Laminar flow substantially affects the morphology and functional phenotype of glomerular endothelial cells.

Shear stress induced by laminar blood flow has a profound effect on the morphology and functional phenotype of macrovascular endothelial cells. The influence of laminar flow on the glomerular microvascular endothelium, however, remains largely elusive. The glomerular endothelium, including its glycocalyx, is a crucial part of the glomerular filtration barrier, which is involved in blood filtration. We therefore investigated the influence of laminar flow-induced shear stress on the glomerular endothelium. Conditionally immortalized mouse glomerular endothelial cells were cultured for 7 days under a laminar flow of 5 dyn/cm2 to mimic the glomerular blood flow. The cells were subsequently analysed for changes in morphology, expression of shear stress-responsive genes, nitric oxide production, glycocalyx composition, expression of anti-oxidant genes and the inflammatory response. Culture under laminar flow resulted in cytoskeletal rearrangement and cell alignment compared to static conditions. Moreover, production of nitric oxide was increased and the expression of the main functional component of the glycocalyx, Heparan Sulfate, was enhanced in response to shear stress. Furthermore, glomerular endothelial cells demonstrated a quiescent phenotype under flow, characterized by a decreased expression of the pro-inflammatory gene ICAM-1 and increased expression of the anti-oxidant enzymes HO-1 and NQO1. Upon exposure to the inflammatory stimulus TNFα, however, glomerular endothelial cells cultured under laminar flow showed an enhanced inflammatory response. In conclusion, laminar flow extensively affects the morphology and functional phenotype of glomerular endothelial cells in culture. Furthermore, glomerular endothelial cells respond differently to shear stress compared to macrovascular endothelium. To improve the translation of future in vitro studies with glomerular endothelial cells to the in vivo situation, it appears therefore crucial to culture glomerular endothelial cells under physiological flow conditions.

Introduction

The nephron is the functional unit of the kidney, in which the glomerulus is responsible for filtration of the blood, a process in which passage of plasma proteins into the urine is restricted in a charge- and size selective manner [1]. The two cell types constituting the glomerular filtration barrier are glomerular endothelial cells (GEnC) and podocytes (glomerular visceral epithelial cells), which are separated by the glomerular basement membrane (GBM) [2]. GEnC are lining the glomerular capillaries, contain numerous fenestrae and are covered by a glycocalyx, which is a thick layer of carbohydrates. The endothelial glycocalyx plays an important role in glomerular function, by contributing to endothelial barrier function, glomerular structural integrity and by preventing immune cell and cytokine adhesion [3-5]. Hyaluronic Acid (HA) is the main non-sulfated glycosaminoglycan (GAG) in the glycocalyx, providing its gel-like structure. Heparan Sulfate (HS) is the main functional sulphated GAG contributing to the charge-selective function of the endothelial barrier. Under pathological conditions, HS within the glycocalyx is degraded by heparanase (HPSE). HS degradation compromises the barrier function of the endothelium, and the glycocalyx transforms into a proinflammatory docking station that facilitates binding of cytokines [3,5-7]. Podocytes are highly specialized epithelial cells that wrap around the glomerular capillary with their foot processes, forming a sieve-like structure between adjacent foot processes, called the slit diaphragm.

Blood flow is well-known to affect the morphology and phenotype of the aortic macrovascular endothelium by inducing shear stress [8-11]. The importance of shear stress on macrovascular endothelium has for example been shown during the pathogenesis of atherosclerosis [12]. When aortic flow is disturbed, this predisposes aortic regions to the development of atherosclerosis and stimulates a pro-inflammatory phenotype of the endothelial cells. In addition, culture of macrovascular endothelial cells under flow for 7 days resulted in the induction of an anti-inflammatory phenotype and reduced oxidative stress [8-11]. Besides inducing this quiescent phenotype, shear stress has been shown to alter the glycocalyx composition and the expression of glycocalyx modifying enzymes of the macrovasculature [13-15].

Based on aforementioned findings in macrovascular endothelium, it is hypothesized that blood flow also influences, among others, the inflammatory phenotype and the endothelial glycocalyx composition of GEnC. By preventing the pro-inflammatory phenotype of GEnC and regulating the glycocalyx composition, shear stress might play a pivotal role in the maintenance of a healthy glomerular endothelium, the preservation of the glomerular filtration barrier and eventually the correct filtration of blood in the kidney. Importantly, GEnC are microvascular endothelial cells with several unique characteristics in comparison with the macrovascular endothelium. For example, GEnC are extremely flattened endothelial cells, contain numerous non-diaphragmed fenestrae, experience lower flow rates in vivo and lack the surrounding vascular smooth muscle cells (VSMC) [2]. It is therefore unknown whether the results from studies using macrovascular endothelial cells can be translated to microvascular cells like GEnC. In the very few studies in which GEnC were cultured under laminar flow, the effect of shear stress on the anti-oxidant response, the inflammatory response and the glycocalyx composition was not examined [16-20]. Studies investigating the effect of shear stress on GEnC primarily focussed on the secretion of paracrine factors like endothelin-1 and nitric oxide (NO) [16-19]. In addition, in two studies which investigated the influence of shear stress on GEnC, non-uniform flow was applied to the cells [16,17]. Furthermore, GEnC were solely exposed to shear stress for 1 day in three of the studies [16,18,19]. From studies using macrovascular endothelial cells, it is known that shear stress should be applied for 7 days in a uniform way to accurately mimic the influence of blood flow in vivo [8-11]. In addition, non-uniform laminar flow is known to play an important pathogenic role in atherosclerosis [12]. It remains therefore elusive how laminar flow affects the functional phenotype of GEnC. As cultured GEnCs are often used as experimental tools in research on the glomerular filtration barrier, whether GEnCs are cultured under static or laminar flow conditions could be of importance when translating in vitro results to the in vivo situation.

To study the effect of shear stress on GEnC in a way that more closely resembles the in vivo situation, we compared GEnC cultured for 7 days under laminar flow using physiologically relevant levels of shear stress to the static culture condition [21,22]. In summary, we show that laminar flow for 7 days has a profound effect on the morphology and functional phenotype of GEnC in vitro, as evidenced by increased NO production, increased HS expression and an altered anti-oxidant and inflammatory response. In addition, GEnC respond differently to laminar flow than macrovascular endothelial cells, as shown by their changes in glycocalyx composition and response to inflammatory stimulation.

Materials and methods

Cell culture

Conditionally immortalized mouse glomerular endothelial cells (mGEnC) were cultured as described previously [23]. This cell line was isolated and characterized by our lab by Rops et al in 2004 [23]. Briefly, mGEnC were seeded in μ-slides Luer I0.8 (ibidi, Gräfelfing, Germany), which were coated at 37°C for 1hr with 1% gelatine, dried for 1hr at 37°C and subsequently coated for 1hr with 1.5μg/cm2 bovine Fibronectin at 37°C. 3 hours upon seeding, the μ-slides were connected to the ibidi Pump system and mGEnC were exposed to a shear stress of 1 dyn/cm2 for 30 minutes, subsequently to 2 dyn/cm2 for 30 minutes and finally to 5 dyn/cm2 for the remaining 7 days.

RNA isolation, reversed transcription and quantitative PCR analysis

RNA was isolated from mGEnC using Trizol (Thermofisher Scientific, Breda, The Netherlands) and 0.5–1μg RNA was reverse-transcribed into cDNA using the Transcription First Strand cDNA synthesis kit (Roche, Woerden, The Netherlands) according to manufacturer’s instructions. Quantitative gene expression levels were determined by quantitative PCR using SYBR Green (Roche diagnostics, Woerden, The Netherlands) on a CFX 96 C1000 Thermal Cycler (Biorad, Lunteren, The Netherlands) and normalized to Hypoxanthine-guanine phosphoribosyltransferase (HPRT) or glyceraldehyde 3-phosphate dehydrogenase (GAPDH) levels using the delta-delta CT method. Sequences of gene specific primers are listed in Table 1.

Table 1

Overview of the primers used in this study.

Gene name	Gene symbol	Forward sequence (5’-3’)	Reverse sequence (5’-3’)
HPRT	HPRT	TCCTCCTCAGACCGCTTTT	CCTGGTTCATCATCGCTAATC
GAPDH	GAPDH	GTGTTCCTACCCCCAATGTGTC	GTGTTCCTACCCCCAATGTGTC
KLF2	KLF2	ACCAAGAGCTCGCACCTAAA	GTGGCACTGAAAGGGTCTGT
CYP1B1	CYP1B1	GATGTGCCTGCCACTATTACG	CCCACAACCTGGTCCAACTCA
ICAM-1	ICAM-1	GTCGAAGGTGGTTCTTCTGAG	TCCGTCTGCAGGTCATCTTAGG
HPSE	HPSE	GAGCGGAGCAAACTCCGAGTGTATC	GATCCAGAATTTGACCGTTCAGTTGG
iNOS	NOS2	AATCTTGGAGCGAGTTGTGG	CAGGAAGTAGGTGAGGGCTTG
eNOS	NOS3	GGTAGTTAGGGCATCCTGCTG	GTCTGGGACTCACTGTCAAAG
Nrf2	NRF2	TAGATGACCATGAGTCGCTTGC	TAGATGACCATGAGTCGCTTGC
HO-1	HO-1	CCAGTCGCCTCCAGAGTTTC	CAAATCCTGGGGCATGCTGTC
NQO1	NQO1	CATTGCAGTGGTTTGGGGTG	GCAGGATGCCACTCTGAATC
HAS1	HAS1	GAGGCCTGGTACAACCAAAAG	CTCAACCAACGAAGGAAGGAG
HAS2	HAS2	TGGTGAGACAGAAGAGTCCCA	GATGAGGCAGGGTCAAGCAT

Immunofluorescent staining

Cells were fixed for 10 minutes with 2% paraformaldehyde (PFA) and 4% sucrose for eNOS and iNOS staining and with 90% ice-cold acetone for wheat germ agglutinin (WGA) and Heparan Sulfate epitope JM403 staining. In case of PFA fixation, cells were permeabilized for 10 minutes with a 0.3% Triton X-100 solution in 1x PBS and subsequently blocked for 30 minutes with blocking solution consisting of 2% BSA, 2% FCS and 0.2% fish gelatine. When cells were fixed with acetone, 1% BSA was used as blocking solution. Primary antibodies or WGA lectin were diluted in blocking buffer and incubated for 1hr at room temperature (RT): eNOS (1:100 dilution, Thermofisher, PA3-031A), Heparan Sulfate (1:100 dilution, Amsbio, JM403), iNOS (1:100 dilution, abcam, ab178945) and biotinylated WGA (1:1000 dilution, vectorlabs). Goat anti-Rabbit Alexa 488, Goat anti-Mouse Alexa 488 and Alexa 488 conjugated Streptavidin (all from Thermofisher Scientific) were diluted in blocking buffer (1:200) and incubated for 45 minutes in the dark at RT. When using Phalloidin-TRITC to stain the actin skeleton, cells were incubated for 45 minutes with Phalloidin-TRITC (1:200, Thermofisher) in 1% BSA and 0.1% sodium azide solution after permeabilization with 0.3% Triton X-100 for 10 minutes.

Nitric oxide detection

Production of nitric oxide (NO) in mGEnC was visualized using the NO-sensitive dye 4-Amino-5-Methylamino-2’,7’-Difluoroscein (DAF-FM) diacetate. Upon 7 days differentiation under either static condition or under a flow of 5 dyn/cm2, cells were incubated for 60 minutes with 10μM DAF-FM diacetate in phenol red free and FBS free medium at 37°C. Cells were subsequently washed three times with Hank’s balanced salt solution (HBSS, Gibco, Breda, The Netherlands) to remove excess probe and incubated for an additional 45 minutes. Immediately thereafter, fluorescent images were made at a Leica DMI600B microscope.

Statistical analyses

Numerical results are presented as mean ± SEM. ImageJ (v.1.47) was used for the analysis and quantification of fluorescent intensity. Statistical analysis was conducted by a two-tailed student’s t-test when 2 experimental groups were compared for qPCR experiments and a one-way ANOVA with a Tukey’s Post-Hoc test was used when 3 or more experimental conditions were compared. For the analysis of the fold changes in fluorescent intensity, a paired t-test was conducted. All statistical analyses were performed using GraphPad Prism version 5 (GraphPad Software, Inc., San Diego, CA, USA). A P-value of <0.05 was considered statistically significant.

Results

Laminar flow induces morphological changes in GEnC

The most profound alterations of macrovascular endothelial cells in response to shear stress are the alignment of the cells and the rearrangement of the actin cytoskeleton in the direction of the laminar flow [24-26]. We therefore investigated how the morphology and the actin skeleton alignment of GEnC changed in response to laminar flow. Culture under laminar flow for 7 days resulted in the partial alignment of GEnC in the direction of the flow (). In addition, GEnC cultured under static conditions displayed a random distribution of the actin skeleton ( left panel), whereas when cultured under flow, GEnC partially demonstrated actin fibre organization in the direction of the flow ( right panel).

Laminar flow induces morphological changes and increases expression of key regulators of the shear stress response in GEnC.

mGEnCs were cultured under static conditions or under a laminar flow of 5 dyn/cm2 for 7 days. Representative brightfield images (A) and representative fluorescent images of β-actin filaments stained with Phalloidin-TRITC (B). Arrows indicate the direction of the flow. mRNA expression levels of the shear stress responsive genes KLF2 (C) and CYP1B1 (D) in mGEnCs cultured under either static conditions or flow. *** p<0.001.

Laminar flow increases expression of key regulators of shear stress response in GEnC

Krüppel-Like Factor 2 (KLF2) and Cytochrome P450 B1 (CYP1B1) are key regulators of the shear stress response in macrovascular endothelial cells and are responsible for activating numerous downstream signalling pathways in response to shear stress [9-11,27,28]. We therefore examined the effect of flow on the expression of KLF2 and CYP1B1 in GEnC, and found that the expression of both KLF2 and CYP1B1 was enhanced in GEnC cultured under flow compared to GEnC cultured under static conditions (p<0.001, and ).

Laminar flow increases NO production by GEnC

NO is a pivotal paracrine factor for maintaining a healthy endothelium and the synthesis of NO is known to be increased in macrovascular endothelial cells in response to laminar flow [29] and in GEnC upon exposure to shear stress for 1 day [16]. We therefore investigated the effect of culturing GEnC under laminar flow for 7 days on NO production by GEnC. NO production was increased (p = 0.0094) in GEnC upon exposure to shear stress for 7 days ( and ). The mRNA expression of endothelial Nitric Oxide Synthase (eNOS) was increased when GEnC were cultured under laminar flow ( p = 0.0179). Furthermore, eNOS protein expression was also increased when GEnC were exposed to shear stress ( and p = 0.04). Both RNA and protein expression of iNOS were not increased in response to shear stress ( and ). Thus, laminar flow seems to increase synthesis of NO by GEnC via increased expression of eNOS.

Laminar flow increases NO production in GEnCs.

mGEnCs were cultured either under static conditions or under a laminar flow of 5 dyn/cm2 for 7 days. Representative images of stainings for NO (probed with DAF-FM diacetate) (A), iNOS (E) and eNOS (G) of mGEnC cultured under static (left panel) or flow (right panel). Arrows indicate the direction of the flow applied. Quantification of the fluorescent intensity of NO (B), iNOS (F) and eNOS (H) staining, respectively. mRNA expression levels of iNOS (C) and eNOS (D) in mGEnCs cultured under either static conditions or flow. * p<0.05 ** p<0.01.

Laminar flow induces changes in the glycocalyx of GEnC

The endothelial glycocalyx is essential for glomerular structural integrity. Shear stress has been shown to affect the glycocalyx composition of macrovascular endothelial cells and the expression of glycocalyx modifying enzymes [13-15] Therefore, we addressed the influence of laminar flow on the glycocalyx of GEnC. The lectin WGA is able to detect both HA and HS, whereas JM403 is a monoclonal antibody specific for HS. The expression of HS under flow conditions, as measured with JM403, increased compared to static conditions ( and p = 0.01). The enhanced HS expression was accompanied with a decreased mRNA expression of the HS-degrading enzyme heparanase (HPSE1) ( p<0.001). Moreover, the expression of the HS-synthesizing enzyme exostosin-1 (EXT1) was enhanced ( p = 0.003), while the expression of two other HS-synthesizing enzymes; exostosin-2 (EXT2) and bifunctional heparan sulfate N-deacetylase/N-sulfotransferase 2 (NDST2) did not change in response to shear stress ( and ). In addition, the expression of NDST1 was decreased when GEnC were exposed to laminar flow (, p = 0.04). ( and ). The mRNA expression of the HA-biosynthetic genes [30] Hyaluronan Synthase 1 (HAS1) decreased, while HAS2 mRNA increased under laminar flow ( and , p = 0.008 and p = 0.02, respectively). mRNA expression of HAS3 was under the detection limit and therefore not shown. Furthermore, the expression of the HA-degrading enzyme hyaluroniase-1 (HYAL1) was enhanced (, p<0.001), whereas HYAL2 expression was unaffected by shear stress (). Although the expression of HA-synthesizing and HA-degrading enzymes altered, the intensity of the WGA staining (which stains for both HS and HS) did not alter between GEnC cultured under either static conditions or under laminar flow. In summary, laminar flow affects the glycocalyx composition of GEnC, by decreasing the expression of HPSE and the subsequent increased expression of HS.

Laminar flow alters the composition of the endothelial glycocalyx.

mGEnCs were cultured under static conditions or under a laminar flow of 5 dyn/cm2 for 7 days. Representative images for the HS staining with JM403 (A) or WGA (C) under static (left panel) or flow (right panel). Arrows indicate the direction of the flow applied. Quantification of the fluorescent intensity of the JM403 (B) and WGA (D) staining. mRNA expression levels of HPSE (E), EXT1 (F), EXT2 (G), NDST1 (H), NDST2 (I), HAS1 (J), HAS2 (K), HYAL1 (L) and HYAL2 (M) in mGEnCs cultured under either static conditions or flow. * p<0.05 ** p<0.01 *** p<0.001.

Laminar flow induces a quiescent inflammatory and anti-oxidant phenotype in GEnC

Laminar flow induces a quiescent phenotype, characterized by increased expression of anti-oxidant enzymes for enhanced protection against oxidative stress and decreased expression of inflammatory markers in macrovascular endothelial cells [31]. This quiescent phenotype is important for endothelial cells to maintain its physiological functions [11,31]. To examine the effect of shear stress on the anti-oxidant response in GEnC, the expression of Nuclear Factor erythroid 2-related factor (Nrf2) was examined. Nrf2 is a master regulator of the anti-oxidant response and able to increase the expression of the anti-oxidant enzymes heme oxygenase 1 (HO-1) and NAD(P)H dehydrogenase quinone 1 (NQO1). Laminar flow increased the expression of Nrf2 in GEnC ( p = 0.02). In addition, a strong trend in increased expression of HO-1 could be observed (, p = 0.05) and the expression of NQO1 was elevated in response to shear stress ( p = 0.004).

Laminar flow increases the expression of anti-oxidant genes and decreases the inflammatory basal state of GEnC.

mGEnC were cultured under static conditions or under a laminar flow of 5 dyn/cm2 for 7 days. mRNA expression levels of Nrf2 (A) HO-1 (B), NQO1 (C) and ICAM-1 (D) in mGEnCs cultured under either static conditions or flow. mRNA expression levels of ICAM-1 (E) and iNOS (F) in mGEnCs cultured under static conditions and under flow, either unstimulated or stimulated with 10ng/mL TNFα for 18hrs * p<0.05, ** p<0.01, *** p<0.001.

Next, the influence of shear stress on the inflammatory phenotype of GEnC was determined. Laminar flow resulted in decreased expression of the key endothelial inflammatory marker ICAM-1 ( p<0.001). We subsequently investigated if GEnC cultured under flow also responded differently to inflammatory conditions compared to GEnC not exposed to shear stress. ICAM-1 expression increased ~3-fold in GEnC cultured under static conditions, while iNOS expression remained unaltered, upon exposure to 10ng/mL TNFα ( and , p<0.05). When GEnC were exposed to shear stress, ICAM-1 expression increased ~25 fold upon TNFα exposure (, p<0.001). Furthermore, in contrast to GEnC cultured under static conditions, TNFα exposure resulted in an increased iNOS expression in GEnC cultured under laminar flow ( p<0.001). In summary, laminar flow leads to enhanced expression of anti-oxidant enzymes and an altered inflammatory state of GEnC.

Discussion

The present study is the first to detail the effect of laminar flow on GEnC in culture. We demonstrated altered morphology of GEnC, increased expression of shear stress-responsive genes, elevated NO production, and an altered anti-oxidant and inflammatory response. Furthermore, shear stress altered the glomerular endothelial glycocalyx, characterized by increased HS expression.

Chronic exposure to physiological shear stress induces a quiescent inflammatory phenotype in macrovascular endothelial cells [8-11] and prevents TNFα-induced pro-inflammatory responses in the aorta [32]. We found in the current study that GEnC exposed to shear stress also showed a quiescent inflammatory phenotype, as evident from decreased ICAM-1 expression. However, GEnC were more responsive under inflammatory conditions when exposed to shear stress, compared to GEnC cultured under statistic conditions. Additional findings in our study highlight how GEnC respond differently to shear stress compared to macrovascular endothelial cells. A recent study showed the increased expression of NDST1 and EXT2 upon exposure to shear stress for 7 days in macrovascular endothelial cells [33]. Furthermore, a more intense WGA staining was observed in the macrovascular endothelium as a result of laminar flow for 7 days [33]. In the present study, however, we detected a decreased NDST1 expression and were unable to show an effect of shear stress on EXT2 expression and WGA staining. Taken together this suggests that GEnC respond differently to laminar than macrovascular endothelial cells. We therefore do not recommend to extrapolate findings about the influence of laminar from studies using macrovascular endothelial cells to the glomerular endothelium. More studies are therefore required to fully characterize the influence of laminar flow on GEnC, for example by studying the effect of a disturbed glomerular blood flow on the inflammatory phenotype of GEnC. GEnCs cultured under static conditions are often used as an experimental tool in research on the glomerular filtration barrier [34-36]. Based on the findings in the current study, culturing GEnC under laminar flow for 7 days might improve the potential of GEnC to mimic glomerular physiology in vitro and eventually a better understanding of the glomerular filtration barrier.

The endothelial glycocalyx is crucial for regulating kidney function, for example by maintaining glomerular structural integrity and contributing to the endothelial barrier function [3-5]. In this study, we discovered that shear stress altered the glycocalyx composition of GEnC. This was evident by the increased expression of HS, the main functional component of the endothelial glycocalyx [37]. The increased expression of HS correlated with the decreased expression of HPSE when GEnC were cultured under laminar flow. Importantly, HPSE is also crucial for the development of acute experimental glomerulonephritis and diabetic nephropathy [7,38]. The induction of experimental glomerulonephritis resulted in increased HPSE expression, a decreased glomerular HS expression and increased proteinuria in wildtype mice. In HPSE-deficient mice, however, renal function was improved and proteinuria was reduced compared to wildtype mice upon inducing experimental glomerulonephritis [38]. Furthermore, a systemic HPSE knock-out prevented mice from the development of proteinuria upon inducing experimental diabetic nephropathy [7]. HPSE expression is also influenced by shear stress in the macrovasculature; HPSE expression and activity were increased in aortic regions with a disturbed aortic blood flow [13]. These aortic regions showed more advanced progression of atherosclerotic lesions and increased inflammation compared to regions with a normal blood flow. Combined with our finding in the current study about shear stress-mediated downregulation of HPSE in GEnC, this might suggest that a normal glomerular blood flow is an important factor to prevent HPSE upregulation, the preservation of a quiescent endothelial phenotype and the prevention of glomerular inflammation.

A limitation of the current study is that monocultures of conditionally immortalized GEnC were used. Extensive efforts are currently underway in the development of glomerulus-on-a-chip models in order to recapitulate the in vivo situation by co-culturing GEnC with podocytes [39-41]. In these devices, GEnC should be cultured under laminar flow, as our study shows that culturing GEnC under physiological shear stress has a profound effect on their morphology and functioning. Studies investigating the specific effect of flow on GEnC in these devices, however, are still lacking. It is therefore impossible to dissect the influence of flow and the impact of co-culture with podocytes on the phenotype of GEnC in these devices. More detailed information about the individual contributions of the co-culture and laminar flow to the glomerulus-on-a-chip models might eventually lead to a better understanding of the physiology of the in vivo glomerulus.

In conclusion, culturing GEnC under laminar flow for 7 days has a profound effect on their morphology and functional phenotype. In addition, GEnC respond differently to shear stress than macrovascular endothelial cells, as evidenced by the response of GEnC under inflammatory conditions and alterations in glycocalyx composition. Culturing GEnC under laminar flow for 7 days might therefore be a new necessary in vitro tool for a better understanding of glomerular (patho)physiology in vivo.

21 Apr 2021

Laminar flow substantially affects the morphology and functional phenotype of glomerular endothelial cells

PONE-D-21-07368

Dear Dr. van der Vlag,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Nicole Endlich, Prof

Academic Editor

PLOS ONE

Journal requirements:

1. In your Methods section, please provide additional details regarding the cell lines used in your study and ensure you have described the source. For more information regarding PLOS' policy on materials sharing and reporting, see https://journals.plos.org/plosone/s/materials-and-software-sharing#loc-sharing-materials, and for more information on PLOS ONE's guidelines for research using cell lines, see https://journals.plos.org/plosone/s/submission-guidelines#loc-cell-lines.

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: In their very well designed comprehensive study the Authors present novel findings on the effects of a long-term shear stress on glomerular endothelial cells in culture. The Authors have investigated and characterized the key GEnC features that are typically sensitive to the shear stress, such as NO synthesis, expression of stress-responsive genes and proteins, or cytoskeleton shape.

Presented results are convincing and they clearly indicate that cells in culture should be exposed to stimuli similar to those in vivo. Otherwise, the results may not sufficiently reflect the actual cell reaction.

On the other hand, this is a very inspiring study that should be (and I believe, will be) followed by next experiments investigating the reciprocal contacts between the GEn cells and the podocytes , in conditions where both cell types are grown under laminar flow.

Reviewer #2: In my view, it is a flawless study. No suggestions for improvements

This is a well-done study on an important subject. Such a study has been overdue. I recommend to accept this manuscript without any changes. In my view, it is a flawless study.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Barbara Lewko, PhD, Department of Pharmacological Pathophysiology, Faculty of Pharmacy, Medical University of Gdansk, Poland

Reviewer #2: No

27 Apr 2021

PONE-D-21-07368

Laminar flow substantially affects the morphology and functional phenotype of glomerular endothelial cells

Dear Dr. Nijenhuis:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Professor Nicole Endlich

Academic Editor

PLOS ONE