P-glycoprotein (P-gp).

Authors:  Hang Zhang; Haiwei Xu; Charles R Ashby; Yehuda G Assaraf; Zhe-Sheng Chen; Hong-Min Liu
Journal:  Med Res Rev       Date:  2020-10-12       Impact factor: 12.944

6.  Involvement of PtdIns(4,5)P2 in the regulatory mechanism of small intestinal P-glycoprotein expression.

Authors:  Takuro Kobori; Shinichi Harada; Kazuo Nakamoto; Shogo Tokuyama
Journal:  J Pharm Sci       Date:  2013-12-05       Impact factor: 3.534

7.  P-glycoprotein binds to ezrin at amino acid residues 149-242 in the FERM domain and plays a key role in the multidrug resistance of human osteosarcoma.

Authors:  Daria Brambilla; Silvia Zamboni; Cristina Federici; Luana Lugini; Francesco Lozupone; Angelo De Milito; Serena Cecchetti; Maurizio Cianfriglia; Stefano Fais
Journal:  Int J Cancer       Date:  2011-10-20       Impact factor: 7.396

Review 8.  Tyrosine kinase inhibitors as modulators of ABC transporter-mediated drug resistance.

Authors:  Suneet Shukla; Zhe-Sheng Chen; Suresh V Ambudkar
Journal:  Drug Resist Updat       Date:  2012-02-09       Impact factor: 18.500

9.  Regulation of breast cancer resistance protein and P-glycoprotein by ezrin, radixin and moesin in lung, intestinal and renal cancer cell lines.

Authors:  Kentaro Yano; Chiaki Okabe; Kenta Fujii; Yuko Kato; Takuo Ogihara
Journal:  J Pharm Pharmacol       Date:  2020-01-24       Impact factor: 3.765

View more
  1 in total

Review 1.  Pathophysiological Roles of Actin-Binding Scaffold Protein, Ezrin.

Authors:  Kotoku Kawaguchi; Shinji Asano
Journal:  Int J Mol Sci       Date:  2022-03-17       Impact factor: 5.923

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.