Literature DB >> 33972254

Antifungal Susceptibility and Mutations in the Squalene Epoxidase Gene in Dermatophytes of the Trichophyton mentagrophytes Species Complex.

Xue Kong1,2, Chao Tang2, Ashutosh Singh3, Sarah A Ahmed2, Abdullah M S Al-Hatmi2,4, Anuradha Chowdhary3, Pietro Nenoff5, Yvonne Gräser6, Steven Hainsworth7, Ping Zhan8, Jacques F Meis2,9, Paul E Verweij2, Weida Liu1,10,11, G Sybren de Hoog1,2.   

Abstract

During the past decade, a prolonged and serious outbreak of dermatophytosis due to a terbinafine-resistant novel species in the Trichophyton mentagrophytes-T. interdigitale complex has been ongoing in India, and it has spread to several European countries. The objective of this study was to investigate the molecular background of the squalene epoxidase (SQLE) gene in order to understand the risk of emergence and spread of multiresistance in dermatophytes. Antifungal susceptibility to fluconazole, griseofulvin, itraconazole, ketoconazole, miconazole, naftifine, sertaconazole, and terbinafine was tested in 135 isolates from India, China, Australia, Germany, and The Netherlands. Based on the latest taxonomic insights, strains were identified as three species: T. mentagrophytes sensu stricto (n = 35), T. indotineae (n = 64, representing the Indian clone), and T. interdigitale sensu stricto (n = 36). High MICs of terbinafine (>16 mg/liter) were found in 34 (53%) T. indotineae isolates. These isolates showed an amino acid substitution in the 397th position of the SQLE gene. Elevated MICs of terbinafine (0.5 mg/liter) were noted in 2 (3%) T. indotineae isolates; these isolates lead to Phe415Val and Leu393Ser of the SQLE gene. The stability of the effect of the mutations was proven by serial transfer on drug-free medium. Lys276Asn and Leu419Phe substitutions were found in susceptible T. mentagrophytes strains. The Phe377Leu/Ala448Thr double mutant showed higher MIC values for triazoles. High MICs of terbinafine are as yet limited to T. indotineae and are unlikely to be distributed throughout the T. mentagrophytes species complex by genetic exchange.

Entities:  

Keywords:  Trichophyton mentagrophytes-T. interdigitale complex; antifungal susceptibility testing; squalene epoxidase gene

Mesh:

Substances:

Year:  2021        PMID: 33972254      PMCID: PMC8284460          DOI: 10.1128/AAC.00056-21

Source DB:  PubMed          Journal:  Antimicrob Agents Chemother        ISSN: 0066-4804            Impact factor:   5.191


INTRODUCTION

Dermatophyte infections are among the most frequent fungal disorders of humans worldwide. Classically, dermatophytoses are easily cured with a wide range of topical and oral antifungal drugs. However, the recent emergence of terbinafine (TBF)-resistant strains of the Trichophyton mentagrophytes species complex in India has raised concern (1). The strains were initially denominated “type VIII” based on ribosomal internal transcribed spacer (ITS) sequencing data. Confusion arose as to whether the strains should be identified as Trichophyton interdigitale (2–4) or T. mentagrophytes (3, 4). Whole-genome analysis of Indian T. mentagrophytes-T. interdigitale species complex isolates revealed that all these isolates were distinct from the T. mentagrophytes-T. interdigitale species of the genus (5). Consequently, Kano et al. (6) described a novel species, Trichophyton indotineae, which matches the genotype of the Indian T. mentagrophytes-T. interdigitale species complex. In addition, recent multilocus, phenotypic, and clinical data have shown that the maintenance of T. indotineae as a separate genotype is justified (7). Trichophyton indotineae has already spread to other countries such as Belgium (8), Germany (9), Japan (6, 10), Denmark (11), Iran (12), Finland (13), Switzerland (14), and Bahrain (15). The most likely scenario is that these resistant strains were imported from the Indian subcontinent and transmitted between humans. The origin and mechanisms of increasing terbinafine-resistant dermatophytes are not well understood. It has been suggested that wide abuse of over-the-counter topical steroid creams with terbinafine has triggered resistance, but a zoonotic origin might also be considered, which is not yet proven. The aims of our experiments are to (i) detect the frequency of terbinafine-resistant Trichophyton strains outside India, (ii) conduct antifungal susceptibility testing (AFST) based on the new taxonomy, (iii) establish whether resistance to terbinafine can be attributed to mutations in the squalene epoxidase (SQLE) gene, and (iv) evaluate the genetic stability of terbinafine resistance.

RESULTS

Identity and AFST.

Using internal transcribed spacer (ITS) and high-mobility-group (HMG) sequencing, isolates were identified as T. indotineae (n = 64), T. interdigitale sensu stricto (n = 36), and T. mentagrophytes sensu stricto (n = 35). All strains from India were “T. mentagrophytes ITS type VIII,” now known as T. indotineae. In vitro antifungal susceptibility profiles of 135 Trichophyton isolates are summarized in Table 1. The geometric mean (GM) MICs for T. indotineae were observed to be 1.92 mg/liter for naftifine (NAF), 0.15 mg/liter for itraconazole (ITZ), 0.70 mg/liter for miconazole (MCZ), 0.37 mg/liter for ketoconazole (KTZ), 1.46 mg/liter for TBF, 1.16 mg/liter for sertaconazole (SCZ), 9.72 mg/liter for fluconazole (FCZ), and 3.96 mg/liter for griseofulvin (GRI); those for T. interdigitale were 0.06 mg/liter for NAF, 0.13 mg/liter for ITZ, 0.40 mg/liter for MCZ, 0.32 mg/liter for KTZ, 0.02 mg/liter for TBF, 1.47 mg/liter for SCZ, 1.92 mg/liter for FCZ, and 2.12 mg/liter for GRI; and those for T. mentagrophytes were 0.04 mg/liter for NAF, 0.17 mg/liter for ITZ, 0.44 mg/liter for MCZ, 0.23 mg/liter for KTZ, 0.03 mg/liter for TBF, 1.06 mg/liter for SCZ, 1.78 mg/liter for FCZ, and 5.94 mg/liter for GRI. All isolates identified as T. interdigitale and T. mentagrophytes were susceptible to TBF (MIC range, 0.016 to 0.0625 mg/liter; MIC90, 0.06 mg/liter). High MICs (>16 mg/liter) of TBF were noted in 34 (53%) T. indotineae isolates (Fig. 1). Elevated MICs of TBF (0.5 mg/liter) were noted in two isolates (3%), and low MICs of TBF (0.125 to 0.25 mg/liter) were noted in two strains (3%) of T. indotineae. All isolates with high TBF MICs also showed high MICs of NAF. T. indotineae had the highest GM (9.7 mg/liter) for FCZ, compared to T. interdigitale (GM of 1.9 mg/liter) and T. mentagrophytes (GM of 1.7 mg/liter). We performed a Kruskal-Wallis test comparing MIC values for FCZ among these three species, which yielded significant differences for T. indotineae compared with the other species (H = 46.347; P < 0.001). A total of 50 Trichophyton isolates were tested for the ability to grow on RPMI 1640 agar containing 0.2 mg/liter TBF and 4 mg/liter ITZ. All isolates with an MIC of ≥0.25 mg/liter of TBF (n = 37) grew well on RPMI 1640 agar containing 0.2 mg/liter TBF, while isolates with MICs of ≤0.125 mg/liter did not grow on this medium (see Table S2 in the supplemental material). None of the strains grew on RPMI 1640 agar containing ITZ.
TABLE 1

MIC distributions of Trichophyton species (n = 135) against eight drugs

Species and parameterValue (mg/liter)
NAFITZMCZKTZTBFSCZFCZGRI
T. indotineae (n = 64)
 GM1.920.150.700.371.461.169.723.96
 MIC5016.000.131.000.50>161.0016.004.00
 MIC90>160.252.001.00>162.00>328.00
 Range0.016 to >160.016 to 20.125 to 40.063 to 40.016 to >160.25 to 20.5 to >322 to >32
T. interdigitale (n = 36)
 GM0.060.130.400.320.021.471.922.12
 MIC500.060.130.250.250.022.002.002.00
 MIC900.060.251.001.000.032.008.004.00
 Range0.031 to 0.1250.031 to 0.50.0625 to 20.125 to 20.016 to 0.06250.25 to 40.25 to 160.25 to 8
T. mentagrophytes (n = 35)
 GM0.040.170.440.230.031.061.785.94
 MIC500.060.250.500.250.032.002.004.00
 MIC900.061.002.001.000.034.0016.00>32
 Range0.016 to 0.06250.016 to 10.031 to 20.016 to 20.016 to 0.06250.0625 to 40.25 to 161 to >32

NAF, naftifine; ITZ, itraconazole; MCZ, miconazole; KTZ, ketoconazole; TBF, terbinafine; SCZ, sertaconazole; FCZ, fluconazole; GRI, griseofulvin; GM, geometric mean.

FIG 1

Distribution of terbinafine MIC values in different species. MICs of terbinafine in T. mentagrophytes and T. interdigitale do not exceed 0.125 mg/liter. Terbinafine-resistant strains are limited to T. indotineae s.str. (sensu stricto).

Distribution of terbinafine MIC values in different species. MICs of terbinafine in T. mentagrophytes and T. interdigitale do not exceed 0.125 mg/liter. Terbinafine-resistant strains are limited to T. indotineae s.str. (sensu stricto). MIC distributions of Trichophyton species (n = 135) against eight drugs NAF, naftifine; ITZ, itraconazole; MCZ, miconazole; KTZ, ketoconazole; TBF, terbinafine; SCZ, sertaconazole; FCZ, fluconazole; GRI, griseofulvin; GM, geometric mean.

SQLE gene analysis.

Missense mutations leading to substituted amino acids in the SQLE protein were documented (Table 2). Thirty-four (53.13%) resistant T. indotineae strains had one of the previously recognized amino acid substitutions (Phe397Leu, mutation 1189T>C, 1191C>A, or 1191C>G) leading to a TBF-resistant phenotype and MICs of ≥16 mg/liter. Nine (26.5%) of these strains also carried an Ala448Thr substitution. Isolates with Phe415Val (n = 1) or Leu393Ser (n = 1) showed TBF MICs of 0.5 mg/liter. One isolate (MIC of 0.125 mg/liter) showed the mutation His440Tyr, but surprisingly, 15 other susceptible strains (MICs of 0.062 to 0.125 mg/liter) of T. indotineae had an additional specific amino acid substitution, Ala448Thr. Given the susceptible strains of T. indotineae with this mutation, we investigated whether other susceptible strains of T. mentagrophytes have the same amino acid substitution. We detected 10 strains from China with two undescribed missense mutations with substituted amino acids (Lys276Asn and Leu419Phe) in T. mentagrophytes; these strains had a susceptible phenotype (TBF MIC of 0.031 mg/liter). Comparison of AFST after 10 sequential passages on potato dextrose agar (PDA) drug-free medium revealed no difference in MIC ranges and GM values between 0 and 10 exposures (Table 3 and Fig. 2).
TABLE 2

Missense mutations in the coding region of the SQLE gene with amino acid substitutions in the SQLE enzyme

Missense mutation(s) of SQLEAmino acid substitution(s)GenBank accession no.OriginGenotypeMIC (mg/liter)No. of strainsFrequency (%)
1189T>CPhe397LeuMW187980IndiaT. indotineae>162335.90
1191C>APhe397LeuMW188000IndiaT. indotineae>1623.13
1189T>C, 1342G>APhe397Leu, Ala448ThrMW187987IndiaT. indotineae>1657.81
1191C>A, 1342G>APhe397Leu, Ala448ThrMW187998IndiaT. indotineae>1623.13
1191C>G, 1342G>APhe397Leu, Ala448ThrMW188003IndiaT. indotineae>1623.13
1243T>GPhe415ValMW188016IndiaT. indotineae0.511.56
1178T>CLeu393SerMW188020IndiaT. indotineae0.511.56
1318C>THis440TyrMW187976IndiaT. indotineae0.12511.56
1342G>AAla448ThrMW187981IndiaT. indotineae0.0625–0.251523.4
828G>C, 1255C>TLys276Asn, Leu419PheMW188025ChinaT. mentagrophytes0.03110
TABLE 3

Comparison of AFST results after 10 sequential passages on PDA drug-free medium

ParameterValue (mg/liter)
NAFITZMCZKTZTBFSCZFCZGRI
TBF-resistant species (n = 13)
 GM>160.1911.0550.474>161.37724.5113.409
 MIC50>160.12510.5>161324
 MIC90>160.521>162>324
 Range16 to >160.0625 to 10.5 to 20.25 to 1>161 to 216 to >322 to 4
 Passage 10 times (n = 13)
  GM>160.2251.2380.653>161.45228.7635.222
  MIC50>160.12510.5>161324
  MIC90>160.521>162>324
  Range16 to >160.0625 to 11 to 20.5 to 1>161 to 216 to >324 to 8
TBF-susceptible species (n = 3)
 GM0.1570.2501.2600.6300.0991.5872.5202.000
 Range0.0625 to 0.250.125 to 0.51 to 20.25 to 20.0625 to 0.1251 to 22 to 42.000
 Passage 10 times (n = 3)
  GM0.1570.2501.0000.3150.0992.0000.5003.175
  Range0.031 to 0.50.125 to 0.51.0000.25 to 0.50.0625 to 0.1251 to 40.5002 to 4

The MICs of eight drugs show no statistical difference between 0 and 10 exposures.

FIG 2

Comparison of AFST after 10 sequential passages on PDA drug-free medium. Geometric means of different drugs show no difference between 0 and 10 exposures.

Comparison of AFST after 10 sequential passages on PDA drug-free medium. Geometric means of different drugs show no difference between 0 and 10 exposures. Missense mutations in the coding region of the SQLE gene with amino acid substitutions in the SQLE enzyme Comparison of AFST results after 10 sequential passages on PDA drug-free medium The MICs of eight drugs show no statistical difference between 0 and 10 exposures.

Triazole susceptibility.

MIC values for ITZ and FCZ between Trichophyton strains exhibited the four most prevalent SQLE genotypes: Phe397Leu with concurrent Ala448Thr, Ala448Thr, Phe397Leu, and no mutation. We performed a Kruskal-Wallis test, which yielded significant differences among genotypes for FCZ (H = 36.54; P < 0.001). The MICs of the triazole FCZ in strains carrying the SQLE double substitution Phe397Leu/Ala448Thr were much higher than those in strains with single Phe397Leu or Ala448Thr substitutions and no mutation (Fig. 3). For ITZ, there is no statistical difference among genotypes (P > 0.05). For FCZ, the GM values in strains with the single Phe397Leu mutation were much higher than those in strains with the single Ala448Thr mutation or no mutation. This suggests that the Ala448Thr mutation is not directly responsible for the increase in resistance against FCZ, with a second, thus-far-unknown factor being needed for the resistant phenotype.
FIG 3

Comparison of amino acid substitutions in the SQLE gene influencing triazoles. The double-amino-acid substitution (Phe397Leu and Ala448Thr) shows higher MIC values of FCZ and ITZ than the single mutations. No statistical difference is observed between the amino acid substitution Ala448Thr and no mutation.

Comparison of amino acid substitutions in the SQLE gene influencing triazoles. The double-amino-acid substitution (Phe397Leu and Ala448Thr) shows higher MIC values of FCZ and ITZ than the single mutations. No statistical difference is observed between the amino acid substitution Ala448Thr and no mutation.

DISCUSSION

In our experiments, we used dermatophyte strains of the T. mentagrophytes species complex originating from three continents (i.e., China, India, Australia, Germany, and The Netherlands). Strains were grouped into three species, T. indotineae, T. interdigitale sensu stricto, and T. mentagrophytes sensu stricto, based on the latest taxonomic insights (6, 7). Comparing AFST profiles of the 135 strains under study, we noticed that TBF resistance is restricted to T. indotineae isolates from India and that these strains also showed cross-resistance to another allylamine drug, NAF. This might support the status of T. indotineae as a separate species, showing diagnostic differences in mating type genes and ribosomal DNA (rDNA) ITSs in addition to statistically significant trends in its phenotype (7). The origin of this TBF-resistant species, causing recalcitrant and difficult-to-treat dermatophytosis, which has been emerging in India since 2015, is a much-debated topic (2–4, 6). The inappropriate use of over-the-counter creams with combined steroid and antifungal mixtures is suggested to be the probable cause of the spread of this problematic species (1). Comparison with published data is hampered by taxonomic confusion concerning the T. mentagrophytes species complex. While recent data have shown that the correct name of the emerging species in India is T. indotineae, it has been variably identified as T. mentagrophytes genotype VIII or T. interdigitale, but correction as T. indotineae is possible via sequences deposited in GenBank. In strains retrospectively identified as belonging to the T. mentagrophytes species complex, a significant spread of TBF resistance ranging between 0.2 and 81% is observed (Table 4). Although no clinical breakpoints (CBPs) for MIC values have been established to guide antifungal therapy, epidemiological cutoff (ECV or ECOFF) values may serve as a substitute for the detection of resistance. The ECOFF is the highest MIC value for isolates devoid of phenotypically detectable resistance mechanisms. As a first step, the ECOFF needs to be based on the new taxonomy. Shaw et al. (16) suggested that determination of the UL-WT (upper limit of the wild type) may be beneficial for managing dermatophytosis and monitoring the emergence of isolates with reduced susceptibility. The MICs comprising >95% of the modeled populations were 8 mg/liter for TBF and 32 mg/liter for FCZ. Arendrup et al. (17, 18) reported that TBF resistance can be set at 0.25 mg/liter (visually) or 0.125 mg/liter (spectrophotometrically at the 50% inhibition endpoint). These ECOFFs may be helpful for physicians in the current scenario of recalcitrant dermatophytes. In our data, T. indotineae shows an almost bimodal distribution (Fig. 1) with isolates having an MIC of >0.25 mg/liter (visually). A value of 0.25 mg/liter was found, in consensus with the UL-WT calculating result, for determinations visually and spectrophotometrically at the 90% endpoint according to the EUCAST method (16). Thus, a uniform standard for the definition of TBF resistance is required. Due to the low number of available strains of Trichophyton species, an ECOFF could not be calculated in our experiments. Based on the UL-WT according to Arendrup et al. (18), the rate of resistance to TBF in our experiments was 58% (upper limit of the wild type set at an MIC of ≥0.25 mg/liter). In accordance with other experiments (19), strains with an MIC of TBF of ≥0.25 mg/liter are able to survive on RPMI 1640 agar containing 0.2 mg/liter terbinafine. We consequently used this method to screen for strains with increased resistance to TBF.
TABLE 4

Number of TBF-resistant isolates showing different countries and mutations in the SQLE gene

ReferenceCountryNo. of all isolatesNo. of resistant isolatesMIC (mg/liter)Resistance rate (%)Mutation(s)
10Switzerland41213.20.24Phe397Leu
36India64391 to ≥3260.94Phe397Leu, Leu393Phe
2India63204 to ≥3231.75Leu393Phe, Phe397Leu
5India1291051 to ≥3281.40Leu393Phe, Phe397Leu
37Japan24124.17None
24India14615≥210.27Phe397Leu
16India4981021 to ≥3220.50Phe397Leu, Leu393Phe
19India2792020.2572.00Leu393Ser, Gln408Leu, His440Tyr, Ser443Pro, Leu335Phe, Ser395Pro
12Iran1415≥323.54Phe397Leu, Leu393Ser
Number of TBF-resistant isolates showing different countries and mutations in the SQLE gene In order to classify the background of resistance in T. indotineae, we selected all resistant strains and 15 susceptible strains of this species and 10 susceptible isolates each of T. mentagrophytes and T. interdigitale. These were used for the detection of mutations in the SQLE gene. In accordance with previous reports (2, 12), a high MIC (≥16 mg/liter) (53.13%) of TBF isolates was associated with mutation 1189T>C, 1191C>A, or 1191C>G, which led to the amino acid substitution Phe397Leu; sometimes, this mutation was combined with the amino acid substitution Ala448Thr. Strains with moderate to low MICs for TBF (0.125 to 0.5 mg/liter) showed the amino acid substitutions Phe415Val, Leu393Ser, His440Tyr, and Ala448Thr (11, 12). Unexpectedly, several susceptible strains (MICs of 0.016 to 0.125 mg/liter) of T. indotineae had the mutation 1342G>A (Ala448Thr). A search conducted in GenBank revealed sequences (accession numbers MN893286 and MN901902 to MN901905) of three susceptible strains with the same mutation (1342G>A). Consequently, it was concluded that this mutation alone does not contribute to TBF resistance. It may be a silent mutation or perhaps may contribute to the increased MIC values observed for triazoles. The role of this amino acid substitution remains as yet unknown. Isolates from China and Germany identified as T. mentagrophytes carried the thus-far-unreported mutations 828G>C and 1255C>T, leading to Lys276Asn and Leu419Phe, respectively, and may be unique in T. mentagrophytes. But due to the limitation of detected strains, only 10 strains each of T. mentagrophytes and T. interdigitale were sequenced. Possibly, this parameter adds to the distinction of the closely related species T. mentagrophytes and T. interdigitale, which needs more data to demonstrate. Amino acid substitutions variably impact conformational changes in the active site of the enzyme resulting in reduced drug affinity. Leber et al. (20) generated TBF-resistant clones of Saccharomyces cerevisiae by mutagenesis. Subsequent molecular analysis of the SQLE gene revealed point mutations leading to amino acid substitutions at Phe402, Phe420, and Phe430, respectively (21). The residues Phe402 and Phe420 in S. cerevisiae SQLE correspond to Phe397 and Phe415 in T. indotineae SQLE, respectively. This means that this mutation is highly conserved over large phylogenetic distances. Nowosielski et al. (22) established that these regions were localized to the C terminus of the SQLE gene and speculated that the amino acid changes influence the interaction with the drug. Homology modeling was performed to compare the mutated residue and the wild type, showing that the mutant residue is smaller than the original, interfering with the binding of the molecule and resulting in a failure of drug-enzyme interactions (23). Shankarnarayan et al. (24) put forward that SQLE could serve as a marker of resistance, especially the substitutions between Leu393 and Ser443 (16). Our data show that the three species in the T. mentagrophytes complex each harbor specific mutations in the SQLE gene. Triazoles specifically interact with the lanosterol 14-alpha demethylase (ERG11) gene, influencing the synthesis of ergosterol. Hence, ERG1 mutants lacking ergosterol are expected to be resistant to these drugs. However, some reports showed that an ERG1 mutant led to increased susceptibility to drugs in Candida (25, 26); thus, the exact mechanism of ERG1 influencing ERG11 is not clear in T. indotineae. In our data set, the MICs of FCZ proved to be much higher in TBF-resistant strains of T. indotineae than in T. mentagrophytes sensu stricto and T. interdigitale sensu stricto. Strains with the double mutations of the SQLE gene that cause the amino acid substitutions Phe397Leu and Ala448Thr showed increased MIC values of FCZ, which was not observed in strains with a single mutation. Burmester et al. (27) speculated that the Ala448Thr substitution combined with the Phe397Leu substitution in the SQLE gene may contribute to higher FCZ and VCZ MICs; however, the Gln408Leu and Ala448Leu double mutants did not follow this trend. In our analysis, no statistical difference was found between the single mutation Ala448Thr and no mutation. With FCZ, a statistically significant association is observed between Phe397Leu and no mutation. We therefore speculated that Ala448Thr alone might not lead to higher FCZ and ITZ MICs, but combined with Phe397Leu, an effect on FCZ and ITZ can be observed, explaining the significantly higher MICs of FCZ in T. indotineae. Similar observations have been reported previously by Ebert et al. (19). The amino acid substitution Ala448Thr at the C terminus of squalene epoxidase probably has an impact on subsequent steps in ergosterol synthesis through conformational changes and may result in reduced susceptibility to azoles. Besides, Gnat et al. (28) indicated higher levels of PDR1, MDR2, and MDR4 gene expression in terbinafine-resistant T. mentagrophytes isolates after exposure to a subinhibitory concentration of terbinafine than in the case of cells incubated without the antifungal. Kano et al. (29) revealed that the expression levels of the PDR1, MDR1, MDR2, and MDR4 genes were 2 to 4 times higher in the TBF-resistant strain grown in the presence of 0.14 μg/ml of TBF than in TBF-susceptible strains cultured in the absence of TBF. The conclusions from previous studies that disruption of the MDR2 gene renders mutants more susceptible to terbinafine than control strains suggest that one alternative to SQLE point mutation mechanisms of terbinafine resistance may involve efflux pumps (30). In conclusion, by using the new taxonomy of the T. mentagrophytes species complex, we describe the MIC distributions of eight drugs. High MICs of terbinafine, with the amino acid substitution Phe397Leu, are as yet limited to T. indotineae and are unlikely to be distributed throughout the T. mentagrophytes species complex by genetic exchange.

MATERIALS AND METHODS

Clinical specimens and fungal isolates.

A total of 135 clinical isolates from India (n = 64), China (n = 36), Australia (n = 12), Germany (n = 7), and The Netherlands (n = 16) collected over a 2-year period (2018 to 2019) were used and are shown in Table S1 in the supplemental material. The isolates originated from human cases of tinea corporis, tinea cruris, tinea faciei, or tinea unguium. Skin scrapings and nail clippings were processed for direct microscopic examination with 10% potassium hydroxide (KOH) (31) or an optical brightener. Strains were maintained in Sabouraud’s glucose broth (SGB) containing glycerol and dimethyl sulfoxide (DMSO) at −80°C (32). Microconidium formation was enhanced by culturing on potato dextrose agar (PDA; Oxoid, Basingstoke, England) at 28°C for 7 to 14 days.

Identification.

For DNA extraction, mycelium was harvested from 7- to 14-day-old cultures grown on PDA at 28°C. Mycelial fragments (approximately 0.5 cm in diameter) were soaked in breaking buffer (2% Triton X-100, 1% sodium dodecyl sulfate [SDS], 100 mM NaCl, 10 mM Tris HCl, 1 mM EDTA [pH 8]) with 300 mg glass beads (0.4 to 0.6 mm in diameter) (2, 12). Samples were shaken at 1,200 rpm at 70°C for 30 min, 250 μl phenol-chloroform-isoamyl alcohol (Invitrogen, St. Louis, MO, USA) was added, and the mixture was shaken again for 5 min at room temperature, followed by centrifugation at 11,000 × g for 5 min. The top fraction was collected and stored at −20°C. Species identification was done using the rDNA internal transcribed spacer (ITS) with primers ITS-1 (5′-TCCGTAGGTGAACCTTGCGG-3′) and ITS-4 (5′-TCCTCCGCTTATTGATATGC-3′) (33). Diagnostic high-mobility-group (HMG) data were provided by C. Tang (7). PCR products were purified using gel electrophoresis (QIAquick; Qiagen, Hilden, Germany) and sequenced using an ABI BigDye Terminator (v3.1) cycle sequencing kit. The sequencing reactions were done at 95°C for 1 min with 30 cycles of 95°C for 10 s, 50°C for 5 s, and 60°C for 4 min on an ABI 3730XL automatic sequencer (Applied Biosystems, Foster City, CA, USA) with the ABI Prism BigDye Terminator cycle sequencing kit (Applied Biosystems). Sequences were aligned using CodonCode Aligner software (CodonCode Corp., Centerville, MA, USA) and compared to data in GenBank.

Antifungal susceptibility testing.

Microtiter plates (Costar; Corning, NY, USA) were prepared using 2-fold serial dilutions in double-concentrated medium according to the EUCAST E.Def 9.3.1 protocol (12, 34). Strains were subcultured on PDA for 7 to 14 days at 28°C, and conidial inocula were prepared in MilliQ water containing Tween 20 (0.5%) by gently scraping the surface of mature colonies with a sterile cotton swab and using filtration on a nylon filter with a porosity of 11 μm. An initial inoculum corresponding to 80 to 83% transmittance at 530 nm in a spectrophotometer was used and diluted 1:10 with sterile water to obtain final inocula of 0.5 × 105 to 2.5 × 105 CFU/ml; concentrations were determined again using a hemocytometer. Antifungals were purchased from Sigma-Aldrich and dissolved in DMSO (5 mg/liter; Sigma-Aldrich, Burlington, MA, USA). Stock solutions were prepared at concentrations of 3,200 mg/liter for all drugs. The applied concentration ranges were 0.016 to 16 mg/liter for itraconazole (ITZ), ketoconazole (KTZ), miconazole (MCZ), naftifine (NAF), sertaconazole (SCZ), and terbinafine (TBF) and 0.03 to 32 mg/liter for fluconazole (FCZ) and griseofulvin (GRI). Microtiter plates were frozen at −80°C for at least 24 h prior to use. Reference strains T. interdigitale ATCC MYA-4439, Candida krusei ATCC 6258, and Candida parapsilosis ATCC 22019 were used as controls and were read after 24 h of incubation (for yeasts) at 37°C. Drug-free controls were included, and microtiter plates were incubated at 28°C (for filamentous fungi). MIC endpoints for all drugs were defined as the lowest concentration that produced complete inhibition of growth as read visually after 5 days; for yeasts, results are read at 50% inhibition by using a spectrophotometer.

Screening for TBF and ITZ resistance.

In order to validate a previously described (10) agar method for detecting TBF resistance in Trichophyton, we screened 50 isolates (MIC of TBF of ≥16 mg/liter, n = 34; MIC of TBF of 0.125 to 0.5 mg/liter, n = 10; MIC of TBF of 0.016 to 0.062 mg/liter, n = 6; MIC of ITZ of 0.062 to 2 mg/liter, all isolates) on RPMI 1640 agar plates containing 0.2 mg/liter TBF and 4 mg/liter ITZ (35). RPMI 1640 medium (Biowest, Nuaillé, France) supplemented with 2% glucose (Sigma, St. Louis, MO, USA) and 0.165 mol/liter 3-N-morpholinepropanesulfonic acid (MOPS) (pH 7.0) (Sigma) was mixed with double-strength concentrations of Bacto agar (Becton, Dickinson, Sparks, MD, USA) and subsequently added to the working solutions of each compound, and the mixture was autoclaved at 121°C for 15 min. The antifungal-free mixture was used in the control wells. Prepared RPMI 1640 agar was applied to 24-well plates with 1.5 ml/well and stored at 4°C. The concentration of TBF was qualitatively equivalent to twice the previously described MIC for Trichophyton species (14). The cultured colonies were then inoculated at the center of the RPMI 1640 agar plates containing TBF or ITZ and incubated at 28°C. Fungal growth ability was examined after 5, 7, and 14 days.

Squalene epoxidase gene sequencing.

A total of 62 isolates were screened for mutations in the squalene epoxidase (SQLE) gene. The primers used are listed in Table 5. PCR was carried out in 50-μl reaction mixture volumes, and conditions included an initial denaturation step for 5 min at 94°C followed by 35 cycles of 30 s at 94°C, 45 s at 59°C, and 100 s at 72°C. PCR products were purified using gel electrophoresis (QIAquick) and sequenced using the primers listed in Table 5. DNA sequencing was performed with PCR primers at a concentration of 2.5 mmol/liter. Gene and amino acid sequences of SQLE of Trichophyton spp. were compared with those of T. interdigitale (GenBank accession numbers KK201110.1 and EZF33561).
TABLE 5

PCR primers used in this study

PurposePrimerSequence (5′–3′)
ITS1ITS1TCCGTAGGTGAACCTGCGG
ITS4ITS4TCCTCCGCTTATTGATATGC
SQLE amplificationSQLE-fw1AGCTGGCAGACTTCCTTTATC
SQLE-rv1GCAGAGATAATGCAGCCACC
SQLE sequencingSQLE-fw1AGCTGGCAGACTTCCTTTATC
SQLE-fw2GTCACCATTGTCGAGACCAAG
SQLE-fw3GATTGATGTTCCTAGGTGACT
SQLE-rv1TTAAATGCCACGGTCATACCG
SQLE-rv2CTTTCGGAACGTAGAGGCATA
SQLE-rv3GCAGAGATAATGCAGCCACC
PCR primers used in this study

Stability of TBF resistance.

Sixteen isolates (TBF MIC of ≥16 mg/liter, n = 13; TBF MIC of 0.016 to 0.062 mg/liter, n = 3) were subjected to sequential passage 10 times on drug-free Sabouraud dextrose agar (SDA) at 7- to 10-day intervals. Subsequently, the 20 strains and control strains were analyzed by AFST (FCZ, GRI, ITZ, KTZ, MCZ, NAF, SCZ, and TBF) according to the methods described above.

Statistics.

Figures were created by using GraphPad Prism version 8.0.0 (GraphPad Software), and Kruskal-Wallis tests were performed using SPSS version 26 (IBM); differences were considered statistically significant at P values of ≤0.05.

Data availability.

The ITS sequences of newly sequenced strains were deposited in GenBank under accession numbers MW346048 to MW346178. The SQLE sequences of newly sequenced strains were deposited in GenBank under accession numbers MW187971 to MW188029.1.
  36 in total

1.  Detailed mechanism of squalene epoxidase inhibition by terbinafine.

Authors:  Marcin Nowosielski; Marcin Hoffmann; Lucjan S Wyrwicz; Piotr Stepniak; Dariusz M Plewczynski; Michal Lazniewski; Krzysztof Ginalski; Leszek Rychlewski
Journal:  J Chem Inf Model       Date:  2011-01-13       Impact factor: 4.956

2.  High terbinafine resistance in Trichophyton interdigitale isolates in Delhi, India harbouring mutations in the squalene epoxidase gene.

Authors:  Ashutosh Singh; Aradhana Masih; Ananta Khurana; Pradeep Kumar Singh; Meenakshi Gupta; Ferry Hagen; Jacques F Meis; Anuradha Chowdhary
Journal:  Mycoses       Date:  2018-04-27       Impact factor: 4.377

3.  Mutation in the Squalene Epoxidase Gene of Trichophyton interdigitale and Trichophyton rubrum Associated with Allylamine Resistance.

Authors:  Shivaprakash M Rudramurthy; Shamanth A Shankarnarayan; Sunil Dogra; Dipika Shaw; Khurram Mushtaq; Raees A Paul; Tarun Narang; Arunaloke Chakrabarti
Journal:  Antimicrob Agents Chemother       Date:  2018-04-26       Impact factor: 5.191

4.  [Extensive tinea corporis due to a terbinafine-resistant Trichophyton mentagrophytes isolate of the Indian genotype in a young infant from Bahrain in Germany].

Authors:  Anke Süß; Silke Uhrlaß; Alfons Ludes; Shyam B Verma; Michel Monod; Constanze Krüger; Pietro Nenoff
Journal:  Hautarzt       Date:  2019-11       Impact factor: 0.751

5.  Terbinafine Resistance of Trichophyton Clinical Isolates Caused by Specific Point Mutations in the Squalene Epoxidase Gene.

Authors:  Tsuyoshi Yamada; Mari Maeda; Mohamed Mahdi Alshahni; Reiko Tanaka; Takashi Yaguchi; Olympia Bontems; Karine Salamin; Marina Fratti; Michel Monod
Journal:  Antimicrob Agents Chemother       Date:  2017-06-27       Impact factor: 5.191

Review 6.  How to: perform antifungal susceptibility testing of microconidia-forming dermatophytes following the new reference EUCAST method E.Def 11.0, exemplified by Trichophyton.

Authors:  Maiken C Arendrup; Gunnar Kahlmeter; Jesus Guinea; Joseph Meletiadis
Journal:  Clin Microbiol Infect       Date:  2020-09-08       Impact factor: 8.067

7.  Resistance Mechanism in a Terbinafine-Resistant Strain of Microsporum canis.

Authors:  Rui Kano; Yun-Hsia Hsiao; Hock Siew Han; Charles Chen; Atsuhiko Hasegawa; Hiroshi Kamata
Journal:  Mycopathologia       Date:  2018-01-16       Impact factor: 2.574

Review 8.  Perspectives on misidentification of Trichophyton interdigitale/Trichophyton mentagrophytes using internal transcribed spacer region sequencing: Urgent need to update the sequence database.

Authors:  Anuradha Chowdhary; Ashutosh Singh; Pradeep K Singh; Ananta Khurana; Jacques F Meis
Journal:  Mycoses       Date:  2018-11-15       Impact factor: 4.377

View more
  8 in total

1.  Effect of Different Itraconazole Dosing Regimens on Cure Rates, Treatment Duration, Safety, and Relapse Rates in Adult Patients With Tinea Corporis/Cruris: A Randomized Clinical Trial.

Authors:  Ananta Khurana; Aastha Agarwal; Diksha Agrawal; Sanjeet Panesar; Manik Ghadlinge; Kabir Sardana; Khushboo Sethia; Shalini Malhotra; Ankit Chauhan; Nirmala Mehta
Journal:  JAMA Dermatol       Date:  2022-09-14       Impact factor: 11.816

2.  First detection of Trichophyton indotineae causing tinea corporis in Central Vietnam.

Authors:  Thi Minh Chau Ngo; Phuong Anh Ton Nu; Chi Cao Le; Thi Ngoc Thuy Ha; Thi Bich Thao Do; Giang Tran Thi
Journal:  Med Mycol Case Rep       Date:  2022-05-13

3.  Increasing Terbinafine Resistance in Danish Trichophyton Isolates 2019-2020.

Authors:  Karen Marie Thyssen Astvad; Rasmus Krøger Hare; Karin Meinike Jørgensen; Ditte Marie Lindhardt Saunte; Philip Kjettinge Thomsen; Maiken Cavling Arendrup
Journal:  J Fungi (Basel)       Date:  2022-01-31

4.  Phylogeny, Antifungal Susceptibility, and Point Mutations of SQLE Gene in Major Pathogenic Dermatophytes Isolated From Clinical Dermatophytosis.

Authors:  Nasrin Pashootan; Masoomeh Shams-Ghahfarokhi; Arash Chaichi Nusrati; Zahra Salehi; Mehdi Asmar; Mehdi Razzaghi-Abyaneh
Journal:  Front Cell Infect Microbiol       Date:  2022-03-18       Impact factor: 5.293

Review 5.  Trichophyton indotineae-An Emerging Pathogen Causing Recalcitrant Dermatophytoses in India and Worldwide-A Multidimensional Perspective.

Authors:  Silke Uhrlaß; Shyam B Verma; Yvonne Gräser; Ali Rezaei-Matehkolaei; Maryam Hatami; Martin Schaller; Pietro Nenoff
Journal:  J Fungi (Basel)       Date:  2022-07-21

6.  Detection of emerging genotypes in Trichophyton mentagrophytes species complex: A proposal for handling biodiversity in dermatophytes.

Authors:  Chao Tang; Sarah A Ahmed; Shuwen Deng; Lu Zhang; Jan Zoll; Abdullah M S Al-Hatmi; Jacques F Meis; Rameshwari Thakur; Yingqian Kang; G Sybren de Hoog
Journal:  Front Microbiol       Date:  2022-08-23       Impact factor: 6.064

7.  The emergence and worldwide spread of the species Trichophyton indotineae causing difficult-to-treat dermatophytosis: A new challenge in the management of dermatophytosis.

Authors:  Anuradha Chowdhary; Ashutosh Singh; Amtoj Kaur; Ananta Khurana
Journal:  PLoS Pathog       Date:  2022-09-29       Impact factor: 7.464

8.  Terbinafine Resistance in Dermatophytes: A French Multicenter Prospective Study.

Authors:  Alicia Moreno-Sabater; Anne-Cécile Normand; Anne-Laure Bidaud; Geneviève Cremer; Françoise Foulet; Sophie Brun; Christine Bonnal; Nawel Aït-Ammar; Arnaud Jabet; Aymen Ayachi; Renaud Piarroux; Françoise Botterel; Sandrine Houzé; Guillaume Desoubeaux; Christophe Hennequin; Eric Dannaoui
Journal:  J Fungi (Basel)       Date:  2022-02-23
  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.