Literature DB >> 33958419

Genome Sequences of Neurotropic Lineage III Listeria monocytogenes Isolates UKVDL9 and 2010L-2198.

Taylor M Albrecht1, Zuzana Kucerova2, Sarah E F D'Orazio3.   

Abstract

We report the whole-genome sequence of Listeria monocytogenes UKVDL9 and an edited draft genome sequence of L. monocytogenes 2010L-2198. Both are neurotropic lineage III strains; UKVDL9 was isolated from a sheep brain, and 2010L-2198 was isolated from a human subject with rhombencephalitis.
Copyright © 2021 Albrecht et al.

Entities:  

Year:  2021        PMID: 33958419      PMCID: PMC8103864          DOI: 10.1128/MRA.00228-21

Source DB:  PubMed          Journal:  Microbiol Resour Announc        ISSN: 2576-098X


ANNOUNCEMENT

Listeria monocytogenes is a facultative intracellular bacterium that causes gastroenteritis, sepsis, meningoencephalitis, and rhombencephalitis (1). Although most cases of listeriosis occur in immunocompromised individuals, rhombencephalitis presents in young, otherwise healthy patients. This suggests that some L. monocytogenes strains have virulence factors that promote brainstem infections. We recently reported two L. monocytogenes strains that caused brainstem infections in a mouse model of foodborne listeriosis; both were classified as lineage III by the Institut Pasteur multilocus sequence typing (MLST) database (2). Strain UKVDL9 (sequence type 1140 [ST1140] by MLST analysis), provided by the University of Kentucky Veterinary Diagnostic Laboratory, was isolated from the brain of a sheep with “circling disease.” Strain 2010L-2198 (ST1590, serotype 4c), a human rhombencephalitis isolate, was provided by the CDC. Lineage III strains are not well characterized, and there has been some confusion regarding their origins and pathogenic potential (3, 4). Strain 2010L-2198 is unusual because there are no other isolates in the CDC BioNumerics database (14,788 L. monocytogenes strains collected in the United States, as of 7 January 2021) with the same ST; only three strains (one clinical isolate and two food isolates) have the same ST as UKVDL9. The whole-genome sequence of strain UKVDL9 was generated de novo by ACGT, Inc. (Chicago, IL). A DNA library was prepared from bacteria grown in brain heart infusion (BHI) broth (16 h at 37°C) using the Illumina Nextera XT DNA sample kit and was sequenced on a MiSeq platform (v. 2.6.2.1 software) using a MiSeq 300-cycle microkit (2 × 150 bp), generating a total of 1,926,930 read pairs. An Oxford Nanopore Technologies library was prepared using a ligation sequencing kit (SQKLSK109) and a native barcoding expansion kit (EXP-NBD104) following the manufacturer’s recommended procedure. The median Nanopore read length was 7,630 bases, and the read N50 value was 17,464 bases. The raw reads were trimmed using Porechop (v. 0.2.3) (5). The genome was assembled into a singular contiguous sequence that was polished using five rounds of Pilon (v. 1.22) (6), and the polished genome was fully circularized using Circlator (v. 1.5.5) (7). Default parameters were used for all software. The 2,885,142-bp genome had a GC content of 38.24% and was annotated by the NCBI Prokaryotic Genome Annotation Pipeline (PGAP) (v. 5.0) (8), which identified 2,722 protein-coding sequences. A draft genome for strain 2010L-2198 containing 35 contigs was originally reported by the CDC (9). The assembled genome had 23 gaps composed of 4,099 unknown nucleotides. To close some of the gaps, primers were designed to amplify 222- to 1,225-bp fragments by PCR using genomic DNA isolated from bacteria grown in BHI broth (16 h at 37°C) as a template. Amplicons were subjected to Sanger sequencing with both forward and reverse primers (Table 1). This resulted in the addition of 918 nucleotides to the 2,860,258-bp genome (GC content, 38.07%), with most of the remaining gaps being found in 16S and 23S rRNA. Annotation by PGAP v. 5.0 (8) identified 2,739 protein-coding sequences.
TABLE 1

Primers used for PCR and sequencing of gaps in the L. monocytogenes 2010L-2198 genome

Gap no.No. of NsForward primer (5′ to 3′)Reverse primer (5′ to 3′)Start positionaEnd positionaAmplicon size (bp)PCR typebOutcomec
116GCATTAGGTGGAGAGATTGGCCATAGTATGCTATGCCTATCGTTG719734345Std.Consensus, 16 bp added
269GCCTCTAGCTTATATTAGTGTTATGGCCTTCTCTTTGCTTGTGTTCCG5243552503305Std.Consensus, 69 bp added
364CTAGAAATCGCCTGTTTGAGACGAGCTGACGGATTACTTGATTC454894454957267Std.Consensus, 64 bp added
469CCAGCTTCATTATTCATTTCTCCCGCCTCCATCTTTTAACCACC630544630612281Std.Consensus, 69 bp added
5149CCTATGGTTAATTGGTGGTATTCGTCTCCTGTAAACATTCCACCG678010678158515Std.Consensus, 149 bp added
618CCAGAGTTAAGTAATCCAGGATACGCAAGAGCAGCTGAAAACAACGAC6958326958491,225Ext.No PCR product
748GGAAATGCCGTTAATACTGTCAAGCCTTCCTCAGAATCAGAACCATTTG946418946465490Std.Forward sequence only, 48 bp added
8137GCGGCACTAACAGTTACAAGTACCGACTGCAGGAATTGAACCCGCAACC10557671055903794Ext.Consensus, 137 bp added
957GTGTCTTAACCGCTTGACCAACGATATTAACACAACAAGGCTTCCCC12458311245983645Ext.No PCR product
1087CTAACTGGCGAAGAAGATGAACGCCGAAAGTGCCTATCCCTAAAGATC24369802437075490Std.No DNA sequence
119GGTTTGTATATCCTGAGCATGGACCTATTCCCAACTATGAAACACCGCG21818522181860738Ext.No PCR product
1213CTTGCGCCATCGTGTACTAAGACGGGATTGCTTCTACGCCATCTTC27242012724213897Ext.No PCR product
1343CAAAGTAATCGCAAAATATTGGGCATCTGGCCCTTCAACTCAATATTGTCTCGC27817532781795425Ext.Consensus, 43 bp added
14117CCCTCCTCAATTCAACTCCATCTTTTGGGGGATAGAAACTAAGCCAGATGATTGG28036452803911414Std.Forward sequence only, 117 bp added
1533GGTAATAGAGCTGAGATCGGAAAGCCTTGTCCAACTCAATTTGCCC28060902806122222Std.Consensus, 33 bp added
1663GAGGTATCATGATAGCGCAATTGCCAAAGACATTTCTGACTGCGAG28070702807132398Std.Reverse sequence only, 63 bp added
171GATAGCACTGCACCCGTCGCCACCAAGTTCGGTCGCATTTCAC15355371535537617Ext.No PCR product
181CCAACTGAGCTAAAGCGGCAGCGGCGAAAAAGTTGCTGCAGACTTAG17692001769200642Ext.No PCR product
1962GCACTGTCAGGAAATACACTATCATAGGTGTCCCCCGCTATCACCTGAAACCGAGGCAC207956520796261,011Ext.Forward sequence only, 62 bp added
2048CATCTAATTCTTGACTGGGAGCAACCCATGACGAATGCGCGACCAGATG232798423283181,109Ext.Consensus, 48 bp added
2117CGCAGCACATATGACCGGTTATGAGCCTGTTTGTTAGTGCAAGCGTAGGG26397182640084912Ext.No PCR product
221GGTACGAATTGAAGCCCCAGTAAACGGGGCTTTCTGGTTAGATACCGTCAAGG28529782852978343Ext.No PCR product
2393GCAAGGCACCATGCTTGAAGCCCCAATCTCTCCACCTAATGCTCAGTG193915Ext.No DNA sequence

Nucleotide positions refer to the original fasta sequence deposited as GenBank accession no. AAKGBO000000000.1. The newly edited version submitted to GenBank under accession no. CP069380 is the reverse complement of that sequence and was rearranged to start with the dnaA gene by convention.

PCR conditions used were as follows: standard (Std.), 2 min at 94°C; 30 s at 94°C, 30 s at 57 to 61°C, and 45 s at 72°C for 30 cycles; and 2 min at 72°C; extended (Ext.), 2 min at 94°C; 45 s at 94°C, 45 s at 61°C, and 1 min at 72°C for 35 cycles; and 2 min at 72°C. For all reactions, Invitrogen Platinum II Hot-Start PCR master mix (2×) containing Platinum II Taq Hot-Start DNA polymerase was used.

Consensus, DNA sequences for the PCR product were obtained from both the forward and reverse primers; no DNA sequence, a PCR product of the expected size was obtained, but it generated noisy reads.

Primers used for PCR and sequencing of gaps in the L. monocytogenes 2010L-2198 genome Nucleotide positions refer to the original fasta sequence deposited as GenBank accession no. AAKGBO000000000.1. The newly edited version submitted to GenBank under accession no. CP069380 is the reverse complement of that sequence and was rearranged to start with the dnaA gene by convention. PCR conditions used were as follows: standard (Std.), 2 min at 94°C; 30 s at 94°C, 30 s at 57 to 61°C, and 45 s at 72°C for 30 cycles; and 2 min at 72°C; extended (Ext.), 2 min at 94°C; 45 s at 94°C, 45 s at 61°C, and 1 min at 72°C for 35 cycles; and 2 min at 72°C. For all reactions, Invitrogen Platinum II Hot-Start PCR master mix (2×) containing Platinum II Taq Hot-Start DNA polymerase was used. Consensus, DNA sequences for the PCR product were obtained from both the forward and reverse primers; no DNA sequence, a PCR product of the expected size was obtained, but it generated noisy reads.

Data availability.

Raw reads for UKVDL9 were deposited in the Sequence Read Archive (SRA) as accession no. SRX10056804 (Illumina) and SRX10056805 (Nanopore); the circular genome sequence can be found as GenBank accession no. CP065028. Raw reads for 2010L-2198 were deposited as BioProject no. PRJNA212117; the revised draft genome is GenBank accession no. CP069380.1.
  8 in total

1.  RefSeq: expanding the Prokaryotic Genome Annotation Pipeline reach with protein family model curation.

Authors:  Wenjun Li; Kathleen R O'Neill; Daniel H Haft; Michael DiCuccio; Vyacheslav Chetvernin; Azat Badretdin; George Coulouris; Farideh Chitsaz; Myra K Derbyshire; A Scott Durkin; Noreen R Gonzales; Marc Gwadz; Christopher J Lanczycki; James S Song; Narmada Thanki; Jiyao Wang; Roxanne A Yamashita; Mingzhang Yang; Chanjuan Zheng; Aron Marchler-Bauer; Françoise Thibaud-Nissen
Journal:  Nucleic Acids Res       Date:  2020-12-03       Impact factor: 16.971

Review 2.  Listeria monocytogenes lineages: Genomics, evolution, ecology, and phenotypic characteristics.

Authors:  Renato H Orsi; Henk C den Bakker; Martin Wiedmann
Journal:  Int J Med Microbiol       Date:  2010-08-13       Impact factor: 3.473

3.  Foodborne listeriosis.

Authors:  W F Schlech
Journal:  Clin Infect Dis       Date:  2000-09-26       Impact factor: 9.079

4.  Genetic and phenotypic characterization of Listeria monocytogenes lineage III.

Authors:  Angela Roberts; Kendra Nightingale; Greg Jeffers; Esther Fortes; Jose Marcelino Kongo; Martin Wiedmann
Journal:  Microbiology (Reading)       Date:  2006-03       Impact factor: 2.777

5.  Pilon: an integrated tool for comprehensive microbial variant detection and genome assembly improvement.

Authors:  Bruce J Walker; Thomas Abeel; Terrance Shea; Margaret Priest; Amr Abouelliel; Sharadha Sakthikumar; Christina A Cuomo; Qiandong Zeng; Jennifer Wortman; Sarah K Young; Ashlee M Earl
Journal:  PLoS One       Date:  2014-11-19       Impact factor: 3.240

6.  Circlator: automated circularization of genome assemblies using long sequencing reads.

Authors:  Martin Hunt; Nishadi De Silva; Thomas D Otto; Julian Parkhill; Jacqueline A Keane; Simon R Harris
Journal:  Genome Biol       Date:  2015-12-29       Impact factor: 13.583

7.  Completing bacterial genome assemblies with multiplex MinION sequencing.

Authors:  Ryan R Wick; Louise M Judd; Claire L Gorrie; Kathryn E Holt
Journal:  Microb Genom       Date:  2017-09-14

8.  Neurotropic Lineage III Strains of Listeria monocytogenes Disseminate to the Brain without Reaching High Titer in the Blood.

Authors:  Taylor E Senay; Jessica L Ferrell; Filip G Garrett; Taylor M Albrecht; Jooyoung Cho; Katie L Alexander; Tanya Myers-Morales; Olivia F Grothaus; Sarah E F D'Orazio
Journal:  mSphere       Date:  2020-09-16       Impact factor: 4.389

  8 in total
  1 in total

1.  Retrospective Investigation of the Whole Genome of the Hypovirulent Listeria monocytogenes Strain of ST201, CC69, Lineage III, Isolated from a Piglet with Fatal Neurolisteriosis.

Authors:  Sergey S Zaitsev; Mariya A Khizhnyakova; Valentina A Feodorova
Journal:  Microorganisms       Date:  2022-07-17
  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.