| Literature DB >> 33936160 |
Peng Yi1, Xiongfeng Xu1, Jiawei Yao1, Bo Qiu1.
Abstract
Objectives Transcriptional changes in cartilage can impact function by causing degradation such as that which occurs during the development of osteoarthritis (OA). Epigenetic regulation may be a key factor leading to transcriptional changes in OA. In this study, we performed a combined analysis of DNA methylation and gene expression microarray datasets and identified key transcription factors (TFs) central to the regulation of gene expression in OA. Methods A DNA methylation profile dataset (GSE63106) and a gene expression profiling dataset (GSE114007) were extracted from the Gene Expression Omnibus (GEO). We used ChAMP methylation analysis and the Limma package to identify differentially methylation genes (DMGs) and differentially expressed genes (DEGs) from normal and human knee cartilage samples in OA. Function enrichment analysis of DMGs was conducted using the DAVID database. A combined analysis of DEGs and DMGs was conducted to identify key TFs in OA. We then validated the mRNA expression of selected TFs in normal and OA cartilage by RT-qPCR. Primary chondrocytes were cultured and treated with the DNA methylation inhibitor 5-Aza-2-deoxycytidine (5-Aza) for functional validation. Results We identified 2,170 differential methylation sites (DMS) containing 1005 genes and 1986 DEGs between normal human and OA cartilage. Functional analysis of DMGs revealed that focal adhesion, extracellular matrix (ECM)-receptor interactions, the PI3K-Akt signaling pathway, and the FoxO signaling pathway were involved in OA. Integrated analysis showed a subset of 17 TFs. Four TFs (ELF3, SOX11, RARA, and FOXD2) were validated. RT-qPCR results showed the mRNA expression of SOX11, RARA, and FOXD2 were consistent with the results from the mRNA expression data. However, the expression of ELF3 could not be validated. Upon 5-Aza-2'-deoxycytidine (5-Aza) treatment, the mRNA levels of ELF3 and SOX11 were down-regulated, whilst RARA was up-regulated, and FOXD2 showed no significant change in expression level. Conclusions the effect of DNA methylation on the transcriptional regulation is related to the distribution of methylated sites across the genome. Epigenetic studies on the positions of DMS in transcriptional units can inform a better understanding of the function of DNA methylation and its transcription regulation.Entities:
Keywords: DNA methylation; chondrocytes; gene transcription; genomic regions; osteoarthritis
Year: 2021 PMID: 33936160 PMCID: PMC8082497 DOI: 10.3389/fgene.2021.618803
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.599
Primer sequences of the genes used for RT-qPCR.
| Primer sequence (5′-3′) | ||
| CAATGACCCCTTCATTGACC | GACAAGCTTCCCGTTCTCAG | |
| GATCTCCGAGCAAGAGCGTAG | GTCTTCGACCAGAACTGGGG | |
| GCGCCAAAGCCTTCTACG | GAGCGATAGAGCCCGCTTAG | |
| CACACACCTGAGCAGCATCAC | CGGTCCTTTGGTCAAGCAGT | |
| AGCGGAGGAGGTTTTCAGTG | TTCCATTCGGTCTCGCCAAA | |
FIGURE 1Unsupervised hierarchical clustering of the methylation levels of the DMS from the preserved and affected cartilage, based on the cut-off criteria of abs(logFC) >0.1 and adjusted P-value < 0.05.
FIGURE 2(A) GO analysis of the DMGs. (B) KEGG pathway analysis of the DMGs. The columns are represented as the negative log10 of the P-value. DMGs: differentially methylated genes; KEGG: Kyoto Encyclopedia of Genes and Genomes.
FIGURE 3Unsupervised hierarchical clustering of the DEGs, based on their expression levels, from the normal and OA articular cartilage samples using the cut-off criteria of abs (logFC) >1 and adjusted P-value < 0.05.
DMS and Array sites (after filtering) in different genomic regions.
| Genomic regions | DMS | DMS rate | Array sites (after filtering) | Array Rate (after filtering) |
| 3’UTR | 83 | 4% | 15005 | 4% |
| 5’UTR | 179 | 8% | 37756 | 9% |
| 1stExon | 23 | 1% | 19832 | 5% |
| Gene Body | 886 | 41% | 139677 | 34% |
| TSS200 | 52 | 2% | 46675 | 11% |
| TSS1500 | 132 | 6% | 60212 | 14% |
| IGR | 815 | 38% | 94216 | 23% |
| island | 125 | 6% | 132924 | 32% |
| opensea | 1420 | 65% | 144283 | 35% |
| shelf | 242 | 11% | 38337 | 9% |
| shore | 383 | 18% | 97829 | 24% |
| Enhancer | 1189 | 55% | 94497 | 23% |
| No enhancer | 981 | 45% | 318876 | 77% |
DETFs harboring DMS in knee articular cartilage from normal and OA patients.
| Methylation Status in OA | TFs | Gene expression status in OA | Genomic regions | logFC of GSE63106 | logFC of GSE114007 |
| Hyper-methylated | Upregulated | 3’UTR | 0.114052191 | 3.830859342 | |
| Downregulated | Body | 0.156007596 | −2.082568147 | ||
| Upregulated | TSS1500 | 0.134644281 | 1.303540248 | ||
| Downregulated | 3’UTR, Body | 0.154268857 | −1.638461524 | ||
| Downregulated | 1stExon | 0.106699436 | −2.309531101 | ||
| Downregulated | Body | 0.162060676 | −1.769999863 | ||
| Downregulated | TSS200 | 0.111024436 | −3.022557431 | ||
| Downregulated | 1stExon,3’UTR | 0.109470333 | −1.184733905 | ||
| Downregulated | TSS200,TSS1500, Body | 0.15388695 | −1.554387492 | ||
| Hypo-methylated | Upregulated | Body | −0.100907626 | 2.020807828 | |
| Upregulated | Body | −0.129022244 | 1.599195067 | ||
| Upregulated | TSS1500 | −0.174751917 | 3.439724382 | ||
| Downregulated | Body | −0.205976918 | −1.661135603 | ||
| Downregulated | Body | −0.105378211 | −1.201323891 | ||
| Downregulated | Body | −0.119453723 | −1.459126795 | ||
| Downregulated | 5’UTR | −0.193317129 | −2.892963016 | ||
| Downregulated | 5’UTR | −0.131035527 | −1.530121946 |
FIGURE 4(A) Relative mRNA expression of selected TFs in normal and OA knee articular cartilage, assessed by RT-qPCR. *P < 0.05, **P < 0.01, ***P < 0.001. (B) Relative mRNA expression of selected TFs in cultured primary human chondrocytes (N = 3) treated with 5-Aza (10 μM) or vehicle for 4 days. Values are expressed as mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001.