Literature DB >> 33967951

Arg-Vasotocin Directly Activates Isotocin Receptors and Induces COX2 Expression in Ovoviviparous Guppies.

Li Kang Lyu1, Jian Shuang Li1, Xiao Jie Wang1, Yi Jia Yao1, Ji Fang Li1, Yun Li1, Hai Shen Wen1, Xin Qi1.   

Abstract

Oxytocin (OT) is a crucial regulator of reproductive behaviors, including parturition in mammals. Arg-vasopressin (AVP) is a nonapeptide homologous to Arg-vasotocin (AVT) in teleosts that has comparable affinity for the OT receptor. In the present study, ovoviviparous guppies (Poecilia reticulata) were used to study the effect of AVT on delivery mediated by the activation of prostaglandin (PG) biosynthesis via isotocin (IT) receptors (ITRs). One copy each of it and avt and two copies of itrs were identified in guppies. The results of the affinity assay showed that various concentrations of AVT and IT (10-6, 10-7, and 10-8 mol/L) significantly activated itr1 (P < 0.05). In vitro experiments revealed significant upregulation (P < 0.05) of cyclooxygenase 2 (cox2), which is the rate-limiting enzyme involved in PG biosynthesis, and itr1 by AVT and IT. Furthermore, dual in situ hybridization detected positive signals for itr1 and cox2 at the same site, implying that ITR1 may regulate cox2 gene expression. Measurement of prostaglandin F2a (PGF2a) concentrations showed that AVT induced PGF2a synthesis (P < 0.05) and that the effect of IT was not significant. Finally, intraperitoneal administration of PGF2a significantly induced premature parturition of guppies. This study is the first to identify and characterize AVT and ITRs in guppies. The findings suggest that AVT promotes PG biosynthesis via ITR and that PGF2a induces delivery behavior in ovoviviparous guppies.
Copyright © 2021 Lyu, Li, Wang, Yao, Li, Li, Wen and Qi.

Entities:  

Keywords:  Arg-vasotocin; cyclooxygenase; guppy; isotocin receptor; parturition; prostaglandin

Mesh:

Substances:

Year:  2021        PMID: 33967951      PMCID: PMC8104081          DOI: 10.3389/fendo.2021.617580

Source DB:  PubMed          Journal:  Front Endocrinol (Lausanne)        ISSN: 1664-2392            Impact factor:   5.555


Introduction

Oxytocin (OT) is a highly conserved nonapeptide that was the first peptide hormone with determined molecular structure (1). OT has various effects and is involved in many physiological processes, especially reproduction. In mammals, OT has a notable effect on the induction of parturition and smooth muscle contraction and has been used as a medicine in the clinic (2–5). In teleosts, studies of isotocin (IT), a homolog of OT, have been primarily focused on social behaviors, including social decision-making and anxiety behaviors in mosquitofish (Gambusia affinis) (6), paternal care and social class in cichlid fish species (7–9) and territory defense, egg care and courtship behaviors in three-spined stickleback (Gasterosteus aculeatus) (10). However, the mechanism governing the effect of IT on ovulation in oviparous teleosts has not been determined. IT may influence ovulation in teleosts. OT injection in killifish (Fundulus heteroclitus) and seurukan fish (Osteochilus vittatus) induces the spawning reflex (11, 12). Injection of a combination of Ovaprim and IT activated ovulation in Hoven’s carp (Leptobarbus hoevenii) (13). The functions of IT in the reproduction are limited to the induction of premature parturition in guppy (Poecilia reticulata) (14). Other studies suggested that AVT may also regulate sex-related reproductive behaviors. Arg-vasotocin (AVT) is the homolog of mammalian Arg-vasopressin (AVP). AVT functions in various adaptive behaviors are similar to those of IT. AVT is important for osmoregulation (15), and increasing number of neuroanatomical studies reported that AVT is involved in the regulation of sex-related reproductive behavior (16–18). In teleosts, exogenous administration of AVT to peacock blenny (Solaria pavo) induced female courtship behavior and the expression of nuptial coloration (19). Identification of putative functional sites of AVT in the hypothalamic-pituitary-gonad (HPG) axis in chanchita (Cichlasoma dimerus) indicated a positive effect on gonadotropin secretion and on the differences in the social status in males (20). Both OT/IT and AVP/AVT are nonapeptide hormones produced from a common precursor (21) and share seven out of nine amino acids in their primary structure (22). OT and AVP may bind to each other receptors due to strong similarity of their chemical structures (22). A study in Wistar rats demonstrated that peripheral administration of both OT and AVP induced profound effects manifested as a reduction in body temperature and heart rate, and these changes were predominantly mediated by the AVP V1a receptor (V1aR) (23). Peripheral administration of the OT and AVP neuropeptides induced prosocial effects that were prevented by an oxytocin receptor (OTR) antagonist but not a V1aR antagonist, indicating a possible function of AVP via OTR (24). With regard to reproduction, both OT and AVP induce uterine contractions in nonpregnant mice (Mus musculus) through a mechanism mediated by OTR (25). Overall, these findings indicate possible crosstalk between the OT/IT and AVP/AVT systems. The OT/OTR system was shown to participate in various physiological processes during the reproductive period (1). OT is important for parturition and acts through its specific receptor (26). OT binding to OTR increases intracellular Ca2+ concentration and thus activates smooth muscle contraction (27). Additionally, OT stimulates prostaglandin (PG) synthesis through a more complex pathway linked to the contraction of the myometrium (3, 27). In humans, OT significantly increases prostaglandin E2 (PGE2) production by increasing the expression of cyclooxygenase 2 (cox2) mRNA via OTR (28). Treatment of cultured endometrial cells with OT induces COX2 activation and synthesis of PGF2a (29). However, in luteal phase mares, OT downregulated the activities of both COX2 and prostaglandin E2 synthase (PTGES) (30). Thus, OT functions involve regulation of PG synthesis, which may be influenced by the reproductive status. PGs play a central role in the onset of parturition in mammals and are well-known as inflammatory factors and multifunctional fatty acid derivatives comprising a group of C20 metabolites synthesized from arachidonic acid (AA) through a series of enzyme modifications. The synthesis is initiated by the conversion of AA into the intermediate product PGH2 by COX1 or COX2 followed by synthesis of five bioactive metabolites, including four PGs (PGE2, PGF2a, PGD2, and PGI2) and thromboxane (TX) (31–33). PGF2a induces the contractions and inflammatory responses in the human myometrium (3). Stimulation of OT release from large luteal cells causes additional PGF2a synthesis and release via a positive feedback mechanism (34). In teleosts, plasma PGF2a levels in successfully ovulated females are significantly higher than those in unsuccessfully ovulated females in small-scale pacu (Piaractus mesopotamicus), indicating the importance of PGF2a in inducing ovulation (35). In goldfish (Carassius auratus), PGF2a functions as a blood-borne behavior hormone that induces spawning behavior (36, 37). These experiments suggested that PGF2a has similar activity in inducing ovulation in some externally fertilizing fish. These studies focused on the effect of IT on teleost spawning behavior mediated by ITR and PGF2a. However, unlike other egg-laying teleosts, guppy (Poecilia reticulata) uses ovoviviparous reproductive strategy and gives birth to active larval fish directly. A previous study demonstrated that PGF2a, IT and AVT significantly shorten the brood interval of guppies (14); however, the molecular mechanism of this effect remains unclear. The present study investigated the molecular mechanism by which AVT and IT stimulate PGF2a synthesis via the isotocin receptor (ITR) and subsequently trigger the initiation of parturition in guppies to determine the role of the interaction of AVT and IT with ITR and PGF2a in the regulation in live bearing guppy. The present study is the first to identify and characterize it, avt and itrs in guppies to document the effect of AVT and IT on cox2 expression and the PGF2a concentration. Finally, the administration of PGF2a to pregnant guppies confirmed the function of AVT-induced PGF2a in parturition in ovoviviparous teleosts.

Materials and Methods

Ethics Statement

All procedures involved in the handling and treatment of fish in this study were approved by Animal Research and Ethics Committees of Ocean University of China prior to the initiation of the study. All experiments were performed in accordance with relevant guidelines and regulations.

RNA Extraction and Reverse Transcription

Total RNA was extracted from the guppy brain and ovaries (n = 3) using TRIzol® reagent (Invitrogen, Carlsbad, USA) for gene cloning. The quantity and purity of the RNA were estimated using a biophotometer (OSTC, Beijing, China) and agarose gel electrophoresis. One microgram of total RNA was reverse transcribed into complementary DNA (cDNA) using a HiScript III RT SuperMix reagent kit (Vazyme, Nanjing, China) according to the manufacturer’s instructions.

Gene Cloning and Sequence Analysis of Isotocin, Arg-Vasotocin and Isotocin Receptors in Guppies

The open reading frames (ORFs) of guppy it, avt, and itrs were obtained from the genome database (PRJNA238429), and the sequences were confirmed by PCR followed by Sanger sequencing. PCR was performed according to the protocol described in a previous report using cDNA samples from the brain or ovary (38). Briefly, initial denaturation was performed at 94°C for 3 min followed by 35 cycles at 94°C for 30 s, 55°C to 60°C for 30 s, and 72°C for 1 min. The reaction was terminated with an extension for 5 min at 72°C. The products were purified using a TIANgel Midi purification kit (TIANGEN, Beijing, China), subcloned into the pEASY-T1 cloning vector (TransGen Biotech, Beijing, China) and transformed into DH5α cells. Positive clones containing the inserts of the expected size were selected for sequencing to confirm the results. The confirmed sequences were submitted to the NCBI. All primers used in the present study are listed in .
Table 1

Sequences of the primers used for dual-fluorescence ISH, plasmid construction and qPCR.

PrimersSequence (5'-3')
Primers for ORF cloning
itr1-orf-FATGGAAACTATTTCCAATG
itr1-orf-RTTACGTGGTGGATGTCTGTGT
itr2-orf-FATGGAGGAACTTTTACGCGCA
itr2-orf-RTCAGTGCGCGGGCCCCCC
avt-orf-FATGCATCACTCCCTGCTGTGC
avt -orf-RTCAGTAGTCGTTCTGTCCTCT
it-orf-FTGGCTTTCGGCTTTCTGGGT
it-orf-RAGAGAGACCTTCGGGTAGCG
Primers for preparation of dual-fluorescence ISH probes
itr1-ish-FCGCAACTTATCTGGGACA
itr1-ish-RCCGTAATACGACTCACTATAGGGAGACATCACGGTGGTTATCTTCG
cox2-ish-FCGCATCCGAGTTCAATAC
cox2-ish-RCCGATTTAGGTGACACTATAGAAGCGTTCAAACGAGGAGTAGGG
Primers for plasmid construction
itr1-orf-PC-FACTATAGGGAGACCCAAGCTTATGGAAACTATTTCCAATGAAAGTGA
itr1-orf-PC-RTATAGAATAGGGCCCTCTAGATTACGTGGTGGATGTCTGTGTGA
Primers for qPCR
cox2-FCGCATCCGAGTTCAATAC
cox2-RTTCAAACGAGGAGTAGGG
itr1-FCGCAACTTATCTGGGACA
itr1-RTCACGGTGGTTATCTTCG
β-actin-FGCCTATCTACGAGGGCTACGC
β-actin-RTTGATGTCACGCACGATTTCC
Sequences of the primers used for dual-fluorescence ISH, plasmid construction and qPCR. The signal peptide and precursor cleavage sites of IT and AVT were predicted by SignalP 5.0 (39) and NeuroPred software (40), respectively. Seven putative transmembrane domains were predicted by the TMHMM server v. 2.0 (http://www.cbs.dtu.dk/services/TMHMM-2.0/). Multiple sequences were aligned and analyzed using Clustal X software (41), and phylogenetic trees were constructed using MEGA 6 software (42).

Colocalization of Guppy itr1 and cox2 Using Dual-Fluorescence In Situ Hybridization (ISH)

Dual-fluorescence in situ hybridization (ISH) for itr1 and cox2 was performed to confirm the regulatory effect of AVT on cox2 via ITR1 using previously described methods with modifications (43, 44). Briefly, 10 guppy ovaries at various development stages were collected, fixed with buffered 4% paraformaldehyde for 24 h and subsequently embedded in paraffin. Next, 7-mm thick sections were cut for ISH. For double ISH, the probes for itr1 and cox2 were labeled with digoxigenin (DIG) and biotin (Roche Diagnostics, Mannheim, Germany), respectively. After hybridization with a mixture of both probes and post-hybridization steps, the sections were washed and blocked with blocking buffer (10% goat serum, Invitrogen, Carlsbad, USA). The sections were incubated with a horseradish peroxidase (HRP)-conjugated anti-DIG secondary antibody (diluted 1:500 with blocking buffer, Roche Diagnostics, Mannheim, Germany) and rinsed twice with sterile phosphate-buffered saline (PBS) for 5 min each time; then, chromogenic reactions were performed using a tyramide kit with Alexa Fluor 488 (Invitrogen) for 30 min. The second fluorescence detection started only when the first reaction appeared to produce appropriate results. The sections were incubated with 3% hydrogen peroxide for 1 h to inactivate HRP conjugated to anti-DIG antibody. After several rinsing steps, the sections were incubated with HRP-conjugated streptavidin (Proteintech, Chicago, USA). The final chromogenic reaction was performed using a tyramide kit with Alexa Fluor 594 (Invitrogen) for 30 min and stopped by adding working solution of stop reagent (Invitrogen, Carlsbad, USA) to detect the signal. The sections were mounted in antifade mounting medium (Beyotime, Shanghai, China) after nuclear staining with DAPI for 10 s (10 μg/mL, Solarbio, Beijing, China). Images were captured using an Olympus BX53F fluorescence microscope (Olympus, Japan).

In Vitro Ovary Incubation Assays

The guppy nonapeptides AVT and IT were synthesized by GL Biochem (Shanghai, China). The purity of the synthesized peptides was determined to be >95% using analytical HPLC. The nonapeptides were dissolved in dimethyl sulfoxide (DMSO, Solarbio, Beijing, China). Tissue culture was performed mainly using an established protocol (45). Briefly, whole ovaries from five fertilized female guppies (1.15 ± 0.09 g) per group were collected and washed three times with PBS containing 100 U/mL penicillin, 1 mg/mL streptomycin and 1.25 U/mL nystatin. After preincubation with Leibovitz’s L-15 medium in a 12-well plate at 28°C for 2 h, the ovarian fragments were incubated in fresh medium containing various doses of AVT or IT (10−5, 10−6, or 10−7 mol/L) for 3 h or with 10−5 mol/L AVT or IT for various times (3, 6, or 9 h). The fragments incubated with DMSO were used as the controls. At the end of the incubation, the fragments were collected and stored at −80°C for RNA extraction and qPCR analysis.

Quantitative Real-Time PCR

The expression of itr1 and cox2 in guppies was analyzed by quantitative real-time PCR (qPCR) with specific primers. The samples were generated from ovary fragments incubated with various concentrations of the stimulatory agents at various time points as indicated. All cDNA products obtained by RNA extraction and reverse transcription were diluted to 500 ng/μl. The 20-μL qPCR reaction mixture contained 2 μL of cDNA templates, 0.4 μL of both primers, 10 μL of KAPA SYBR®FAST qPCR Master Mix (2X), 0.4 μL of 6-carboxy-X-rhodamine (ROX) and 6.8 μL of RNase-free water. PCR amplification was performed in a 96-well optical plate at 95°C for 30 s followed by 40 cycles at 95°C for 5 s and 58°C for 30 s, and a final extension was performed at 72°C for 2 min. qPCR was performed using a StepOne Plus real-time PCR system (Applied Biosystems), and the 2−ΔΔCT method was used to calculate the gene expression levels.

Plasmid Construction and Luciferase Assay

The human embryonic kidney 293T (HEK-293T) cell line was used for the binding activity assays. The ORF of the guppy itr1 cDNA was subcloned into the pcDNA3.1a expression vector (Invitrogen, Carlsbad, USA). Prior to the transfection, 293T cells were maintained at 37°C in DMEM containing 10% fetal bovine serum (FBS) (Thermo Fisher Scientific, Massachusetts, USA). Twenty hours before the transfection, 1 × 105 cells were seeded into the wells of 24-well tissue culture plates. Then, 500 ng of pCRE-Luc reporter plasmid, 300 ng of pcDNA3.1-itr1 and 50 ng of pRL-CMV (to normalize transfection efficiency) containing the Renilla luciferase sequence were transiently cotransfected into the cells in 500 μL of serum-free medium using Lipofectamine reagent (Invitrogen, Carlsbad, USA). Six hours after the transfection, the cells were incubated in DMEM (10% FBS) for 12 h and subsequently treated with the vehicle or various concentrations of IT and AVT (10−6, 10−7, or 10−8 mol/L) for an additional 6 h. Each treatment was replicated in four wells. Then, the cells were harvested, and luciferase activity assays were performed using a dual-luciferase kit (Promega, Wisconsin, USA).

ELISA Measurement of the PGF2a Concentration

To assess the PGF2a concentrations after IT and AVT injections, 24 pregnant guppies were intraperitoneally injected with IT (1 μg/g), AVT (1 μg/g) or the same volume of saline solution. Tissue homogenates from each individual were collected 3 h after the injection. The homogenate was obtained by centrifugation of the samples at 12,000 g for 10 min after an overnight incubation at 4°C, and the PGF2a level was measured in duplicate samples using commercial ELISA kits (Runyu, Shanghai, China) according to the manufacturer’s instructions.

PGF2a Injection and Parturition Behavioral Assay

Parturition behavioral assays were conducted in 2-L rectangular tanks. Guppies were selected and treated 20 days after the last delivery, and 10 individuals were housed in two 5-L water tanks with water temperature of 28°C before the injection. One pregnant individual from each tank was acclimated for 2 days to standardize the effect of environmental changes. PGF2a (Shanghai Yuanye Bio-Technology, China) was injected at a concentration of 1,000 ng/g body wet weight to verify whether PGF2a has a direct effect on parturition. PGF2a was dissolved in ethanol at a concentration of 100 μg/mL, as described in a previous study of PG administration in guppy (14), with several modifications. Individuals in the control group were injected with an equal volume of ethanol. All reactions were recorded with a digital video camera. The treatment and control were administered at the same time. The experiment was replicated three times. The offspring were collected and imaged using a microscope (Optec, China) to analyze the morphology.

Statistical Analysis

All data are presented as the mean values ± S.E.M. The PGF2a concentration and gene expression in response to various concentrations of the hormones and at various treatment times were analyzed using one-way ANOVA followed by Duncan’s and Dunnett’s T3 multiple range tests. Gene expression in guppy treated with various hormones at the same time points were analyzed using independent sample T test. P-values <0.05 were considered to be significant. All statistical analyses were performed using SPSS 19.0 software (SPSS, Chicago, IL, USA).

Results

Gene Cloning and Sequence Analysis of AVT, IT, and ITRs in Guppies

Genomic data mining and gene cloning showed that the open reading frame (ORF) of avt (MW050982) is 456 bp and encodes a 151-amino acid (aa) precursor with a predicted signal peptide of 16 aa ( ). The precursor cleavage site analysis showed that the putative nonapeptide is located from aa 18 to aa 27 ( ). Comparison of the deduced amino acid sequences revealed that teleost AVT nonapeptides are highly conserved with avian AVTs and human AVP, except for a mutation site at position 3 (Gln/Ser) ( ). A phylogenetic tree of AVP precursors was constructed, and AVTs from teleosts and avians were clustered into a single clade, along with mammalian AVPs ( ).
Figure 1

(A) Nucleotide and deduced amino acid sequences of guppy AVT. The putative signal peptide is underlined. The putative AVT peptide is shaded. (B) Multiple comparisons of amino acid sequences of AVP/AVT precursors. The boxed letters indicate the sequence of mature AVP/AVT. (C) Phylogenetic analysis of AVP/AVT precursors in different species. Phylogenetic tree was constructed using MEGA 6 software and the neighbor-joining method. The data were resampled with 1,000 bootstrap replicates. The accession numbers of each sequence are as follows: Oryzias latipes (BAM15897.1), Lates calcatifer (XM_018674883.1), Takifugu rubripes (AAC60293.1), Danio renio (NP_840078.1), Homo sapiens (AAA61291.1), Gallus gallus (NP_990516.1), Mus musculus (AAC42027.1), Tachysurus fulvidraco (XM_027167236), Oncorhynchus masou (AAC60743.1), Oncorhynchus keta (CAA35205.1), Platichthys flesus (BAA98140.1), and Gouania willdenowi (XM_02457450.1).

(A) Nucleotide and deduced amino acid sequences of guppy AVT. The putative signal peptide is underlined. The putative AVT peptide is shaded. (B) Multiple comparisons of amino acid sequences of AVP/AVT precursors. The boxed letters indicate the sequence of mature AVP/AVT. (C) Phylogenetic analysis of AVP/AVT precursors in different species. Phylogenetic tree was constructed using MEGA 6 software and the neighbor-joining method. The data were resampled with 1,000 bootstrap replicates. The accession numbers of each sequence are as follows: Oryzias latipes (BAM15897.1), Lates calcatifer (XM_018674883.1), Takifugu rubripes (AAC60293.1), Danio renio (NP_840078.1), Homo sapiens (AAA61291.1), Gallus gallus (NP_990516.1), Mus musculus (AAC42027.1), Tachysurus fulvidraco (XM_027167236), Oncorhynchus masou (AAC60743.1), Oncorhynchus keta (CAA35205.1), Platichthys flesus (BAA98140.1), and Gouania willdenowi (XM_02457450.1). Genomic data mining and gene cloning indicated that the ORF (MW050983) of it is 468 bp and encodes a 155 aa precursor with a predicted signal peptide of 18 aa ( ). The putative nonapeptide extends from 20 aa to 28 aa based on precursor cleavage site analysis ( ). Comparison of the deduced amino acid sequences indicated that the IT nonapeptides are highly conserved among teleosts and similar to human OT and chicken mesotocin (MT), except for two mutation sites at positions 4 (Gln/Ser) and 8 (Leu/Ile) ( ). A phylogenetic tree of OT-like precursors revealed the clustering of teleost ITs into a single clade with mammalian OTs and avian and tetrapod MTs ( ). As neuropeptides with nine amino acids, both AVT and IT show high sequence conservation, except for Gln/Ser at position 4 and Arg/Ile at position 8. Both peptides contain disulfide bonds between cysteine (Cys) residues at positions 1 and 6 ( ).
Figure 2

(A) Nucleotide and deduced amino acid sequences of guppy IT. The putative signal peptide is underlined. The putative IT peptide is shaded. (B) Multiple comparisons of the amino acid sequences of OT/IT/MT precursors. The boxed letters indicate the sequence of mature OT/IT/MT. (C) Phylogenetic analysis of IT precursors in different species. The phylogenetic tree was constructed using MEGA 6 software and the neighbor-joining method. The data were resampled with 1,000 bootstrap replicates. The accession numbers of each sequence are as follows: Oryzias latipes (NP_001265759.1), Salmo salar (ABU80634.1), Takifugu rubripes (AAC60289.1), Danio renio (AAL50209.1), Homo sapiens (NP_000906.1), Gallus gallus (QCX08109.1), Mus musculus (NP_035155.1), Electrophorus electricus (XP_026855497.1), Oreochromis niloticus (XP_003446141.1), Xenopus laevis (XP_018080922.1), and Xenopus tropicalis (XP_002936405.1).

Figure 3

Schematic diagrams of the primary structures of guppy AVT (A) and IT (B). Different amino acids at positions 4 and 8 are highlighted in red.

(A) Nucleotide and deduced amino acid sequences of guppy IT. The putative signal peptide is underlined. The putative IT peptide is shaded. (B) Multiple comparisons of the amino acid sequences of OT/IT/MT precursors. The boxed letters indicate the sequence of mature OT/IT/MT. (C) Phylogenetic analysis of IT precursors in different species. The phylogenetic tree was constructed using MEGA 6 software and the neighbor-joining method. The data were resampled with 1,000 bootstrap replicates. The accession numbers of each sequence are as follows: Oryzias latipes (NP_001265759.1), Salmo salar (ABU80634.1), Takifugu rubripes (AAC60289.1), Danio renio (AAL50209.1), Homo sapiens (NP_000906.1), Gallus gallus (QCX08109.1), Mus musculus (NP_035155.1), Electrophorus electricus (XP_026855497.1), Oreochromis niloticus (XP_003446141.1), Xenopus laevis (XP_018080922.1), and Xenopus tropicalis (XP_002936405.1). Schematic diagrams of the primary structures of guppy AVT (A) and IT (B). Different amino acids at positions 4 and 8 are highlighted in red. Genomic data revealed 2 oxytocin-like receptor genes in guppies. The size of the oxytocin receptor gene is 1,173 bp, and the gene encodes a 390-aa G protein-coupled receptor; the classical 7-transmembrane domain structure is annotated in . The ORF of itr is 1,188 bp, coding for a 395-aa G protein-coupled receptor with seven transmembrane domains ( ).
Figure 4

Nucleotide and deduced amino acid sequences of guppy ITR1 (A) and ITR2 (B). The shading represents transmembrane domains. (C) Phylogenetic analysis of the OTR family in different species. Phylogenetic tree was constructed using MEGA 6 software and the neighbor-joining method. The data were resampled with 1,000 bootstrap replicates. The accession numbers of each sequence are as follows: Carassius auratus (XP_026116839.1), Salvelinus alpinus (XP_023846756.1), Mastacembelus armatus (XP_026163763.1), ITR1 Oncorhynchus mykiss (XP_021466000.1), ITR2 Oncorhynchus mykiss (XP_021465666.1), ITR1 Seriola lalandi dorsalis (XP_023257499.1), ITR2 Seriola lalandi dorsalis (XP_023265951.1), Cynoglossus semilaevis (XP_016892293.1), ITR1 Danio rerio (NP_001186298.1), ITR2 Danio rerio (NP_001186299.1), Gallus gallus (NP_001026740.1), Homo sapiens (NP_000907.2), Mus musculus (NP_001074616.1), Oryzias latipes (NP_001243561.1), Paramormyrops kingsleyae (XP_023661236.1), Perca flavescens (XP_028431436.1), Stegastes partitus (NP_001281113.1), Poecilia formosa (XP_007570475.1), and Paralichthys olivaceus (XP_019942082.1).

Nucleotide and deduced amino acid sequences of guppy ITR1 (A) and ITR2 (B). The shading represents transmembrane domains. (C) Phylogenetic analysis of the OTR family in different species. Phylogenetic tree was constructed using MEGA 6 software and the neighbor-joining method. The data were resampled with 1,000 bootstrap replicates. The accession numbers of each sequence are as follows: Carassius auratus (XP_026116839.1), Salvelinus alpinus (XP_023846756.1), Mastacembelus armatus (XP_026163763.1), ITR1 Oncorhynchus mykiss (XP_021466000.1), ITR2 Oncorhynchus mykiss (XP_021465666.1), ITR1 Seriola lalandi dorsalis (XP_023257499.1), ITR2 Seriola lalandi dorsalis (XP_023265951.1), Cynoglossus semilaevis (XP_016892293.1), ITR1 Danio rerio (NP_001186298.1), ITR2 Danio rerio (NP_001186299.1), Gallus gallus (NP_001026740.1), Homo sapiens (NP_000907.2), Mus musculus (NP_001074616.1), Oryzias latipes (NP_001243561.1), Paramormyrops kingsleyae (XP_023661236.1), Perca flavescens (XP_028431436.1), Stegastes partitus (NP_001281113.1), Poecilia formosa (XP_007570475.1), and Paralichthys olivaceus (XP_019942082.1). Teleosts clustered together in the phylogenetic tree of both OT-like receptors. Teleosts, including zebrafish, guppy, medaka (Oryzias latipes), large yellow croaker (Larimichthys crocea), and gilt-head bream (Sparus aurata), express two types of the receptors, which were previously known as OTRs and ITRs. In the present study on guppies, the oxytocin receptor was renamed isotocin receptor 1 (ITR1, MN725111), and the isotocin receptor was renamed isotocin receptor 2 (ITR2, MW050984). However, oxytocin-like receptors in non-teleosts display greater evolutionary distance, suggesting that they are relatively conserved in teleosts ( ).

cAMP Response Element-Luciferase-Based Characterization of the Effects of AVT on Guppy ITR

A binding assay was performed using the cAMP response element (CRE)-luciferase reporter assay system to determine whether guppy IT and AVT bind ITR1 and regulate the downstream gene expression. The ORF of itr1 (pcDNA3.1a), pGL3 (CRE-luciferase), and pRL-TK were cotransfected into HEK293T cells, which were incubated with various concentrations of IT and AVT for 24 h. Both IT and AVT at the concentrations of 10−6, 10−7, and 10−8 mol/L significantly activated ITR1 (P <0.05) ( ). The CRE-luciferase reporter assays demonstrated a dose-dependent response to the IT injection, and the luciferase activity corresponding to ITR1 induction by AVT was not dose-dependent.
Figure 5

The assay of IT (A) and AVT (B) binding to ITR1. The relative CRE luciferase activity in the presence of various concentrations of IT (10−6, 10−7, or 10−8 mol/L) and AVT (10−6, 10−7, or 10−8 mol/L) was determined by measuring firefly and Renilla luciferase activities normalized to the values in the control group. Bars represent the mean values ± SEM, and different letters indicate significant differences (P < 0.05).

The assay of IT (A) and AVT (B) binding to ITR1. The relative CRE luciferase activity in the presence of various concentrations of IT (10−6, 10−7, or 10−8 mol/L) and AVT (10−6, 10−7, or 10−8 mol/L) was determined by measuring firefly and Renilla luciferase activities normalized to the values in the control group. Bars represent the mean values ± SEM, and different letters indicate significant differences (P < 0.05).

Effects of IT and AVT on the Levels of cox2 and itr1 mRNAs in the Guppy Ovaries

In vitro incubation of ovarian fragments was performed to evaluate the effects of IT and AVT on the expression of cox2 and itr1 mRNAs. The sequences of cox2 (XM_008415162.2) and β-actin (EU143772.1) were identified using the NCBI database. qPCR was performed to measure the expression of cox2 and itr1. β-Actin was used as an internal control. The expression of cox2 was significantly upregulated (P < 0.05) in the presence of high concentrations of AVT (10−5 mol/L) compared with that in the control group and in the samples treated with IT ( ). The expression of itr1 was also significantly increased (P<0.05) by all concentrations of AVT compared with that in the samples treated with IT ( ). The results of time-dependent treatment experiments indicated that the expression levels of cox2 and itr1 were significantly induced (P<0.05) at 3 h and rapidly decreased (P < 0.05) at 6 h before returning to the normal levels at 9 h in the presence of a high concentration of AVT (10−5 mol/L) ( ). In contrast to AVT stimulation, the expression levels of cox2 and itr1 were significantly induced (P < 0.05) at 6 h and rapidly decreased (P < 0.05) at 9 h, returning to the normal levels at 9 h in the presence of a high concentration of IT (10−5 mol/L) ( ).
Figure 6

Dose-dependent effects of AVT and IT on the expression of cox2 and itr1 mRNAs in guppy ovary fragments. Ovary fragments were incubated with AVT or IT at the concentrations of 10−5 mol/L, 10−6 mol/L or 10−7 mol/L for 3 h, and the levels of cox2 (A) and itr1 (B) mRNAs were measured using qPCR (n=5). The results are presented as the mean ± SEM and as fold changes in the expression levels versus the corresponding controls. Different capital letters indicate significant differences between the groups treated with each concentration of a hormone (P < 0.05). Different lowercase letters indicate significant differences between the two hormone treatments at the same concentration (P < 0.05).

Figure 7

Time-dependent effects of AVT and IT on the expression of cox2 and itr1 mRNAs in guppy ovary fragments. The levels of the cox2 and itr1 mRNAs were measured using qPCR (n=5). (A, B) Ovary fragments were incubated with AVT (10−5 mol/L) for 3, 6, or 9 h. (C, D) Ovary fragments were incubated with IT (10−5 mol/L) for 3, 6, or 9 h. The results are presented as the mean ± SEM and as fold changes in the expression levels versus the corresponding controls. Different capital letters indicate significant differences at the same time points between the treatment and control groups (P < 0.05). Different lowercase letters indicate significant differences in the corresponding control or treatment groups (P < 0.05).

Dose-dependent effects of AVT and IT on the expression of cox2 and itr1 mRNAs in guppy ovary fragments. Ovary fragments were incubated with AVT or IT at the concentrations of 10−5 mol/L, 10−6 mol/L or 10−7 mol/L for 3 h, and the levels of cox2 (A) and itr1 (B) mRNAs were measured using qPCR (n=5). The results are presented as the mean ± SEM and as fold changes in the expression levels versus the corresponding controls. Different capital letters indicate significant differences between the groups treated with each concentration of a hormone (P < 0.05). Different lowercase letters indicate significant differences between the two hormone treatments at the same concentration (P < 0.05). Time-dependent effects of AVT and IT on the expression of cox2 and itr1 mRNAs in guppy ovary fragments. The levels of the cox2 and itr1 mRNAs were measured using qPCR (n=5). (A, B) Ovary fragments were incubated with AVT (10−5 mol/L) for 3, 6, or 9 h. (C, D) Ovary fragments were incubated with IT (10−5 mol/L) for 3, 6, or 9 h. The results are presented as the mean ± SEM and as fold changes in the expression levels versus the corresponding controls. Different capital letters indicate significant differences at the same time points between the treatment and control groups (P < 0.05). Different lowercase letters indicate significant differences in the corresponding control or treatment groups (P < 0.05).

Colocalization of itr1 and cox2 in the Ovaries of Female Guppies

Dual-fluorescence ISH of itr1 and cox2 was performed in the ovary at two different developmental stages to determine possible direct regulatory effect of AVT on cox2 expression mediated by ITR1. As shown in , itr1-and cox2-positive signals were present in the inner follicular cell layer of late vitellogenesis-stage oocytes, indicating that the individual was fertilizable and ready for parturition and that ITR1 may regulate the expression of cox2 ( ). However, positive signal of itr1 was not detected in early vitellogenesis-stage oocytes ( ), suggesting that itr1 expression was significantly influenced by oocyte development stage. On the other hand, positive signals of itr1 were observed in ovarian stromal cells. Follicles at both stages are indicated with white arrowheads (late vitellogenesis stage oocyte follicles) and open arrowheads (early vitellogenesis stage oocyte follicles) in , showing that itr1 is only expressed in the follicular layer of late vitellogenesis-stage oocytes.
Figure 8

Dual-fluorescence ISH for itr1 (green, stained with Alexa Fluor 488) and cox2 (red, stained with Alexa Fluor 594) in guppy ovaries at different developmental stages. (A–D) ISH staining in the early vitellogenesis stage. (E–H) ISH staining in the late vitellogenesis stage. The itr1 signal overlapping with the cox2 signal in the late vitellogenesis stage in the follicular cell layer is indicated by white arrowheads. The single cox2 signal in the early vitellogenesis stage in the follicular layer is indicated by open arrowheads. Nuclei were stained with DAPI (blue). Scale bar, 20 μm.

Dual-fluorescence ISH for itr1 (green, stained with Alexa Fluor 488) and cox2 (red, stained with Alexa Fluor 594) in guppy ovaries at different developmental stages. (A–D) ISH staining in the early vitellogenesis stage. (E–H) ISH staining in the late vitellogenesis stage. The itr1 signal overlapping with the cox2 signal in the late vitellogenesis stage in the follicular cell layer is indicated by white arrowheads. The single cox2 signal in the early vitellogenesis stage in the follicular layer is indicated by open arrowheads. Nuclei were stained with DAPI (blue). Scale bar, 20 μm.

Analysis of PGF2a Concentrations in IT-and AVT-Treated Guppies

PGF2a concentrations were measured to test the effect of neuropeptides on PGF2a biosynthesis in guppy. AVT induced PGF2a synthesis (P < 0.05) compared with that in the control group and IT group 3 h after intraperitoneal (IP) injection. The values in the IT and control groups were not significantly different from each other ( ).
Figure 9

Measurement of PGF2a concentrations after IP injections of IT (1 μg/g), AVT (1 μg/g) or the same volume of saline (control). Eight individuals were analyzed in each group. Different lowercase letters indicate significant differences between the treatment groups (P < 0.05).

Measurement of PGF2a concentrations after IP injections of IT (1 μg/g), AVT (1 μg/g) or the same volume of saline (control). Eight individuals were analyzed in each group. Different lowercase letters indicate significant differences between the treatment groups (P < 0.05).

Administration of PGF2a to Pregnant Guppies Induced Premature Parturition

An IP injection of PGF2a (1,000 ng/g body wet weight) into pregnant guppies induced parturition behavior in immature larval fish. shows that the first delivery occurred approximately 1 h after the IP injection (9:43 AM local time), and no clear variations in parturition behavior were observed in the control, IT-injected (500 ng/g) and AVT-injected groups (500 ng/g) (data not shown). Up to three dead larval fish at most were observed after PGF2a injection in a guppy. Eleven dead larval fish were observed. PGF2a administration significantly induced the premature parturition of guppies. As shown in , premature larval fishes retained a larger yolk sac and lower melanin distribution on the body compared with those in the control group (ethanol). The bodies of the larval fish in the control group showed considerably more stretching than those in the PGF2a-injected group due to the lack of skeletal muscle development under premature conditions.
Figure 10

Offspring of pregnant guppies injected with PGF2a (1,000 ng/g) or ethanol (vehicle control). The PGF2a injection induced premature parturition, and larval fish presented larger yolk sac (white arrowheads) and curly bodies (A, B). n=5. Normal larval fish from ethanol-injected pregnant guppies presented a regular yolk sac (black arrowheads) and stretched bodies (C, D). n=5. Scale bar, 1 mm.

Offspring of pregnant guppies injected with PGF2a (1,000 ng/g) or ethanol (vehicle control). The PGF2a injection induced premature parturition, and larval fish presented larger yolk sac (white arrowheads) and curly bodies (A, B). n=5. Normal larval fish from ethanol-injected pregnant guppies presented a regular yolk sac (black arrowheads) and stretched bodies (C, D). n=5. Scale bar, 1 mm.

Discussion

Nonapeptide hormones have been identified in the endocrine system in various vertebrates. AVP and its homolog AVT are highly conserved, except position 3, which contains Phe in AVP and Ile in AVT. These peptides are named based on the presence of Arg at position 8. Comparison of OT and IT indicated that OT contains Gln at position 4 and Leu at position 8, and these amino acids are replaced with Ser and Ile, respectively, in IT. In teleosts, which are the predecessors of land vertebrates, amino acid sequences of the AVT and IT nonapeptides share homology, except positions 4 and 8 (1). Thus, two evolutionary lineages have been proposed, the IT-OT line and AVT-AVP line, and both lineages are associated with reproductive functions and behaviors (1, 22). High conservation between IT and AVT was confirmed in the present study by gene cloning and sequence analysis of an IT precursor, an AVT precursor and two ITRs of guppy. The predicted conserved disulfide bridge was formed by Cys residues 1 and 6. Nonapeptides were classified into AVT- and OT-like families according to the 8th amino acid, which is essential for activating the corresponding receptors (1, 46). Basic amino acids, such as Arg, are present at this position in AVT, and neutral amino acids are present in OT-like peptides (1, 46). In teleosts, the production of IT is primarily observed in the preoptic area (POA); however, ITRs are distributed in various tissues (47). The present study in guppies identified and cloned two itrs in agreement with reports in other teleosts, including zebrafish (48), medaka (49) and bicolor damselfish (Stegastes partitus) ( 50). These patterns originated due to two rounds of whole-genome duplication events in vertebrates (2R), which produced one otr and five avp receptors, and the third round in teleosts (3R) subsequently produced two local duplicates of itrs (51). In mammals, one OT receptor (OTR) and three AVP receptors (V1aR, V1bR, and V2R) have been identified in various peripheral tissues (52, 53). Regardless of the similarity of these receptors (25%), the selectivity of OT and AVP for these receptors varies between species and tissues (22, 54). Notably, AVP has similar affinity for OTR, V1aR, and V1bR (22, 55, 56). The OT receptor has the same affinity to hormones with cyclic structures and Arg-8 (AVT) or Leu-8 (OT) (1). In vertebrates, OT has been shown to stimulate PG synthesis by upregulating cox2 gene expression to induce the conversion of AA to a PG precursor (3, 27, 28). Further studies showed that in cultured endometrial explants, cox2 mRNA expression and PGF2a synthesis were increased by OT stimulation and were abolished by the OT antagonist atosiban (29). Similarly, in pre-labor human amnion epithelial cells, incubation with OT resulted in a significant increase in PGE2 levels mediated by upregulation of cox2 expression (28). In addition, the synthesis of PGs was observed in the follicles of human ovaries (57). These studies demonstrated that OT upregulates the cox2 gene by signaling via OTR. Similarly, the studies in teleosts were focused on the role of PGs in the reproductive process, including follicle rupture, ovulation, and spawning (58–60). Notably, a study on catfish (Heteropneustes fossilis) demonstrated that AVT is the main factor stimulating PGF2a synthesis (61). However, it is not known whether AVT stimulates PGF2a secretion via OTR similar to OT/IT. The results of the present study indicated that itr1 and cox2 are colocalized in the inner follicular cell layer that produces PGs. Furthermore, merged itr1/cox2 signals were also observed in ovarian stromal cells, where PGs were reported to play a role in the immune reaction (31). The CRE-luciferase assay was performed to evaluate the affinity of AVT and IT for ITR1 and to confirm our hypothesis that AVT regulates cox2 mRNA expression via ITR1. The results showed that both IT and AVT bind to ITR1; however, AVT does not display dose-dependent effects. These data are supported by previous studies showing that AVT activates teleost ITRs with lower potency than that of IT (62). AVT has a similar affinity for OTR, V1aR and V1bR (22). Then, we stimulated cultured ovary with AVT and IT in vitro. As expected, both cox2 and itr1 were upregulated by AVT and IT treatments; however, AVT treatment resulted in faster and stronger transcriptional regulation of cox2 and itr1 than that of IT. Measurement of PGF2a concentrations showed that AVT was more efficient inducer of PG synthesis. In humans, OT regulates the expression of its own mRNA through the transcription factor nuclear factor kappa B (NF-κB) and PGs in a positive feedback mechanism. A previous clinical analysis showed that the expression of cox2 and otr was high in women with high NF-κB activity (63). Similar results were obtained in primary human amnion epithelial cells incubated with IL-1β, which is an inflammatory factor that activates NF-κB, resulting in rapid upregulation of otr (28). Similarly, our results suggested a conserved parturition mechanism in mammals and live bearing teleost guppies. Notably, OT had opposite effects on luteal phase mares; however, the levels of a series of enzymes involved in PG synthesis, including cox2, were decreased after OT administration (30). The data of dual ISH indicated that itr localization followed a stage-related expression pattern. This result may explain why OT/IT has different functions in ovaries at different developmental stages. In vivo injection of PGF2a was performed to confirm its function in inducing preterm parturition. Similar to a previous study (14), prematurely delivered fry had a shorter body length and larger yolk sac. Interestingly, the results of this study indicated that a high concentration (500 ng/g), but not a low concentration (50 ng/g), of AVT can induce premature birth in guppy. However, in the present study, injection of AVT (500 ng/g) did not induce premature birth, and direct injection of PGF2a was able to significantly induce premature birth. The differences between individuals and gestation period may be responsible for variability of the results. A study on teleost ovulation reported that PGF2a was more effective than AVT in inducing ovulation in a dose- and duration-dependent manner (64). Considering that stimulation of guppy with AVT increased PGF2a concentration and did not activate premature birth, PGF2a may be more effective than AVT in induction of delivery because AVT is located upstream in the positive feedback regulation of PG synthesis (luteinizing hormone (human chorionic gonadotropin) > 17,20β-dixydroxy-4-pregnen-3-on (DP) < > AVT > PGs > final oocyte maturation (FOM)/ovulation) (64). The results also revealed that PGF2a may play a crucial role in ovoviviparous teleost parturition, similar to other live bearing species, considering the function of this PG in mammalian myometrium contraction and in follicular apoptosis in teleosts (3, 60). The presence of immature dead larval fish confirmed the effect of PGF2a on the unnatural induction of parturition in guppies. In summary, the present study is the first to identify and characterize IT, AVT and ITRs in guppies. The results of the present study contributed to elucidation of direct effects of AVT and IT on cox2 expression and subsequent induction of PG production in guppy mediated by CRE signaling, resulting in premature delivery. Our findings suggest that AVT functions as a more efficient factor that participates in parturition of live bearing teleost guppy by stimulating PG synthesis by upregulating cox2 expression.

Data Availability Statement

The data sets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/ .

Ethics Statement

The animal study was reviewed and approved by Animal Research and Ethics Committees of Ocean University of China.

Author Contributions

HSW, JFL, YL, and XQ designed the study. LKL performed the experiment. LKL, XJW, YJY, and JSL participated in the sample collection. LKL wrote the manuscript, and XQ provided feedback on the manuscript and edited the article All authors contributed to the article and approved the submitted version.

Funding

This study was supported by grants from the National Key R&D Program of China (2018YFD0901204) and The National Natural Science Foundation of China (41976089 and 41676126).

Conflict of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
  58 in total

Review 1.  Arginine vasotocin a key hormone in fish physiology and behaviour: a review with insights from mammalian models.

Authors:  R J Balment; W Lu; E Weybourne; J M Warne
Journal:  Gen Comp Endocrinol       Date:  2006-02-14       Impact factor: 2.822

2.  High levels of circulating prostaglandin F associated with ovulation stimulate female sexual receptivity and spawning behavior in the goldfish (Carassius auratus).

Authors:  Peter W Sorensen; Christopher Appelt; Norman E Stacey; Fredrick Wm Goetz; Alan R Brash
Journal:  Gen Comp Endocrinol       Date:  2018-06-22       Impact factor: 2.822

Review 3.  Prostaglandins in teleost ovulation: A review of the roles with a view to comparison with prostaglandins in mammalian ovulation.

Authors:  Takayuki Takahashi; Akane Hagiwara; Katsueki Ogiwara
Journal:  Mol Cell Endocrinol       Date:  2017-09-15       Impact factor: 4.102

4.  Effect of a High-Rate Versus a Low-Rate Oxytocin Infusion for Maintaining Uterine Contractility During Elective Cesarean Delivery: A Prospective Randomized Clinical Trial.

Authors:  Adrienne Duffield; Christine McKenzie; Brendan Carvalho; Bharathi Ramachandran; Victoria Yin; Yasser Y El-Sayed; Edward T Riley; Alexander J Butwick
Journal:  Anesth Analg       Date:  2017-03       Impact factor: 5.108

5.  Derivation and Evaluation of Putative Adverse Outcome Pathways for the Effects of Cyclooxygenase Inhibitors on Reproductive Processes in Female Fish.

Authors:  Dalma Martinovic-Weigelt; Alvine C Mehinto; Gerald T Ankley; Jason P Berninger; Timothy W Collette; John M Davis; Nancy D Denslow; Elizabeth J Durhan; Evan Eid; Drew R Ekman; Kathleen M Jensen; Michael D Kahl; Carlie A LaLone; Quincy Teng; Daniel L Villeneuve
Journal:  Toxicol Sci       Date:  2017-04-01       Impact factor: 4.849

Review 6.  Roles of prostaglandin receptors in female reproduction.

Authors:  Yukihiko Sugimoto; Tomoaki Inazumi; Soken Tsuchiya
Journal:  J Biochem       Date:  2014-12-04       Impact factor: 3.387

7.  Oxytocin antagonism reverses the effects of high oestrogen levels and oxytocin on decidualization and cyclooxygenase activity in endometrial tissues.

Authors:  Maria Sztachelska; Donata Ponikwicka-Tyszko; Gabriela Sokolowska; Slawomir Anisimowicz; Jan Czerniecki; Weronika Lebiedzinska; Monika Zbucka-Kretowska; Marek Zygmunt; Slawomir Wołczynski; Piotr Pierzynski
Journal:  Reprod Biomed Online       Date:  2019-06-12       Impact factor: 3.828

8.  Progesterone inhibits oxytocin- and prostaglandin F2alpha-stimulated increases in intracellular calcium concentrations in small and large ovine luteal cells.

Authors:  Tracy L Davis; Rebecca C Bott; Teresa L Slough; Jason E Bruemmer; Gordon D Niswender
Journal:  Biol Reprod       Date:  2009-10-07       Impact factor: 4.285

9.  Sexual dimorphism of steroidogenesis regulated by GnIH in the goldfish, Carassius auratus.

Authors:  Xin Qi; Wenyi Zhou; Danqi Lu; Qingqing Wang; Huixian Zhang; Shuisheng Li; Xiaochun Liu; Yong Zhang; Haoran Lin
Journal:  Biol Reprod       Date:  2013-04-11       Impact factor: 4.285

10.  Arginine-vasotocin expression and participation in reproduction and social behavior in males of the cichlid fish Cichlasoma dimerus.

Authors:  Martín Roberto Ramallo; Matthew Grober; Maximiliano Martín Cánepa; Leonel Morandini; Matías Pandolfi
Journal:  Gen Comp Endocrinol       Date:  2012-08-24       Impact factor: 2.822

View more
  2 in total

1.  Brain Transcriptomic Dataset During Parturition in Ovoviviparous Sebastes schlegelii.

Authors:  Likang Lyu; Haishen Wen; Yun Li; Jianshuang Li; Xiaojie Wang; Yijia Yao; Xin Qi
Journal:  Front Genet       Date:  2022-02-04       Impact factor: 4.599

2.  Identification of neurohypophysial hormones and the role of VT in the parturition of pregnant seahorses (Hippocampus erectus).

Authors:  Huixian Zhang; Yali Liu; Geng Qin; Qiang Lin
Journal:  Front Endocrinol (Lausanne)       Date:  2022-07-29       Impact factor: 6.055

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.